MIME-Version: 1.0 Content-Type: multipart/related; boundary="----=_NextPart_01CC82DD.F65216E0" This document is a Single File Web Page, also known as a Web Archive file. If you are seeing this message, your browser or editor doesn't support Web Archive files. Please download a browser that supports Web Archive, such as Windows Internet Explorer. ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" Understanding evolutionary paradigm of knockdown resistance in mosquitoes by analyzing DNA sequence polymorphisms in voltage-gated sodium channel in Culex quinquefasciatus

Understanding evolutionary paradigm of knockdown resistance in mosquitoes by analyzing DNA sequence polymorphisms in the voltage-gated sodium channel in Culex quinquefasciatus<= span lang=3DEN-US style=3D'font-size:10.0pt;line-height:115%;font-family:"Times = New Roman","serif"; mso-ansi-language:EN-US'>

Manas Sarkar1*, Aparajita Borkotoki2, Indra Baruah1=

1Medical Entomology Division, Defence Research Laboratory (DRDO), Tezpur784001, Assam, India

2Department of Zoology, Gauhati University, Guwahat= i, Assam, India

*Corresponding author (Present address): Centre for Medical Entomology & Vector Management, National Centre for Disease Control, 22-Sham Nath Marg, Delhi-110054, India. Phone : +91-9999483978 [Mobile],

E-mail: manas_sarkar54491@yahoo.com 

Graphical Abstract

3D"Description:

 <= /o:p>

Abstract: The Vol= tage Gated Sodium Channel (VGSC) is critical for binding of different insecticides and plays a key role in insecticide resistance. The insect sodium channel consists of four homologo= us domains (I to IV), each containing six transmembrane segments (S1 to S6). An important mechanism of resistance to DDT and pyrethroids is termed knockdown resistance (kdr), caused by a s= ingle nucleotide polymorphism in the IIS6 domain of sodium channels. We analyzed = the polymorphisms, nucleotide diversity, and phylogenies in the vgsc-IIS6 gene in Culex quinquefasciatus<= /i> from India. We analyzed the neutral model/hypothesis to infer if natural selection is acting upon the vgsc gene. Taji= mas D, Fu and Lis D* and F* and Fus Fs test were performed to determine wheth= er the distribution of nucleotide variation within the samples was consistent = with the neutral model. We theorized that the evolutionary pattern of intra-population distribution of variability in vgsc gene is consistent with the neutral expectation.

 <= /o:p>

Keywords: Knockdown resistance; insecticide resistance; molecular evolution; neutral theory; natural selection; India

 <= /o:p>

 <= /o:p>


Introduction

Culex quinquefa= sciatus is the principal vector of bancroftian filariasis on the Indian subcontinen= t. Control of this vector has relied extensively on application of insecticide= s1. Because of continued and/or indiscriminate use of insecticides, increased resistance, especially against DDT has been observed in this part of the wo= rld2.

DDT and pyrethroids share a similar target site, t= he para-type voltage-gated sodium channel (vgsc). It alters the normal functions of the sodium channel. The prolonged channel opening causes increased nerve impulse transmission, leading to paralysis a= nd death of the insect3, 4. The transmembrane structure of para-type VGSC consists of four internally homologous domains (IIV), each having six transmembrane helices (S1S6). Extensive research has shown that kdr or kdr-like mechanisms have resulted = in mutations in sodium channels5. Mutations in the domain-II region= of the channel are commonly responsible for insecticide resistance. A single nucleotide polymorphism (SNP) (A to T) in the S6 hydrophobic transmembrane segment of domain-II of vgsc co= nfers insensitivity to pyrethroid and DDT. This resistance mechanism is known as knockdown resistance (kdr) and has been reported in many insects, such as Musca domestica6, Blattella germanica7 an= d Heliothis virescens8, 9. Mosquitoes with the kdr phenotype display a high level of resistance to both pyrethroids and DDT10-17.

Insecticide-binding simulation studies of vgsc with DDT and pyrethroids show= ed that most of the mutations conferring insecticide resistance were located in the domain-II of the vgsc gene<= sup>18, 19. However, information regarding the evolutionary pattern of this g= ene and knowledge of its phylogenetic lineage are not available for Culex mosquitoes. In Anopheles gambiae, there is eviden= ce for the multiple origin of kdr mutation in Africa20. In Culex, there is no published study= so far on polymorphisms, nucleotide, and/or genetic diversity and phylogeny of= vgsc associated with the molecular evolutionary pattern.

We, therefore, analyzed the polymorphisms and nucleotide diversities in the vgsc<= /i>-IIS6 gene to gain insight into the evolutionary forces at work in the insecticide-binding domain of the v= gsc gene conferring resistance to a population of Cx. quinquefasciatus from northeastern India. This is the first study presenting the data of DNA polymorphisms in the vgsc gene in relation with the mol= ecular evolutionary pattern of kdr traits in the most important disease vector Cx. quinquefasciatus. Given the scale of the resistance problem, this study is not only of academ= ic interest, but also crucial for devising appropriate resistance-management strategies.

 

Materials and Methods

Mosquito population and bioassays

In order to carry out the tests for selection base= d on allele frequencies, especially with relatively small sample size, it is important to assemble random samples from a population rather than ascertai= ned samples. We have assembled random samples of adult Cx. quinquefasciatus from foothill areas of Assam, northeast= ern India (2648′43.0′′N, 9235′39.3′′E; 2651′47.4′′N, 9233′48.7′′E; 2651′48.4′′N, 9232′27.6′′E; 2650′45.3′′N, 9235′33.2′′E). We considered these mosquitoes as a single population, because the collection sites are relatively close to each other. Insecticide susceptibility assays were performed on wild caught adult female mosquitoes using the WHO adult bioassay kit21. Mortality was determined 24 hours post-exposure. Resistance status of wild populations was compared to a susceptible referen= ce strain of Cx. quinquefasciatus, known as SLab, which was collected from Tezp= ur city of Assam and was reared for more than 10 years in the insectary of Defence Research Laboratoey (Tezpur) and considered to be > 90% susceptible to DDT and &g= t; 98% to other insecticides. We used the WHO criteria for evaluating resistan= ce or susceptibility in the mosquito population22.

Gene Amplification and Sequencing of PCR products

In this study, we amplified and sequenced IIS6 dom= ain of vgsc gene from a population = of Cx. quinquefasciatus collected from northeastern India. Genomic DNA from individual adult female Cx. quinquefasciatus mosquitoes was extracted using the= SDS extraction and ethanol precipitation method as described previously23<= /sup>. The DNA samples were air-dried and suspended in 100 μl of nuclease free water. We designed two primers, Cq1 (5'GTGGAACTTCACCGACTTC 3') and Cq2 (5' GCAAGGCTAAGAAAAGGTTAAG 3') to amplify a fragment of the IIS6 domain of the = vgsc gene, reported to contain the= kdr mutation site. The PCR reaction was carried out according to Sarkar et al.<= sup>17. PCR reactions were replicated twice, each experiment conducted on a differe= nt day.

PCR products were purified using the QIAquick PCR purification kit (Qiagen). A total of 100 PCR samples, 50 numbers each from knockdown resistant and knockdown susceptible phenotypes were sequenced on = both strands using an ABI automated DNA sequencer. Sequences were analyzed using BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Sequences were submitted to the National= Center for Biotechn= ology Information Open Reading Frame Finder (http://www.ncbi.nlm.nih.gov/projects/gorf/<= /a>) to determine the coding regions and introns.

Sequence analysis and polymorphism detection

Single nucleotide polymorphisms in IIS6 domain of = vgsc were detected as sequence differences in multiple alignments using CLUSTALW (http://align.genome.jp/). Electrophoregrams were visually inspected using BioEdit (http://www.mbio.ncsu.edu/BioEdit/BioEdit.html) and heterozygotes w= ere identified24. SNPs were identified as transitions or transversio= ns in coding and non-coding regions. Nucleotide diversity, polymorphisms, divergence, gene flow, and genetic differentiations among the populations studied were analyzed using DnaSP 5.00.02 (http://www.ub.es/dnasp)25.

Analysis of Data and Molecular Evolutionary Theories

Most intra-population (i.e., the single population tested for neutrality in this study) data analyses including estimates of= DNA polymorphisms, nucleotide diversity (π) number of segregating sites (S= ), number of haplotypes (h), haplotype diversity (Hd) were performed among 1= 00 sequences of the vgsc gene by subdividing the gene into functional domains (exons and introns). The data = were analyzed using DnaSP 5.00.02. We analyzed the neutral model/hypothesis (alternatively known as the null model; states that the vast majority of evolutionary changes at the molecular level is caused by random drift of selectively neutral mutants26), to infer if natural selection is acting upon the analyzed vgsc g= ene. Tajimas D test27, Fu and Lis D* and F*28 tests and = Fus Fs test29 were performed to determine whether the distribution of nucleotide variation within the samples was consistent with the neutral mod= el. Tajimas D test statistics is defined as the standardized difference between two estimators of the population mutation rate parameter θ (=3D 4 N = 56; for an autosomal region of diploid individuals; where N is the effective population size, and μ is the per-gene or per-site per-generation muta= tion rate). One estimator based on the number of segregating sites and other on = the average number of pairwise nucleotide differences, which should be equal un= der the neutral mutation model and should differ when natural selection affects= the genomic region. Fu and Lis D* test compares two estimators of the populati= on mutation rate parameter θ, based on the differences between the number= of singletons (mutations appearing only once among the sequences), and the tot= al number of mutations28. Fu and Lis F* test statistics is based on the differences between the number of singletons and the average number of nucleotide differences between pairs of sequences28, 30, equation 10. The Fs test statistic29, equation 1 is based on the haplotype (g= ene) frequency distribution for a given value of θ derived from the average number of pair wise nucleotide differences31, equations 19-21. We performed Coalescent simulations to estimate confidence intervals and exact P-values (10000 interactions) for Tajimas D, Fu and Lis D* and F* test, nucleotide diversity, linkage disequilibrium, number of haplotype and haplo= type diversity test. These simulations were conditioned on the observed number of segregating sites (S), and thus population size is not a factor.

Results and Discussion

Bioassays were carried out using 4% DDT and mortalities were recorded after 24 hour exposure. The mortality of Cx. quinquefasciatus with DDT ranged from 11.9% to 41.25% whereas mortality in SLab insects was estimated at 91.2%. This bioassay result suggests that Cx. quinquefasciatus population tested is highly resistant to DDT across all study sites. The details of insecticide resistance and/or susceptibility status, and detoxif= ying enzyme profiles of this population were described in our other publication<= sup>2.

Detection of kdr mutatio= n in wild population of Culex quinquefasciatus

We randomly sampled 50 DDT-resistant and 50 susceptible mosquitoes in search of polymorphisms in the insecticide-binding segment of vgsc gene. We found = two distinct sequence variants (i.e., knockdown susceptible or kds and knockdown resistance or kdr) after sequencing 100 samples. These two distinct sequence variants were submitted in GenBank under accession number FJ182226 and FJ970025. Figure 1 displays the sequence alignment of the knockdown= -susceptible and knockdown resistant population, which confirms the presence of the polymorphic site at position 127 (TTA to TTT) that induces the substitution of leucine to phenylalanine in resistant mosquitoes, as previo= usly reported by others in the same species 14, 15. However, we did not find any A to C mutation as reported by Wondji et al.15

Neutrality tests and evo= lutionary pattern of knockdown resistance

The sequences of the vgsc gene consisted of one exon and one intron region. We found four parsimony variable sites (127, 155, 157, and 176) in these sequences; = out of these one was found in the exon region (A127T, kdr mutatio= n) and three in the intron-2 region (Table 1). Polymorphic sites in the intron= ic sequences co-segregate with the kdr allele. Statistical analysis of polymorphism for the entire sequenced region and each functional domain of = the vgsc gene are summarized in Table = 1. In vgsc, nucleotide diversity in the = exon (π/site=3D0.0033) and intron (π/site=3D0.0038) was found to be al= most similar when compared with the entire gene (π/site=3D0.0037). However,= we observed a higher θ/site value for the intron region in comparison to = the exon and entire sequence (Table 1). This is probably due to higher mutation rate= per nucleotide per generation in the intronic region.

3D"Description:

Figure 1. Alignment of nucleic acids and corresponding amino acids of IIS6 domain of the para-type sodium channel gene from= two representative sequences of knockdown susceptible (FJ182226) and resistant (FJ970025) strain of Culex quinquefasciatus. Note the A to T change at nucleotide 127 and leucine = (L) to phenylalanine (F) at amino acid at 39 in the resistant strain. Alignment also displays four polymorphic sites: at position 155 (C-A), 157 (T-C) and = 176 (A-G) in the intron-2 region.

 

The polymorphic sites in different intronic region= s of the vgsc gene vary depending on= the mosquito species. We observed three polymorphic sites in intron-2 of Cx. quinquefasciatus whereas Pinto et al.20 reported eight polymorphic sites in intro= n-1 of the An. gambiae population t= hat explain the distinctive pattern of polymorphisms in different intronic regi= ons of vgsc in different populations.

We performed Fishers exact test for independence between sites (with Bonferroni correction) and Kellys ZnS to test linkage disequilibrium32. Only parsimony informative polymorphic sites w= ere considered for the analysis and results are presented in Table 1; there is = no evidence of significant nonrandom association between nucleotide variants at different polymorphic sites (P > 0.1). Recombination per gene in vgsc domain-II was very low (R=3D0= .001). The minimum number of recombination eve= nts RM=3D0. In the presence of non-significant linkage disequilibrium and very low recombination, it is not unexpected that the estimates of haplotype number = and corresponding haplotype diversity for vgsc do not deviate from the neutral expectations [number of haplotype, h=3D3; haplotype diversity, Hd=3D0.537 (0.09) with P=3D0.316] (Table 1 and 2). Nucleotide variations in synonymous and nonsynonymous sites in vgsc are presented in Table 3. We = found no singleton and synonymous mutation (Table 3).

3D"TextOne method for revealing the influence of selection on a sequence is by examini= ng the distribution of segregating variants at that locus in a population and testing this distribution against the neutral model33. We have u= sed the D statistics27, 28 to examine the hypothesis that all substitutions at the locus are neutral. Several possibilities were explored: using the whole region sequenced, only the coding region, or only the intro= n-2. Where appropriate, the significance of the test or parameter has been verif= ied by coalescent simulation (10000 repeats) (Table 2). The detailed results of neutrality tests including coalescent simulation are presented in Table 1 a= nd Table 2. Upon analyses of segregating variation, no statistics (D, F* or Fs) provide evidence for a significant departure from neutral evolution. The po= wer of neutrality test is limited in the presence of recombination34, but because recombination was very low, this may explain the lack of significant departure from neutrality. Overall, the evolutionary pattern of intra-population distribution of variability in the domain-II of the vgsc gene is consistent with the n= eutral expectation; hence there is no evidence that positive Darwinian selection h= as recently influenced, or is currently influencing, nucleotide variation in t= his region of the genome. Hence, there is a possibility that knockdown resistan= ce (kdr), associated with polymorphism= in domain-II of the vgsc gene, may= be caused by random drift of selectively neutral mutants. Should we then concl= ude that selection did not affect the nucleotide variation in vgsc and evolution of the kdr trait is largely due to genetic drift rather than natural selection? The present data are obviously not sufficient to tell apart the various scenarios that could have led to the present structure, because information at many independent loci is required= to make strong inference on past demographic factors that could affect the selection processes.

3D"TextOn the other hand, the neutral theory does not rule out the role of natural selection in certain scenarios of adaptive evolutio= n - such patterns are expected from neutrality. Hence, the molecular evolution of th= e vgsc domain may be dominated by selectively neutral evolution of segregating variants (polymorphic sites) at genomic level, but at the phenotypic level, changes in knockdown resistance were probably dominated by natural selection rather than sampling drift.

3D"TextOur observations provoked a hypothesis of possible evolutionary pattern of kdr allele in Cx. quinquefasciatus. Further critical study with whole vgsc sequences is needed to addres= s this problem. At this point, we have no means to claim any definite evolutionary mechanisms controlling knockdown resistance in mosquito by using the data f= rom the present study. We also suspect that the evolutionary puzzle regarding t= he origin of knockdown resistance in mosquitoes can be addressed successfully = by thorough analysis of intronic polymorphism in the entire vgsc gene between samples from different parts of the world. The study of a molecular evolutionary pattern of the insecticide-binding domain= of the vgsc gene in Cx. quinquefasciatus, described here, has important academic implications and opens a scope for a= future study with a holistic approach to identify definite evolutionary forces at = work in knockdown resistance.

 

Acknowledgments

The authors sincerely thank Dr. Banalata Sen, Environmental Health Perspectives (USA) for her careful proofreading of the draft manuscript. Defence Research & Development Organization (DRDO) financially support the study.

 

 =

 =

References<= /span>

1.      McCarroll, L. and Heming= way, J. (2002). Can insecticide resistance status affect parasite transmission in mosquitoes? Insect Biochem. Mol. Biol.= 32, 13451351.

2.      Sarkar, M., Bhattacharyy= a, I.K., Borkotoki, A., Goswami, D., Rabha, B., Baruah, I., and Srivastava, R.B. (2009a). Insecticide resistance and detoxifying enzyme acti= vity in the principal bancroftian filariasis vector, Culex quinquefasciatus<= /i> in northeastern India. Med. Vet Entomol. 23, 122-131.

3.      Soderlund, D.M., and Blo= omquist, J.R. (1989). Neurotoxic actions of pyrethroid insecticides. Ann. Rev. Entomol. 34, 7796.

4.      Narahashi, T. (1992). Ne= rve membrane Na+ channels as targets of insecticides. T. Pharmacol. = Sci. 13, 236241. =

5.&n= bsp;     Soderlund, D.M. and Knipple, D.C. (2003). The molecular biology of knockdown resistance to pyrethroid insecticides. Insect Biochem. Mol. Biol. 33, 563577.

6.&n= bsp;     Williamson, M.S., Denholm, I., Bell, C.A., and Devonshire, A.L. (1993). Knockdown resistance (kdr) to DDT and pyrethroid insecticides = maps to a sodium channel gene locus in the housefly (Musca domestica). Mol. Gen. Genet. 240, 1722.

7.&n= bsp;     Dong, K., Scott, J.G. (1994). Linkage of kdr-type resistance and the parahomologue sodium channel gene in German cockroaches (Blattella germanica). Insect Biochem. Mol. Biol. 24, 647654.

8.&n= bsp;     Taylor, M.F.J., H= eckel, D.G., Brown, T.M., Kreitman, M.E., Black, B. (1993). Lin= kage of pyrethroid insecticide resistance to sodium channel locus in the tobacco budworm. Insect Biochem. Mol. Biol. 23, 763775.

9.&n= bsp;     McCaffery, A.R., Holloway, J.W., and Gladwell, R.T= . (1995). Nerve insensitivity resistance to cypermethrin in larvae of the tobacco bud= worm Heliothis virescens from USA cotton field populations. Pestic Sci. 44, 237247.

10.   Chandre, F., Darriet, F., Darder, M. et al. (1998). Pyrethroid resistance in Culex quinquefasciatus from West Africa. Med. Vet. Entomol. 12, 359366.=

11.   Martinez-Torres, D., Chandr= e, F., Williamson, M.S. et al. (1998). Molecular characterization of pyrethroid knockdown resistance (kdr) in the major mala= ria vector Anopheles gambiae s.s. Insect Mol. Biol. 7, 179184.

12.   Martinez-Torres, D., Chevil= lon, C., Brun-Barale, A., Berge, J.B., Pasteur, N., and Pauron, D. (1999). Voltage dependent Na+ channels in pyrethroid resistant Culex pipiens L mosquitoes. Pestic= . Sci. 55, 10121020.

13.   McAbee, R.D., Kang, K.D., Stanich, M.A. et al. (2004). Pyrethroid toler= ance in Culex pipiens pipiens var mo= lestus from Marin Country, Californi= a. Pest Manag. Sci. 60, 359368.

14.&= nbsp;  Xu, Q., Liu, H., Zhang, = L., and Liu, N. (2005). Resistance in the mosquito, Culex quinquefasciatus, and possible mechanisms for resistance. Pest Manag. S= ci. 61, 10961102.

15.&= nbsp;  Wondji, C.S., De Silva, W.A.P.P., Hemingway, J., Hilary, R., and Karunaratne, S.H.P.P. (2008). Characterization of knockdown resistance in DDT and pyrethroid resistant Culex qu= inquefasciatus population from Sri = Lanka. Trop. Med. Int. Health 13 (4), 548555.

16.&= nbsp;  Zhou, L., Lawrence, G.G., Vineis, J.H., McAllister, J.C., Wirtz, R.A. and Brogdon, W.G. (2009). Detection of broadly distributed sodium channel alleles characteristic of insect pyrethroid resistance in West Nile Virus vector Culex pipiens complex mosquitoes in the = United States. J. Med. Entomo= l. 46 (2), 321327.

17.&= nbsp;  Sarkar, M., Borkotoki, A= ., Baruah, I., Bhattacharyya, I.K., and Sri= vastava, R.B. (2009b). Molecular analysis of knock down resistance (kdr) mutation and distribution= of kdr genotypes in a wild population of Culex quinquefasciatus from India. Trop. Med. Int. Health 14 (9), 10971104.

18.   OReilly, A.O., Khambay, B.P., Williamson, M.S., Field, L.M., Wallace, B.A., and Davies, T.G.E. (200= 6). Modeling insecticide binding sites in the voltage gated sodium channel. Biochem. J. 396, 255263. =

19.&= nbsp;  Usherwood, P.N., Davies, T.G., Mellor, I.R., O'Rei= lly, A.O., Peng, F., Vais, H., Khambay, B.P., Field, L.M., and Williamson, M.S. = (2007). Mutations in DIIS5 and the DIIS4-S5 linker of Drosophila melanogaster sodium channel define binding domains for pyrethroids and DDT. FEBS Lett. 581 (28), 5485-5492.

20.   Pinto, J., Lynd, A., Vicente, J.L., Santolamazza, F., Randle, N.P., Gentile, G., Moreno, M., Simard, F. et al. (2007). Multiple origin of knockdown resistance mutation in the Afrotropical mosqui= to vector Anopheles gambiae. PlosOne 2= (11): doi: 10.1371/journal.pone.0001243

21.&= nbsp;  W.H.O. (1998). Test procedure for insecticide resistance monitoring in malaria vector, bio-efficacy and persistence of insecticides on treated surfaces. Document WHO/CDS/CPC/Mal/98.12. Geneva, Switzerland.

22.   W.H.O. (1992). Vector resistance to insecticides. 15th Report of the WHO Expert Commit= tee on Vector Biology and Control. World Health Organization Technical Report Series 818, Geneva, Switzerland, pp. 162.

23.   Coen, E.S., Strachan, T.= , and Dover, = G. (1982). Dynamics of concerted evolution of ribosomal DNA and histone gene families = in the melanogaster species subgroup of Drosophila. J.Mol. Biol. 158, 1735.

24.   Black, W.C., Baer, C.F., Antolin, M.F., and DuTeau, N.M. (2001). Population genomics: geno= me-wide sampling of insect populations. Ann. Rev. of Entomol. 46, 441-469.

25.&= nbsp;  Librado, P., and Rozas, J. (2009). DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatic= s: doi:10.1093/bioinformatics/btp187.

26.&= nbsp;  Kimura, M. (1983). The neutral theory of Molecular Evolution. (Cambridge University= Press, Cambridge, <= st1:State w:st=3D"on">Massachusetts).

27.&= nbsp;  Tajima, = F. (1989). Evolutionary relationship of DNA sequences in finite populations. Genetics = 105, 437-460.

28.&= nbsp;  Fu, Y.X., Li, W.H. (1993). Statistical tests of neutrality of mutations. Genetics, = 133, 693-709.

29.&= nbsp;  Fu, Y.X. (1997). Statistical tests of neutrality of mutations againstpopulation growth, hitchhiking and background selection. G= enetics 147, 915-925.

30.&= nbsp;  Simonsen, K.L., Churchill, G.A., and Aquadro, C.F.= (1995). Properties of statistical tests of neutrality for DNA polymorphism data. Genetics 141, 413-429.

31.   Ewens, W.J. (1972). The sampling theory of selecti= vely neutral alleles. Theor. Pop. Biol. = 3, 87-112.=

32.&= nbsp;  Kelly, J.K. (1997). A test of neutrality based on interlocus associations. Genetics <= span style=3D'mso-bidi-font-weight:bold'>146, 1197-1206.

33.&= nbsp;  McAllister, B.F., and McVean, G.A.T. (2000). Neutr= al evolution of the sex-determining gene transformer in Drosophila. Genetics 154, 17111720. =

34.&= nbsp;  Wall, J.D. (1999). Recombination and the power of statistical tests of neutrality. Genet. Res. 74, 6579


 

------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/item0001.xml Content-Transfer-Encoding: quoted-printable Content-Type: text/xml ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/props002.xml Content-Transfer-Encoding: quoted-printable Content-Type: text/xml ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/themedata.thmx Content-Transfer-Encoding: base64 Content-Type: application/vnd.ms-officetheme UEsDBBQABgAIAAAAIQDp3g+//wAAABwCAAATAAAAW0NvbnRlbnRfVHlwZXNdLnhtbKyRy07DMBBF 90j8g+UtSpyyQAgl6YLHjseifMDImSQWydiyp1X790zSVEKoIBZsLNkz954743K9Hwe1w5icp0qv 8kIrJOsbR12l3zdP2a1WiYEaGDxhpQ+Y9Lq+vCg3h4BJiZpSpXvmcGdMsj2OkHIfkKTS+jgCyzV2 JoD9gA7NdVHcGOuJkTjjyUPX5QO2sB1YPe7l+Zgk4pC0uj82TqxKQwiDs8CS1Oyo+UbJFkIuyrkn 9S6kK4mhzVnCVPkZsOheZTXRNajeIPILjBLDsAyJX89nIBkt5r87nons29ZZbLzdjrKOfDZezE7B /xRg9T/oE9PMf1t/AgAA//8DAFBLAwQUAAYACAAAACEApdan58AAAAA2AQAACwAAAF9yZWxzLy5y ZWxzhI/PasMwDIfvhb2D0X1R0sMYJXYvpZBDL6N9AOEof2giG9sb69tPxwYKuwiEpO/3qT3+rov5 4ZTnIBaaqgbD4kM/y2jhdj2/f4LJhaSnJQhbeHCGo3vbtV+8UNGjPM0xG6VItjCVEg+I2U+8Uq5C ZNHJENJKRds0YiR/p5FxX9cfmJ4Z4DZM0/UWUtc3YK6PqMn/s8MwzJ5PwX+vLOVFBG43lExp5GKh qC/jU72QqGWq1B7Qtbj51v0BAAD//wMAUEsDBBQABgAIAAAAIQBreZYWgwAAAIoAAAAcAAAAdGhl bWUvdGhlbWUvdGhlbWVNYW5hZ2VyLnhtbAzMTQrDIBBA4X2hd5DZN2O7KEVissuuu/YAQ5waQceg 0p/b1+XjgzfO3xTVm0sNWSycBw2KZc0uiLfwfCynG6jaSBzFLGzhxxXm6XgYybSNE99JyHNRfSPV kIWttd0g1rUr1SHvLN1euSRqPYtHV+jT9yniResrJgoCOP0BAAD//wMAUEsDBBQABgAIAAAAIQAw 3UMpqAYAAKQbAAAWAAAAdGhlbWUvdGhlbWUvdGhlbWUxLnhtbOxZT2/bNhS/D9h3IHRvYyd2Ggd1 itixmy1NG8Ruhx5piZbYUKJA0kl9G9rjgAHDumGHFdhth2FbgRbYpfs02TpsHdCvsEdSksVYXpI2 2IqtPiQS+eP7/x4fqavX7scMHRIhKU/aXv1yzUMk8XlAk7Dt3R72L615SCqcBJjxhLS9KZHetY33 37uK11VEYoJgfSLXcduLlErXl5akD8NYXuYpSWBuzEWMFbyKcCkQ+AjoxmxpuVZbXYoxTTyU4BjI 3hqPqU/QUJP0NnLiPQaviZJ6wGdioEkTZ4XBBgd1jZBT2WUCHWLW9oBPwI+G5L7yEMNSwUTbq5mf t7RxdQmvZ4uYWrC2tK5vftm6bEFwsGx4inBUMK33G60rWwV9A2BqHtfr9bq9ekHPALDvg6ZWljLN Rn+t3slplkD2cZ52t9asNVx8if7KnMytTqfTbGWyWKIGZB8bc/i12mpjc9nBG5DFN+fwjc5mt7vq 4A3I4lfn8P0rrdWGizegiNHkYA6tHdrvZ9QLyJiz7Ur4GsDXahl8hoJoKKJLsxjzRC2KtRjf46IP AA1kWNEEqWlKxtiHKO7ieCQo1gzwOsGlGTvky7khzQtJX9BUtb0PUwwZMaP36vn3r54/RccPnh0/ +On44cPjBz9aQs6qbZyE5VUvv/3sz8cfoz+efvPy0RfVeFnG//rDJ7/8/Hk1ENJnJs6LL5/89uzJ i68+/f27RxXwTYFHZfiQxkSim+QI7fMYFDNWcSUnI3G+FcMI0/KKzSSUOMGaSwX9nooc9M0pZpl3 HDk6xLXgHQHlowp4fXLPEXgQiYmiFZx3otgB7nLOOlxUWmFH8yqZeThJwmrmYlLG7WN8WMW7ixPH v71JCnUzD0tH8W5EHDH3GE4UDklCFNJz/ICQCu3uUurYdZf6gks+VuguRR1MK00ypCMnmmaLtmkM fplW6Qz+dmyzewd1OKvSeoscukjICswqhB8S5pjxOp4oHFeRHOKYlQ1+A6uoSsjBVPhlXE8q8HRI GEe9gEhZteaWAH1LTt/BULEq3b7LprGLFIoeVNG8gTkvI7f4QTfCcVqFHdAkKmM/kAcQohjtcVUF 3+Vuhuh38ANOFrr7DiWOu0+vBrdp6Ig0CxA9MxEVvrxOuBO/gykbY2JKDRR1p1bHNPm7ws0oVG7L 4eIKN5TKF18/rpD7bS3Zm7B7VeXM9olCvQh3sjx3uQjo21+dt/Ak2SOQEPNb1Lvi/K44e//54rwo ny++JM+qMBRo3YvYRtu03fHCrntMGRuoKSM3pGm8Jew9QR8G9Tpz4iTFKSyN4FFnMjBwcKHAZg0S XH1EVTSIcApNe93TREKZkQ4lSrmEw6IZrqSt8dD4K3vUbOpDiK0cEqtdHtjhFT2cnzUKMkaq0Bxo c0YrmsBZma1cyYiCbq/DrK6FOjO3uhHNFEWHW6GyNrE5lIPJC9VgsLAmNDUIWiGw8iqc+TVrOOxg RgJtd+uj3C3GCxfpIhnhgGQ+0nrP+6hunJTHypwiWg8bDPrgeIrVStxamuwbcDuLk8rsGgvY5d57 Ey/lETzzElA7mY4sKScnS9BR22s1l5se8nHa9sZwTobHOAWvS91HYhbCZZOvhA37U5PZZPnMm61c MTcJ6nD1Ye0+p7BTB1Ih1RaWkQ0NM5WFAEs0Jyv/chPMelEKVFSjs0mxsgbB8K9JAXZ0XUvGY+Kr srNLI9p29jUrpXyiiBhEwREasYnYx+B+HaqgT0AlXHeYiqBf4G5OW9tMucU5S7ryjZjB2XHM0ghn 5VanaJ7JFm4KUiGDeSuJB7pVym6UO78qJuUvSJVyGP/PVNH7Cdw+rATaAz5cDQuMdKa0PS5UxKEK pRH1+wIaB1M7IFrgfhemIajggtr8F+RQ/7c5Z2mYtIZDpNqnIRIU9iMVCUL2oCyZ6DuFWD3buyxJ lhEyEVUSV6ZW7BE5JGyoa+Cq3ts9FEGom2qSlQGDOxl/7nuWQaNQNznlfHMqWbH32hz4pzsfm8yg lFuHTUOT278QsWgPZruqXW+W53tvWRE9MWuzGnlWALPSVtDK0v41RTjnVmsr1pzGy81cOPDivMYw WDREKdwhIf0H9j8qfGa/dugNdcj3obYi+HihiUHYQFRfso0H0gXSDo6gcbKDNpg0KWvarHXSVss3 6wvudAu+J4ytJTuLv89p7KI5c9k5uXiRxs4s7Njaji00NXj2ZIrC0Dg/yBjHmM9k5S9ZfHQPHL0F 3wwmTEkTTPCdSmDooQcmDyD5LUezdOMvAAAA//8DAFBLAwQUAAYACAAAACEADdGQn7YAAAAbAQAA JwAAAHRoZW1lL3RoZW1lL19yZWxzL3RoZW1lTWFuYWdlci54bWwucmVsc4SPTQrCMBSE94J3CG9v 07oQkSbdiNCt1AOE5DUNNj8kUeztDa4sCC6HYb6ZabuXnckTYzLeMWiqGgg66ZVxmsFtuOyOQFIW TonZO2SwYIKObzftFWeRSyhNJiRSKC4xmHIOJ0qTnNCKVPmArjijj1bkIqOmQci70Ej3dX2g8ZsB fMUkvWIQe9UAGZZQmv+z/TgaiWcvHxZd/lFBc9mFBSiixszgI5uqTATKW7q6xN8AAAD//wMAUEsB Ai0AFAAGAAgAAAAhAOneD7//AAAAHAIAABMAAAAAAAAAAAAAAAAAAAAAAFtDb250ZW50X1R5cGVz XS54bWxQSwECLQAUAAYACAAAACEApdan58AAAAA2AQAACwAAAAAAAAAAAAAAAAAwAQAAX3JlbHMv LnJlbHNQSwECLQAUAAYACAAAACEAa3mWFoMAAACKAAAAHAAAAAAAAAAAAAAAAAAZAgAAdGhlbWUv dGhlbWUvdGhlbWVNYW5hZ2VyLnhtbFBLAQItABQABgAIAAAAIQAw3UMpqAYAAKQbAAAWAAAAAAAA AAAAAAAAANYCAAB0aGVtZS90aGVtZS90aGVtZTEueG1sUEsBAi0AFAAGAAgAAAAhAA3RkJ+2AAAA GwEAACcAAAAAAAAAAAAAAAAAsgkAAHRoZW1lL3RoZW1lL19yZWxzL3RoZW1lTWFuYWdlci54bWwu cmVsc1BLBQYAAAAABQAFAF0BAACtCgAAAAA= ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/colorschememapping.xml Content-Transfer-Encoding: quoted-printable Content-Type: text/xml ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/image001.png Content-Transfer-Encoding: base64 Content-Type: image/png iVBORw0KGgoAAAANSUhEUgAAAlgAAAHCCAYAAAAzc7dkAAAAAXNSR0IArs4c6QAAAARnQU1BAACx jwv8YQUAAAAgY0hSTQAAeiYAAICEAAD6AAAAgOgAAHUwAADqYAAAOpgAABdwnLpRPAAAAAlwSFlz AAAuIwAALiMBeKU/dgAAAAd0SU1FB9oMHgs4FuVZvg8AAAAcdEVYdFNvZnR3YXJlAEFkb2JlIFBo b3Rvc2hvcCA3LjDJbLm3AAD/PklEQVR4Xux9B1hUWbZ1T5733sz8k3q6p6ejHbTbnLNizjmjIKBg QATJOQoC5qyYcwBEwZwTSM45J7N2ns4961/7FheKskC6tXvsmbrfd76qunXvCfvsW2fV3vus/TMA pc8999wfWQyHQQIGCRgkYJCAQQI/qAS45tTWr77/2c+ee+7rb759rrTi9nPffPvtcz/jCbXIxdr3 qDfL9/qOp3W+oXZ129Ttm3b7un1RPzd2TUPt6pOB2peGvmtIFnKftox/8YtfPCJKTZ0/f44zUSt/ OSflX//613N89xz+pSnP/VyurZvXxhRId+y6c91U5VPrUceu+1qnJ8899//+99fP/fznGn2R+37+ 858rRX2v3Qf1vfq9Pn1rTK5a/f9QhPUpi+EwSMAgAYMEDBIwSOAHlwAXZ0j59ttvtco3+OKLL5Fb VIGs/FJkF5Qhp7Bc+SxF3usWfd+p5/KKK6Fb8kuqoK8UlFajodLQPdrnG2tHt97CspuQUlR+q14p rrgN7aJe931etdts7H5pr6TyDkqr7qL85n2lVNx6UK+UV9/n9/dRxlJadY/Xs1TcRVHZbRSU3ER+ cTXlXM1X/bLVlZ/0TbtPuuOW/uie+66fH5EtZX3r9m3cuXMH9+7dw/379/Hw4UN88MEH+PDDD/Hx xx/j008/xT//+U989tln1MMv8OWXX+Krr77CN998U6ujqt7KaxOPTwVgvd/Eiw2XGSRgkIBBAgYJ GCTwRBLQB7BkIfucC1sugZQKsFSQpQ9caZ+T69SinleBVkOAS134VTCiD4joA136ANfjAJZu3boA QN9n7bbVNvUBM3336o5N3xjlPhVclVXfqwVVlbcfQrsI6BIAJqUO/NxSQFJjIFNkog9cqf1VwZ3U qRYVSDVFPt/lmmKOtbKyClVVVbh165YCtO7evVsPaOkDWQKwvv766ycBWO8bANYT/VQYbjZIwCAB gwQMEmiKBLQtANoWLAFXX3/9FT77/HMFYGXmldQCJm3w1NT32pYvXYD1OIuKNhj6dwAstX19AEvX +tOQdUpfv/WBPH0ASyxYugBLAJgUAVkCggTcaPdTZNoUi6H0698BsIrKb6K4pAQlJaUoLy9XgNbN mzdrLVoPHjxQrFnaIOtz6qJqxdIGWWJ1VfW4CTpvAFhNEJLhEoMEDBIwSMAggSeUgDbAUt2DAq7E UiDln3TPCDgSgCVWLG1LVlPBla5rURtgPQ5cqYu/PpCjgpYf2oL1tAFWY9YzbYCl7SJsDGCpVqyf EsCSvubm5iI/Pw+FhYUEWiW1QEssWmLN0gVZTXEVNuFxMACsJgjJcIlBAgYJGCRgkMATSkAfwBLr gAZgfYlPGQOTU1hGgFVMcCUgSyxZEo/13YrUISW3SGK4NCWvuIIuK3FbaUpBaSWtMFUsEhMklhUp EhslMVKacwWlVY8U7TrU91K3dqnfTl0bdW1p2tEu6ne6bT+uLt37NJ+lTbVoj69ujMUVN2mRus1y h9YpicG6p5SKWxKHVVcEeGlbsLQBVp2lTOKv6stAV94amVfVjrm44hatYeKmlDgwTVHP6crmyT6L ta0K6ekZyMzIQE5ODvLy8lBUVISysjK6DitrrVkCstSYLInHUq1YYsnSZ8VqwuPQOMDKLb0Lz8Nl 8Dx6Hx5RfG8oBhkYdMCgAwYdqK8DR+/C7ch9hEZkK24uw/GoBBqzXskCJuUTBhpnF5QQYBURXAnI KlY+f9eSU1hKgFVKYCUgS1PyissVEKCWOoClASIagKUpKjiRa3SLdh3qe6lbuzTWjm5bum3qtq3d hm6f6wMpbVD16Hvt8cn7OoB1mwDqDsGVgCxNqbglYKvuc8MuQs3mAI2LUABWw3KQcUj/1X5I+1JK KgVkaYp6TnsOGhuj7pj0fmYbhWw3ITERiSypqanIqAFaqjWroqJCAVliyZLgdwFZn3zyiRL0/riA 98c8640DrLPXM9DL5SwWnP0MXon/glvct4ZikIFBBww6YNCBGh1wv/EtvJKAybuqMWzhFu5SumvA V3ok8DiA9cXnX+BjLmoagPXkFixt65V+C1Z9y5I+a9KzZMES8CL90W+x0lipGiu6ViCxFon1SqxY 2hYsDcCSHYUSd6UBWQ0BLG23qSYGq2FLnj4Llrb1SteC1RTw2BTLloxTgN2169dxnSU+Ph5JSUm0 aKUr1qyCggKUlpYqlixxF8ouQ+14LHEVNraj8PsDrH99g5OXk9DFOhzDV2TD/fJX8I8HfOMMxSAD gw4YdMCgA6ID8ptoE/0+urlexNC5q1BRUQ5GwRpAlo4EHgewxB3zEbfLizswI1cAliYGqylFNz6r oSD3ZzkGSzf2St8OPTnXGKVEU4PbJdZMgtXV3YECoNQYLO1XFVipAe6qe1DuVy1Xaj+fdpB7U+gp mrKTUMZZQLlduHCR5QKuXr2KGzduIDk5udaSJe5CCX6vrq5+xIqlxmKpOwpV2gbdDRsNPPANW7D+ 9c1XOHYuDt1sItHJ5QYGhxTCZPcnmLn3c8zc85mhGGRg0AGDDvxX64AZfwunbHmAPt7JaGNzBkPn rUIh/xH/69tvDADrMQBLs3Pwa8U6IOXzzz/Dhx99VAuwJNBdO9i9MaDVVIDVEHXAd9mN90MFuf9Q AKshGgoVYKkgShdgNQauVIClD1Rpn3sSmoanCbDEenbq1GmWUzh//vwjIEtisiTwXaxYt8mXJTxZ 77//vuImbEqweyO8WI8BWGc1AKubRyJ6+6RhQFAehiwtwZBQQzHIwKADBh0w6ICRfwZ6esSjvd05 xYJVkJ9vAFhNcBFqAyyJc/mM8S4fMPZFY8HSgKsfAmCpAEDXGvTv5sGS9vVRM2hTIDTVgtUQD5Y2 zUNjAEsfuNK2XmlzYIk8Zafms2zBEoAVHR2N6GPHakHWtWvXFHehxGRlZ2cruwsl6F2NxRKAJbQN 2sHu8ofgOxKPNgVgRaCbewL6+qbBKCAb/RfnGopBBgYdMOiAQQeoA0Z+6ejlmYD2tmc1AKvAALD0 me90mdvV3YMa69XnCpP2++9/UA9gqTQN2tYrXdClj76hKS7ChhjWdYFOYwzv+ghGdbmqmuLGUnml tN1u2kCwqezzj6N40O6bSjSqTdWgDax03YLa/Fd1ge2PsuXrWrB0QZ0+YlFdgtGmWK+aSroqdUuf IiMjERERgZiYGJw5cwYXL15UYrIkHkuC3lUrlnBkCRGpuqNQ9LIhTqwmMLs3AWAtIMBy0wCsfgRY AwLzDMUgA4MOGHTAoAOBKsCiBcsAsBp1izYGsMQN8yndMQ8fvo9sxl2pFiwDwHqUDb0p1qmGSEqf ZYClDUSfLsC6owTfHzx4EAcOHMCRI0dw/PhxnDt3DpcvX65nxZJYLNlRqLoJJdj9PxJg9Q3IRV9/ sZT9sGCuPxdJaUdpq2bBlFejmvalHz8WoFTb7PcDj/lpjUfmRp2nH2OunqTfItMfS6f09bOpbYtM VT2Q1ycZ8491r6IHfH6eZn/1PZc/1ni+WzsGgNXUYLMfG2DpWrEair+qb6ESN119V92PYcHStppp XIL1mdG/Ww7Fhl2NjQEs7YB31Xqlzdyua2VTXYMN537U5CYUeRaWCReV5F4Uriv9uQZ1AZZmHhov TbEOFjMVTx5dmHv37sOePXtw+PBhHKOr8PTp04oVKzY2Vgl4z8zMVHYUiptQdhNKHJYALO04rO+R OudxFqxYdFsQTgtWPC1YqbRgZfFHX374Gyp56EezeU/fHHT3zkY3lq5ejxb5Tn6UByqg5tG6Ri7N x5jlBRjImK/G22usL4//TtoftaxAKfJe3J+92PehwXlK+6N5/odsX7vuYSH5GMs2By/5Ycf85OPR zHFf/xzIPEmfRVbyWeT35PU/vTpkTmU+pU/DQzU6NegH1qnvo8/STwEovf00uid6N4L9fdbkqW9s Ik/RAZHv05p73efyadX79OvJoYswjS7CG7RgMch97kqDi7ABxNUQwFLir8SC9alYsB7SglWi7CJU qRokJkslHZVXbQoHlYhU24WoISXVEI3W5SV8lGhUQ+CpgoD6hKJNSfAs9+ujJXiUSkGT3LnxoiE1 1bQr/dIl7awjSK1PdKq//9r0Eg0TlQoPlSbZs+omVEGW9qvqGnw8wHqUokHD21VHbqqkrKkhGJXX +gCpjni1IZJXXdqMx8tVM8Y8Es3u2rUbO3furLVinThxQrFiSSyW8GOJmzCf8ZNC2SBxWNoAS+XD amwn4ffbRXg2Ft0JsLoTYBkRYPUnwBrIxaqh0n9xDsYsy4fTvgr4RVQh4Eg1QmNuYs3p21h7RlNW nrwN/8hqTFpVQACWRdCWU1tfH79sTF1TiIoHX+KDf34Dl/0V6OnTeJuN9aex73r5ZMNySwnufvSV UuR9d/ZH+phbzR0tbD/v5mdK32Sh+77tPO6+AUosTw6u5n+Mjz//Btsu3UP3H2jMj+tLU76Xvkos 3vqzd3D7A2Yc/+Zf+Oizb7Dq1C30JUCQRawp9fwY1/SmPrkeqMDVvI9RfOdz6tTXMNtUTNCV/aP0 san6LM/AKILV8ISHyKr8J+5//DWOJj9Uno8fQ07ft40e7F9ozC1Fb7OrPiMoJPjWep6/T736nks5 933q+uHvyUE/AqzeBFgdDQCryS5CNcBdFiwVYIml4MEDAVjFBFhFtWSjwoulko7KqzYJqUpEqv29 Skqqko2qhKO6RKO6ZKDahKL6yESbSjD6fclA5T7tNh5H2tlY/xsaS/2+PW2A9SjJqNqeLrmoNqGo PnJQ4cDSR/Kqe64pXFnSlhDNbt+xA9u2baMlay/Cw8OVWKyzZ8/iypUrSEhIUHix1DgsoWsQPiwB /Gqguz7C0acQgyUA6zAB1g0CrBQCrEz+0Akg0l8EDDnvL0dO9T/xMRdd9bhe8DECo6qw5swt3Cj6 GJ/wB/nOh19hy8W7tCjk0PohP6A5XPiyMHNjUe19S45Vo5tX423q9mXAYk1djyuyONjtLqtty3ZX mdLWwbj7+Pyrb5XzNx9+qdQjoOJx9X2X76WPA2r6KHVLqSSolONk2ge0+n23MX+Xtp/k2kHsc3fv TKwjCJUjlvMamfBAeX+PIFXG9LRl9ST97eOXhXnbSqiPn9XO86wwAVgCXJ7unKr1aetfU/VZ9H/i qnxczf2wtp/nsj58ZvVAHavo6fbLGmLNz778ln+uaImreZa/i3y1Zab7XMozKue+S30/3rXZBFip BFhxBFinacFaYbBgNcGCpeYflAD3Hwtg6WNzbwikNB1g1WcvV9nK9aWqaZwIVAMoNJar+kDlSYFW w6zyGoClWrH0Wa+0dw42xYKlK7fvA7CaCq5U69jjCFbFUiZzv2XrVmzZskVxEx46dAhHjx5V3IRq HFZaWpqSr7C4uFhJBq2yuuvuJJQ/Bfq4sJ7AgnWIACsORj7JBFgZ/KETANNAIXAYQsDUk4vw3mv3 lDbl3+2o0Fx08eB2Zp9M9GKx3l5CgKUBFMdT38cg1tePP8z9aRkZFpyL5cdvYivB1yQuOv385ce1 kTa1vuvLBVXqUK5XgFbDRdobvTSPlpjbShnD99JWR/d0nE7/QOlbxf0vlDr6P6aupvZPxmnENmrH JPWySJ/dD1Zg99V7sNpSTLdD08fc1LafxnXSd5mTWx98pcjHnoufzOnm83dorazSyOkpyepp9Ffk 3cE1HcHHqmr132JzEQGWANim6dR3uU5X/76LPssGEpGv6JwcpzMEaD/mefsBxvBdxiv9NV1fiF1X 7mEx51/kPUB9/prSN+qKIjNVZ/iq+1zKMyrnvku/fsxr+/ml1ACsUwaA1cAqI6e1XYSNA6zv4yLU 5C3UFDVvoeom1LgKVTb3+rvctF1vdW5CffkG9Z9TU8Ro3GMqW7n2ot+UOCG5XnUPqm5HNbZJQ4Gg Xep27tW5FNVxNJ47sb77snGApboOm+4ifDQgX9OeuP407sC6XIOqe1DbLai6UfXngNTHqt8U2co4 ZO7DwsJYNtNVuEsJeBeAdfLkSVy6dEkhHhW6Bm2AJTsJtS1Y2jsJny7Asj6I7q6x6OudhP7+6VxA ufg3Ugbwu87uafzR1fyzFYA1dqkEg2ZCvhtAN2M3z3Qs2FFca+XaevGOcm5QoACkLIKxdHR0S+OP b6ZyTtqT+4z8M5VzUuS9nJPv+vF9ZwIji02FSC37BCbr89HdS9NXqU+9Tyxwcq3cL/fKZ+mrtCXn B/F6aftU+vu1AEuu61PTptynWPFqxq/WpfZJxiffyVi1+6n2X/o0LDgbV2ip8I+sVNpWxyDfdXBl PIdPRu2YG2pH2tWeA2lXzsk4pagyUfug3eeG5u4R+SpjrT/XIhvv8Iran9Hpa/MVeXXl3PX0Jhho QC+knvpyz6o/jzX3SR/UPmvLuiE5a7ene42iH6xX9Co0proOYFFHRMbKnNTIrXaudOZXrV/kpzun 6lw/Tv9kTPr0WW1f1c3eBH3Sj3IVYFEHRa6NjVFXD7Sv1X5WpF65VvqsLV/1fuUZ0dJZ3XqV8dc8 N+q1cr20J/XJ8yNj1JaJ5tmrLzfteuV+0f9Fu0uQUvop/4TlkGtPMy+6z2U9Xdf9HdCjpyJzVR+k LumXOj7ld0hHr/WNX3cs+nRbqZeW/d4eseiw8CSGzqEFy8CDpRdmNQSwZOGSGJc6F+F330WoS0Kq UjeoMVhqwLs+WoWmxVup8VGPvjZGS9BUKgF9vFL1AZZ+OoSmBL9rX6NLIaFtwdKNxdJHp6DPitUQ nYS6OUBljdelYtAFR9rxVLos8Q2NsynyVQHW5s2bsWnTxto4rKioKAVgSaD74wCW7k7CpwqwuhFg dXO5jr5eiUq8wQD5wXpM6fIIwKIb0Dej3n3y43oxW2MpEveS8Zo8gqI0LohptIJlYewyBvwu0fzY SunD+8cszcGMdfmYuCIXI0L4b3mx/PBnYPzyXCyNqUL1Q82/f9f9pZi4koHYfhnKfcNYj9Q3kNdL nfJezktb6ufBbFPa6eKRRguWBmCV3ftCcz9Bkdwzmu3LNVKvvE5gP6Qd+U6tX9oQ4CHfybmRofKv PENpx+NQOZJKPlHq3n7pDvudo4y1s3uqIhsZn4xLWRSUhSGTi046BhNkSn0ydnmVz3Je2pJre3rL 4pap3DuK7fXgZ1WGY2rGLX2Wax6ZO56Txag3xyn3T12dp/RfxmrEe+Q+aUeukTFsPq9xD8rhvK9U kb3aD9265bz0U+qR/sj41DrlvchnWLAs0hmKjIZTztK+Kk/5TuZXxjxF6/ygQM24ZTzy2oPgVM7J dcbs+zjKVerq7Uvwx/kMja6zYJlvLNDIi/dJ32RMk1flKe3KmKUfMudSt/Rf3ksb0ieR/xReO5z9 kntV4NGY/unTZ2lb1emRlLm0L/0W+ddasKiDoou1esCxyLxPor5N47Mi8lP7pzuvqm6qchS5iEzk fhmD9FfqkVeRhchfPsvY5B6ZKxm31N9LGadGN6TN/pSP9Fn0TJ5X+V79Tq5X+yv1yrVS56RVmmdB 5kjqFRlPo7zXnbmJB59orKFztxQpfZD6pF7d51LG2BQ9lbGoz4z0V8YsfZH+qs+j6KAG7AkA1PRH 2p5O2YicpO3H/cap34tlv5f7dbS3OUGAtdwAsPTCq4YtWCoH1scff8TA4gffi6bhPx1gNUTkqW9n pC4ZaWMASwU/2mBKXIXan1U34eN4sPSxtgtQehzAaojgtSnA97sArE2bNmHjxg3YwVis/fv3K3QN EuguACsuLg4pKSlKbkKhahBGd9WC9RGzC/zAAOsAAdY1AqyEGoAlQKnx0oWAYdeVO1oWLLoCuEBo 39fTOw1LjlbWPo6eB8sInHKw+dwt/qP9RLF8BUVVcoFkcD0tZ8sJoGILPqLr8S5K737OmKUv4H6g DJ3cUvhKs3DVp7V1ncl4H1su3IJVWCGOJN5HnsSEsb49V+8gjRYueX8k8QE2sa2syk+Vz3Y7i9Hd M5WLWmotwBLAtvn8LQZzf6UEc7//6deITn6AUSFilUhF4JEKFN/+XLlfisk67gCkbGTsFfc1528U fkQAlYJZmwpwWSvGJqnkY7oE7zBGqFABh5dyPsQHrP9Y0gNaLgRwCQBM5RgKkMxri+58hkNxTMB5 73Pls5wX2fSjbFaeqFKsYgII8xmY70Z55N1kJnDGkn302dccz0NaEemCIimi7tzJOZmL1aeqFYB6 Le9DnEh9qIDeyIT7GLxYFixZSNPgc7iMAPHjenIOo3yGBXHx01O33Dd/WxHdwA+RXv4pPmKQuYAd mROJ2ZFYvHz2025XsTJWAdkyx6o8t1y4jXbOyfAJL0cc5aien7khH73YZ9EL6f+i3cVKv2TMMvcf sp1iysvjYKlyf2h0nZ6Zb8xXxtuNsnPYU6LcI/oWx3Y/ZNyggOsJXGT7UF+ljdGhWUqdN9//Uum3 6E8JA+b9IsoVgC51eTSifxvO3qynzzJOAR7yupj6U8XYu8yKT3GEsk6jjP75hSZ2UfohOibzJXo5 e3MBUth2FvX8cs4HyiYMmXPROemn7rMl+i/yFZmVUmekvyMIDEWHbnKeC29/pjw3Y5dlK22fzXxf Af9yj8yV1Ct9FBB9jt+JbgkYkmdGZCExlFsv3sb+60wGy+9uccPDGOqYPOcy7zJHJ9Me4hSLPJvq syB/KnoSQAUfrVCeYzm+/Ppfit6vPX2TQKtQqbfec+mVqszz4/RU+iu/IeE37iOh+GPleT3I8a46 Wa08W//84ltUs+/Lj1cp+ip1DluSiUM37uFc1geIiL+vhC7k8vdixto8TfaKx/zWGfkkEWBdMwCs BoCVeroxC5YsYP8OgPW4VC+Nfa8vB58KbrRBQ0NurIYsNgKmdC1vck5ldFctW2pb6rUNsbw3DrA0 tAkllQKqNKW06l69z08CsFQApFqvtN2Nqlz0ASx1rI8jWG0MYKn1Sps53FW6caMArI0KwNq3b59C Oip8WJKfUKgadAGWcGGJi/CHB1jz96Ob81X09YxHP5rDB/jzR+cxpYtbMkGGxtKhuAhDafXx4WKh dV9PrxT+iOXWPpZBUeUYEphBoPFB7bmlXBjbOSXy326OsvCsJQjow3rGsL4S/jgf5g9jF/dktHdJ wuJIJlmtOYzX5KKVQyJBSL4CSNTj48+/rn1/Put9gom6thz2cJH3SFbqE0AihwCUs1xclxwt5yJZ Byx2Xr7NRSIVnVyTsJELqHpYcPHuwXF1ZH8yyjWWqiwunj09U5S6ZRzqEXikHC0dEuiWTCdo1IBR OWQx60z59fZOheXmfDys+YfveahUGZPP4VLluocff4XZm+gKZd2H4zTuWPXIv/VPLp4lykKsHgLC pA/ac9Cf8yHy3HROM4aSu59hZDAXf48UXMjWWPEu8nUw56U/rZciZ+m3eoicO1IGUo8+nZA5dt5b ggfsq3rIohfGxX/F8TrQIwBHrKMylqmrcvAlwawceygX0aX2zkkE23XtWmzM42KbQoCZjJBjFQr4 lXk2pnxlPKdq5k8WytaOiQjlNephviGP8k2C454iZcGV+0aF0LLC+5K4KMuRyNchgbTMLMkg2NDM owAJGf/0tTnKwv012wyKqmAeulSlf7r615Z6O2F51iP6LPolcytylDo+JgCeuT4XHVi3/AFQD9FB 9drZm/IUPXj4ydeYviZH0Q8BLnIUESiNZzvSf3UOelHuU1dlK/qrmdfP6coiSKbODuVcypjmbyvA pBVZuEXAUcU/K6P5TIn8RJZybL90W5GdyF2AsXpIf9Vj//U7KK95vj5jW/Kci+7M31qguP8zKjTz unBHYe09Sygzmbe2TkkEUreU8x/xN2Io5d3BJZnALhfJWs+aPJddKbOm6KkRA84nr8xWQLt6/PPL bxRZue0vVnaRKu3xdSrHKjL3Cy/Dp/xtsdleWPvMidxc95Uo/Xzcb52RdwJ6uV1B+wUxtGAtMwS5 10q+/pumAqwspshJz5GdhLJjUBNT9bjSELu7NlDRx+6u7Yb7ru9V69F3dRHqY4rXrkPts7abU/1e ewzyvVqXfK/9Xtuy1TBjPeOgyshJVU5gVUFQVVNKK+/X+6wvBkutUzuNj/YYVFekrvVKH8DSR4qq m35HGzzqA6+NpTmSPgh1h4CrDRs2YPv27QrAEmZ3bYAlXFhqyhyVbPRHAFjX0XX+PnR1uoI+3Ips 5MtAd/6IPa4I8NAGWGNCaAXhgqh9Xw/PZGVhUY/Q6Aq0sItXFhD1kMWzFUHILC6ocsgPofyzXUeg dTTpPux3FaEHF+Uu7knKQqseZqxXgI78QMpCqh6RCff4g1qKHZdu0aKTyX/L+bXf2e8u5A95Ejqz 7yrAqnwgC1OqAiJkAZDPcghonLY6G20cE+ot/Eq7HFcPtiuWDjnkVT7Leflee2zqwiFARCxeckjb nVwTlQUltkCzqyyVC44sHnKd9Ec+yyHfy2IqJb5Qc+37n34F03U5itwEYIp1QI7dtKrJvOjOgfmG XHxOa5Icy2O4+HExEyA2R+veJbQ2yPkuBCaPyJnjalAf/GkRpEyXaIGjdaeraFVKVPqsjkOskf15 bS8mzR1JUCMLrhyiQ9Jnfe3KuSlcTMXSJocslAJspV4BiTLHXgSlHdiWdp9NCJD68I+CgC9Ftpyf 9WeqseFsdT0wJOBj3SmNa1EA1RQCFtEpkY0KiO/R2jGR4Eb+BOjKReZKgJyuPsu1AryE4kIOAcF9 fFIU/ZjINlUwqq0HV2v+CAiY2sC+CiCOSdHs3pRj0S6N7qrzIDoi5WxmzR+Fr7/lhoQitKZOLOVz doY61tI+gX0uV0CY58ESNLe7ochNdFujLyL7RGXet1GW6rGaQH0Z9WQT5dXTKxlbzmvAudwnz3l7 ylv+gIglbB6fr3ds46mPWs85n1OZO32/EaLz7V0SCcgKatuT51Jk1hQ9FauYAFu5VgWXF/hHqhd/ e6SOfQSE6mHGa0QeK09ogL7MsVhvV52sQjR/W6aszFLuE71s7Peur3c8ehJgtVsQjSFzlhpchLUS rv/mxwRYKgP8Dw2wvk+qnIYAVk5hhZLTTy36Psu4VLAhbPcCTsTCpAEYQuZ5szYnYEOM73Vg5OkD LF0g9DiApSsLbatgblH9YP5Hk1br8mhpyExVOajjLKIFSwVY69evV6gani2ANU8A1mX0YSCnmMP7 c9fM40on1wTsuqz5Udb88NJtwMVT+74eHklYebwOFPlHlKKtYzxBlzbAKkd7pwRarDLolqnbai/1 Ctg6lnSPVoY0LqKaxaL2x5N19PBMUsqMNdm15xcfKePCcoMgKpH/XhMI0Or+Wcv7ru6Jynen0zSL l4Aesdr1YZxFb68kuh7qLEXmG3L4Ax2vv12OLa1MA4LkVcYqfTHTGVsXt0QlSFZ2ItUCLLbdkX0T WannjiffV8Y4wJ/WMS5gJ1LuK3VXsn9yXXun+NpzYpERWUt/RwSlKRxVcsh8yLxoz4GMV1sGC2jV 6MJzcr/2vbtr7pX+6pNzY/og9S3cXrdg2vC9nNMeh4xT6ujFPouuqIu82md97bah7JdEldXO7aQV jMWijAewnr4ELDKP3Sn3rjp9Fn0Ysji1Vi7R1CGZS1su6nPC8pQ5ks8Cik+lavSgjJY9kYnMk9Qb SD3S1rUG9YD90dVnuVZbD0Kpt6oeiJ6pFlfRQVUPVCvRdQItc/ZP+jpvS01f+Xk4nwGFRkXr2ZQE 7QK8VKBxNfcD5hRNpLXzDv90FCoJ3EdT1mNCGa+3OI0WuFIF8KoWLFX2yni15DxtVRb/WMQrfRad 1H3Oe3IOxy1lnNaSdAI2uq9pqcyu/IS7yDQSE/2Rexv6jRCdlH6rh+hnKz6zTdXTdnwWFN2tAYrb Ltwk6Isn2H103uQ3wHprvmLJ1D7ufvQlreVV1CPNnDem3329bqCn62W0sz6GIVahNQCrfn31Kv8v /fDfArD0gYxHWcplp1xdEaBWR4paH2jpugy1LWdqcLzqQqwjK60Lxv8xLVhPE2DpswzqMtE3xf2q D2AJF5aal/D8+fNKTkJxEf74FqwztGDN3YuujpfQh4GcRt6J6C9WrMeUTi7xtT+8ssCP5ALQW3Yh 1twni2AXLvZHubjJIbxTVpvpbuIPodm6OkAUcrRMua4PF7dZXPQuZT/E+3STqIc8tKZraUlyuAG5 tnbRYx09uID08EzUW5/0oyvzK9rv1PqnzPdyrjN/dLUBllwrljvph7qgf/PtvzCTbbTWadeEi7eA qa5clFJKP1K6owAsLhrSH31jU+gvWH89gEU5yLnyGqvWmfQHbJ+y90umjBJqwZQGmMi5+Ef63Itj HxOSVrtTU1kwOS/acyfjXbSzbjFzVKx4CTUAqw6EqPeKDB6RM9tpTB++i5x1+7z94k2CDC6ObDfw iMY1KofIsTUXXQEn6hHM+e/K60S3pAjAlLY7cT5DjtXpxozVWQQUKYqFRY7LOdytx/kRIKboTE2R +1Q9ECA7kOBW5uqRvhDgSF+aqn9yrTbAOnD9ttLXvvIHpAE9qKqxnApQkd280gftvio6JEBA67mU PwZSbybddHJIzFswgZIArbEEVfI89iQAdNhVoFwjINLzQN3O3qbMufZzLi5B0bfetGpJu96HihX3 pYC2AFqN+cgoh/pM679XM2e6z2Ur+7gm62k7xxt69V6v7nKuRe4ybnlOVZ2QfpZSHv3k2a95PhvS 8b7kwOrpcgnt5h/FEEsCLCXZswFg1T6YNW8eD7A+VoLcs/KK6CIspIuw8BFSUW1C0cbIR1UCUm2y UZVwVDiRnkZpjK9KJcQUTiddIk19PE9Sl25f9X0WnimVbFXqFXoHIVaV+6VeuUfzWSgTNNQPPxbA 0uUA0yUXVT9rc4Q1RIiqLVuVW0ufTFXC0kaJS0k0KuS14h5ULVjPGMDaQ4B1Eb0VgMVAd/7oPK60 5Y+c/HNUftj573DqSu7O4w+n5gdLXD7xGBaYWgsqtl2sprWBFgcucjPWZNU+m0FcVOXH1WJDNhKL PlLukYXOL5xbu0s0AMZifTZaLopFqBbAkvbaO93gP/YEmOjUJwu29EMWqYXb61yE8l7OyQ//qRoL llgOZCHrSRAhRYCOHLLgySIlwC5Ua/G23prHxTYOgwNSlHgmOQRoyY++JMw2Y1/VI4AWu5a8VhY6 WTRVy8WJ1PtK3/vwnOpCK2BMyfCgVEVGsnip7sBkykCua8fr5T45pB45J/0dsURAkgaQCljp4Hyj 3tyJfCw35dQufnKNnJMiMlcJV5dH0+pA2YjsAmnpUI/plG13gpPG9EFXzjbbSO1AWXQgKFT7LHIW GUifR3OR/rQG/ETEM+6JYxMLhGopkbZlft9bFAf3/XXu39zqTxW5d2YfZQ4nr8hQrDJ9qW8BESW1 fZ66igH5PKfuOBXg4bC7QJGhOnbph9Sz76rGCivWUqtNucr30neRkxwf0B07ie20dohrUP909Vn0 Q/r/SY1lUYCN9EdAcnfWr+rBcVopW9rFKnOZUa6xhn7LPxQyJlW3pT+in/JM6c6B/CmQ+lZoWYnv 0qW54UyVoudy7wLOhTrHttR/AZ6qxWvrhWrKOFaxji7RArfyPKlzLvqkykL0TPRNxiHgSj1kHkzX 1j3Tqt7LGHZfqYnB4r3K3LFf+p5LkVlT9VTq1db7bTV6L9ZA+T1RDxP2STNv5YhJvqf8sZiwLANr TsrGgy/oev5SkalixWrkN6+PBwGW80UDwKqVrP43/6kASxus5RWXEdSU12Mh1wVZDQEsTT0agKRb 5Lx8LyBDXuX7wjLNe2G2F2ClkpRqpwD6dwAsDfdVHbDUBT+PA1j6iFULSiuU8WrKo3X/pAFWlzm7 0cXhAnq7yU5Cpszhj3lDRRaKHh6aH+8jXBzVY/+12/yRSkIHWcS4QE1dmVELEq7mvo+BtMLIotaR P+aWm+pAyPKYcryz8HotSBL3hrTxHhceX/6IS7zKhKUCdOLqLaJbzldj1YkKDGCbZuvrftylPrlW 6mjnGAeXvdrWmwK6KMnIzEVDBVLi1pBFXH60p6/OVHYiyTmxlsjiJQu53+G6xfsCY15M12UhhpY5 dTeY/BMWi4uMT+oQ65cc0sZSAhdzgi6RmQQby3Eh6yHaso8iQ7sd+QrYkDYFAL614JpyTg5ZGG35 XvJEyljEuieH1DOA8hRZi7vtMwb5yrGXYKGVvcbNq5Y+tEj2If2GzI8c2bRkyHdtHGJxNFFjXUwl QBRg25vXiXzWnKwLTp8XlsM5I2hrQCf0ydltX6EyB9LnizV9FrAj9XflWEYQSKpxSLLIWW/JxQrO m/ZmBQFMQwkGpK9igVKPdAIRV86p1eYcZZG8wbg0mbtVWiBj9kaxOMUpi61qVZEA8g2MDRMgIIDh CuuUfowLTaMVRhOrtelslaJ3o4JTcecDDR3I+tOVGr2lzmiDOFX/+lP/BKiqh+iftC3zLZYr9ZDN FnPDSDVCi5zqoiu580/MoVVXZGK/M78W+AjY23npJi2oWcq4ZIzGBI2ij7rPpZyTMdyu6e8XjMWS OkW3BOBKe+qxms9LVELdMyt/aGLomp5DWWqDahmPzLlGT+JwsGYcomcCjt+1vV4LTEW+izlXYjVT j4vU71Np9zGNfRYwI4csvisY1yXPbGfXeDjThakejgS/0o4A8MfpqfwJ6eRyg2Ou0/tDsXcUvRUw tZJtqIf8LjTnb4tqeZR+yrMk8yNySKdFqxd1Utpt7Devj3ssejhdQNt5URg822DBqhWwzpvHAywN TUNWXjEtWEU16XKK6+Uh1M5J2Fh+QjVHoSYfYV0RwsmnV1RXXl2d2mSjKjGmbi4+fXn21LyG4urT 5F6sK/JZ02cN2aiQdZbIzjiOS74TC5Wcl/diudJ1E/4YFiwNkBNg1VjeQQ2pqDYJa/2+qjFXdaSq KrmrNkGq1FFX9OczrBcIT3lJfstn1oKlACz78+jtKjsJ+cPKRbmh0sOdMVRrM5UFSv0nrPkBpSWH 1pawc1UIJ0i6wwDf+1w8152q4MIQz0We/8T5asZ75YdNPWSRceWPrVBEnKKF5ksuEFkEAZHxd5Tr bLYydQt/FHtxwRofmlp7r7Qn15iyvqTiuvQjUp87F/gOjrFYuC0XBTfrqB2kXputDHy1v07X0H2c z3iAnbSsFd76lLFXd5R4p1vvf8FFqVST/Jp96uWZgLEhDEbPe1/ZESZHNa1bjrvyCSCZiZvgKKfq Ey4MtwhCRG50i/LHWwVZIhPTNZk4ybF9W7PaS5D6pjOVZIcmgHOK4+KahyLuCpSy9XwVShmLVsxF 34kLTyfnOPYhXjn/Sc0OSRm7gDep9xrBq3pIgH5IVKkiZ+356+Uh8ovnol1N9+tXOJ/5AIdibyuW rys5DzEqiIHdTJUkxftAUS0Dv9SbT/nJnOnWqdYvc6MrZ+m79ZYcrD1ZtztNFn6xIowI5GYA9m/9 6QrFOiSHBODLPCyPLlPkJhafC1kPaLkk6z7lM9gviQviHQX8qoeAUplD0SvnPQW4zXlTD7EGiY62 IdgMPVqKux/WfSc6W8D5Xsbzg/0ZiE35Tl6eRuvph4pFY8+Vm8ofA3kvuisykTb06h91RvooAFVb nz0J2Ds6xWJ0cAoieM1XNZsQpG2RveiYWJpEtttpRZL5lXEKcKy4XxeH+BVlVn7vM2w8U4Fhi+mW o77oey5lDDK3clynnspcC6ddV9cbBOt5tXIW2YocV52omxeRtYxTdE89RBYzqVsdWe8KzsmDjzV/ DOQQkD+cc+hFPVGtkDKuXWx/C599FeznVX+C4ezz1BXpii7LIc/25rOVmEegKWNXD+W55LPa2YW6 /hg9FTlNWJqGuPwPau8XnRYLnBOfSZGXesTymumryKG3NFX5TfmCenaFz4uAv9j89zGOz3VPnWdF n3z7uF1HD8fzaDv3CAFWiMFFWCvh+m+aDrCefBfhjxHkrm/XoRofpQ1qdKkE9AW5q7vxchSAVUaA VVc0iaslfU6lQqFw896HqLj1gICLsY08r/JWqW3qcmP9eABLXJbarO2aNDy6BKONEYo2RlpaG7Re ywp/WydZdB3Yqg+wGOROwKoBWOtq8xE+EzFYR89cQxerXei86Cx6uUigO/9J0orVUOnlcQNjuXDM oRXKbC1dA2s0ZSbfW23MwgICovlh2crnCQREPbhA9eY9Up9yb0gKLHmdet+s9STtXEXiQabq6Udw YrwyXfle6hBA1dWVKXzEqsadPD3c6RoITFLuNVnNXYtcmEYGJSvtatcndUh9snDO3lD3nSXfy7me rGd8KON4fCUeK5bWgXSlPemLnJe8jH1Yt2LNkx1EvH6wP12bq9O58GjG1Y39mrwsFdO4gEif5Bq5 R8Yo9Ur/5Fq5r59PAuZtzq7to/m6TMabkQCRdUsb3djXURyHnF9AYCL9GLWEO/3YhtoHOSdARx2n yEj6MWdT3fgslGs0ctGeP5Gf9EuK9FnukfHKeKRvSh5K9kW+l7mQetR2RH4yZ/KdPp1Q6tSRs4xN zklfzDgmVT9EBkMoj568R2Q1hdfIdzPYZm8urEMDkhS5jaF+Sb9kvkUnRLYyJqlTrUvmuI/IjjLS 7bPIZhz7LPfJ2CZygVXvk/oF5HV2pmuOdcq4RVcG+SWy7XQFGIo+yT2K7vIPhzoH+vRvNOdJnz7L fVKv9EH6p4yT9ffnuCawbqlf+qHqjaIHHIvIWumr6DiLyKILdVTGr+qL7jzId8MXa54LuV7VXblO 2quVM9sXmck4pq7QyFKeH3nOZnPO1DmX8Us/pG8yh6KX6nfy3A+nvsu8iO7LeZkLqVP6Ie/l3DD2 R85JGb1EMyaRg8hUxq7vuVR1tDE9lTZEbtp6L/2TeZ22Mk15dur6Sj3g89yFwE3VLem/6KF8lueu IZlqy7i321V0dzyHNnMiCbCCDQDrvxxg6VIkFBF0FNekidG24GgDH43lihYpxSolpVwBT1IyCbby S2+i4jbB/4VYrNqwDYeiTiK3mK4yZYecuA41hJ4C1NS0O2o/6gCdJh6rDqgQoAhNQ9mjNA2llSpt w10FIGlzVunSKmjaEcuZ1K3ZxdfY7sEfEmDpo2tQZPQsA6zOljvRye6MEsjZm+ZwoWtoqCg7atzj lB/9xkpXfi8LhmaB0tTX0L2yEKkATO5T65Xz2v2Q+3vwnPq9ADf5Mdbth1pfDz39lHPSlmbx09Tf jWmC1Dqkz2pf1bZ1+9295hq5VvorfVLHqXuttCHf6faxK9tU2qmRtfRH+xp17Or3cr3299KuvnnQ gLJH50/Oiby0x6rWoT0/uv2QNqUdfXWqcmpIztptac+Z2hd1TNIP6Zs6HumDAuhqZCPXy2fdvqug 73F91r1P5ktXr6Rtbd2Te7R1t3asj+jfo8+CRv80+i7jUuuV115sR+qWoq03an9Et1RZyfW6z4C+ 51Jb55S2teSmtF+jO0r7/CzjUs9JH7SfKbVtzZxrQJ+u7kqduuOSOrXPSZ2qzqjzI+1L//Xprea5 rJNZQ3qq6oK+Z76xcch32vOrttfYb536XS/XK+jmcIYAKxyDDACrAXjVdCZ3bR4slQtLeK4aKmKt qseDVcOdJYuqEEzqI+18HOfVY+kdlNyGj+720yYB1YAdsejcUQCSBJ3L+wICkNwi7vIr5i7CErrM WAr4XS5pGrIJpnLFWkWXYA7jrHIYnF3MuKvyyls4d/4yTEwt8PY772GGiQUuXrqOQnENcrxyr1i0 hNqhqFwAkaZIvTIWTdu3Uch+CAASMCTXF5TeJs3DPYKoe/xeSEYfoIylsEQDvMqqHirfq/Vp7pX+ aorUm0eglyfjUdqo775Tcw/Kax1IU3MNqvkX63Y86rNgaXNqae8a1OXU0gVu2ql6xH36zFqwOlvu IMA6rQRySqB7H+6aMRSDDAw6YNABgw4Q7JOioZvDabSxOoxBs5YYLFhPaMHKJMFoWrbsJHy0CODS LfqAlxrDpJJ1qm62xwErlRJB+z71Xn2gSwUEuvWqfE6FtCoVkrgzm4AlM5/AouweCglksvIJSgoF pBD0FNHyI4WAK49gKIcxaHncQZmfk4fCvDzcLC/F9QtnMXnkcLR49RW0f+ctTBk9GhH79iMnPRvl 3E1YWnYb+UUCfu7WFAIngqaCEmYqySf4KqS1S7FWkTOLoCqnsJKglOCToKj45gMUVd1HPr8rqXyI 8uoPUFTCe4sIuMofopTnitjvIgKuwlICRPY5v1gttwiuyL3FogGUmiB0tTy6k5BjJrjTx4KvS8tQ K8Mat6O2u1Hfe11m+J8OwJq9HZ1sT6EnAznFHC58WIZikIFBBww6YNABWv1o2e9mfwptLA8RYAUZ ANb3BlgamoYMAqu07MJHANaTgKsnAVi6wEo3cbQ+0KaADQVI0IJE4FJAS1A2gUk2AU8xwYyAnHxa fRTrFcFODpnrC2m1qqpkzBKtLTmZmcjPzEBxdiaunzkFT7sF6Pbe22j3xivo3aYlbMxmIO78Odwu p3WLuxZzSWuRQ8BUUEw3IcFaTkEl5ViqtFNe/VABWNkEWgKy8vh9bqFYkQiOxH1ZfR/ltz/A7Qf/ pMXqfRSV3kP1rY9pOXuA/EJawgjahO1d7pX6BLTlFwuoIiCsKYo1rmb3oC64EpBVt8uvDmA1JQ1R nRWwzgLWEND6CQOsbQRYJ7lThoHuZCzu40ErlqEYZGDQAYMOGHRAsex3W3QSrS0PGgBWgw7CprgI 6wBWalZhrRWrKRYrfSl1dK1XTU2VI9c1ZrWqA1Tc9UY32yPWK7rMVLeWAKwscccx31+mvOd3xUym LHFSeUK1QBdfqVhoCmm1yslFeVExKgqLkBx7FdfPncS1k8eweWkgFsyYDAcLY8wcPQTDurWHj+08 JF88i+KMNKTH30D8teuIu87XGylIS8sh2OLOwwICKrrzSsRdKHFRfJ8nYC6fNBIEROIuFBb4agbN i+uv8uZD3LzzkQLSikrEekV3YcX7KK24r4ArXYAloEot4orU7CB8tGhzVYkLUbVg1Vn/RIaaUge6 aOGjrDS7EzVuTRVA6bdeaeLEVBZ3xY1ZQ+Sqpsp5dl2Es7ei48Lj3ClzTjGH92ZiU0MxyMCgAwYd MOjAVQKs8+i66ARazz5AgBVosGA9sQWrEKlZBQRYBTWEoxrKBrVk0oWmr+hSOEjcTR1ZZ326Bl36 hkc/y72P3qNN8ZAj5KA6JZdEoPm05OTTTSalkCSXBdV3kU3wkcGYrSyJrSJ3VWl5Fe7euYuK8nJk ZWQg7uolHD2wB+tCgxDk7gTn+RZY6umA/euXYqXHIrhYTEbgQgu4z56KhcajEeqyAFuCfbDMyxFr g3xxPPwAEq9dRVLcDSQlJCIjI4+WMVI6EKAUsz+lBDZljIPKFfoHul/zObYC9qf69gOUV93Bxs3b 4eDogcioU6gg0Cqv1gCrssoHBGi67kGNBUu7KLFkDQAsbTehvNdQMwiYkrix+rQZck67aILnH6V/ qB/rVRf3pVJAqBQZcr9KxvpM0jQcPX0VnWeFoaNNDHowkFPM4WLFMhSDDAw6YNABgw5cYejEOXS1 i0HrWfsxyMIAsBoyYj2epkG1YBUQYOUTYOUTYBUojO66Rcg1Gyoqw7s2WWdTWNK1r1Hv1XefSiya TfLPLCEGJbmolBxx1ZEQM7dMU/IYj5RPF14OgVaWAC9+zisqIbgpxK2bN1FenI8TRw5j7bJgrAn2 g5/9XIzs1QEdXv8bejb/B6b26whXs3EImDcNbqYj4ckSsnA6ljmYw2/eVNhNG455k4Yi0HEuzhze hZL0BFq0kpASdwWJiclISEhHZkau4nrMJw+UlGKCqhKCriKeqyDoqiToOnIkBoMHDceLL76qgKwi WqPu3KOLUFyCErhO61ExLXBK0HxNsL4S2C4WLH4v1iuNxU6/BUvbqiXuQ5UQVQhF9THq67K4C7mq PkZ8fQz52iSuKgO8nJP5fOYBVncFYDHQ3QCwDDIw6IBBBww6oOiAAWA14hfU+uo/FWDVWrFUgEUw JUArT6w0BAd5cp5ArJhgq6qK1pjcHFw4GYP1dP05zbPAXOMJsDOdiLnjBqJ/y5fRt/nfMKFbc4xs 8zIGt/gLpnV/E+Z9msNmRCd4zhgIb7OhWDSxF+aM7ApX89FY72uL6B2rkHA6Aknnj+LS8cOIORqN /fvDEX4oEidPnMGlC1eRnJSGXILWclqEqqtu4/bNe7jEnYnTp8zAW2+8jaGDR2DL5p0MsC9mP2m9 Ir1BoYAxidOqoWrQde/Vzz1oAFh6noT3n+PJOjZK7Qfim68gFqxOFmHowEzx3exlJ+EFxU1oKAYZ GHTAoAMGHbjM0Imz6GIbjVYW+zDQfLHBRfiELsJ0BrhrXIQSh9W0YHddOgd9uwgbiqvSF8TelF2E 6n16g7VrKBMUclBaUMpo0SrMp8szMQERu3bA1nwGRvXsCNPhRpg7YRhMBnbFpG7vYGTbf2B859cw qfOrGNHiT+j/yq/Q+/nn0JdlfIvfY1KbP8G016sEW21hM7ojvGcNx1IHEyx3noXlLnMQtsQJUdtX 4+CePSTU3I2d23dj3579iD4ag8T4JKSnZCA7Iwe3qm8jNTEV82fNwcvP/x0d27TH9rAdqCSYqmSg fTlLRTV3FQrtglimaOlSGegfdeGpBKOPAiztHYUa65Imrkrk0tiOTm2ZanN36ZK26ibR1iZx1d6F KPO5YcPGZ5BoVACW+WZ0YKb4botkJ+F5xU1oKAYZGHTAoAMGHbikhE50WXiMAGsvAVaAAWA9BYCV kikuQg3A0i7flbqhfsqZ+pxY+oCVGuCufZ/KCv8o6KrjwconYNAO2s5m/FOWQhhaRpccA9kLinE2 5jiCPNwxfdQwDGj3Hga3eRuWw/rAamgfjGnzGka0+hsmdnoFY9v+DSOb/wETWv8Zk1v9CcZt/gi7 /m/CZfh7mNX9BZj3fAmLRraCw9gO8DIxgqfZYNhO6gPTwe3hMGMQwjcH4wp3GCYmpiEjLQsJNxIR ey2OsV7ZKGI/KmhdS0lKha+bF5q//Bre/PsrcLaxRwYtXA/vva9YtyRGrJilnCBLYrQKJThdce/J OGmRY5FXccOp7rtCST6tFgFTCqCim5RFk6i5QvNZB2A1xlOmzYyvy+TeFHAlbcl10sazC7DMNqED M8V3szuJnhLozl0zP2Tp7ngBHWzPoq3NGaV0tGtam5LOp4PtOd5zVnntTXemvnM/ZN//2+ru6qCR ebuFZ9Ge5Vkefzfm0+xY01fpr+z+amp/lXuph3Lfd723KW2IHEV+qs53XsQ/Mt+hfz/ktfI8ytjV /knePXm2nlabUreMu7Ok43qK9T6t/jVezwX0IEVDFxsCLPM9GGhmAFhPGoMlFqyGAJY+i5Yu6FJ3 HWrzYzWUOqch65W+XYm6QEt3V6ICsBTyUSEJZWwWX0tkV11ePiJ378FCM3MM7NQB7V5+EV1ffRFT erQnQBpPoDQIY1q9hCFv/g5jWtIl2OkluIztBMcRbWDV4xVsmDcMqTu8cTZ0HpZb9EXAjO7wntYV tiNbwn5cBywY1Q4Wg1tjmlELWE/oju0hTrhwIgYlhSW4U03Qk5uLjJQUZKdnkFOrEjcrK7FkcSA6 tGyNHm06wHyyMa6cOoeP73+Aava3TCE2pXuQMWNFFfxcLTv4JM6K4EgJQteAK3F9FtQCrDruK9Vq pQFVAqgYf6ZVtK1TKu+YOg+6Vq3GAJY+1nZ156BqvfpJAKyOZhvQfv4RBnLKTkJZmM7/IKUX3Y+d 7c9igMclrI4uxIX0uziZfAsBB3PQ1eGcYj3T2zbPC4XErLWJWB6Vj4jYKmw4UaTUpXuuC8/9UP3/ b6tX0oPMWB6PkMg8HLhSgV0XyrjoaubiWZNFN+aKGxd4HUvCc5V+HrpWiUGe5C/iGB7XV7l3UnAs Ag9r7g2/XomBTbz3cXWLvDrancXEJbHYc7EcFzLu4kTSLcxdn8w/B/9+XZU5Hh1wDX4HsrHtXCmO xd/E2MVMn/U0+kY96c6y7AiDfTlm+61pSkqux8nsWfu+u/1JdLY5gpbmuwiw/A0WrCe0YMnuQQFY 4ibUdhXqs2g1ZN1SXYa6FixdK1RDn9X7dElMtUFWVm4ZaQ+EKb0aqbklSpqbQgKPkpJSgptC3Cwr R1F6GraF+MNiqBEGtHgDXV78I7o8/3uMePc1WPTrBNvRRjDp0w4D3/gj+r/wc4x7+39gQ2vVMvP+ WDlrINZYDsGxgNmICbTC0hm94Ti0BVbMGoRVVsPhb9wX0SvscW1XEMJczeE4sS/cjQdhpaM51gV6 InLXdmTEXkZ5LvN9ZqaiPD8T5QXZWBEcAKOeXdClbVtMHzsF4TsP8Lsy3GN+w1JyYwmFQ0k1yUdv kbtL2N/pIiwvZ3B8KXm1GEtWWFxKqxatXFUEXrRSCQ1DAcFYMQFXCa1UwjxfTEBVJOBLdvHJTkAW fa7Bhhjz9ZGO6supqG3F0uXBUgGYxI8Jo/8za8FSANa8SHS11ewkVIDOD1C6OpyFkdtFXMrUJEMu ItmZelgSPLVfyBgwPe12I/jq43IBpwjG1COn4kPlx1r7XH7VR7S26K/jhxjPf3KdPWTnlP057L1U jq+++VYR+30mTZYxy6L8rI29o+0ZRMVV1SbZ/pYZsYf5XNEAhcfockemiVp3vJDJizXJpL/LvY+r W1JQTSZ4K7z5MT7651eoItmfHJLoWgBg1yb073FtPMn38rz47c9mQue6hNgzlt94Ks+R6ImA8Tsf fK6M+UzqbbS21oQh/HTKOXS3O4HOC47gPbOdBoD1FHiwfioAKzOX1qqCW3QDViGFRKGy4zCffFal RUW4WVKM/KQkbF8eiulGnTH47b9jcLMXMfDVv8LoxT9gyBvPw9KoA2b2ao0hLXj+9d9hynv/D4sG vKW4Al2GvYfFU7piuVk/rLQYoBTXEa3gMaY91lqNwCrGXq2yGoVTq1xwfccS7PKeC58ZQ+FrOhxr CLBCna3hbj1boXGI3rsVOQlXUJqVjC1rlmFY/+4Y0LsTRg0aiHmmlki5loT7JBstpluzgOSnBbJ7 kEHuuSxZTJMjLr4KsslX0fJVViG8XdyBWCk8WuLyq6CFi+SotIyVlDLxND+X6AVY+mOvmgawNODs PxRgXUGHmesIsCIIsKIJsOQHUEDW0y09WF/7hSdpYchWHtEbefe5UJ+hpaEcxbc+wbSl15muhy7K BtqVVBVSBETJkVr8kG6HE4+c60DC1Kfd959KfSLjdpRJZ8bS9XISYPFkcyi7SmXOrmbfU2RefvdT pc7ujgJin6zup32/6FJ/9/O0wFQpff34s68w1FtcyI/X5x68t431CVquKr7zvY2NQ+rtZHcKMQnV Sr2bThbCyPUcEgoe4Eb+ffRzO6/o79OWxXetr7X1cQLMgtql05jPYsfv8Rzp6p+MX8a3/3IZyqg7 AQez0GHh4+fju/b/h76+Gy37na0j8N7MHQRYfgYLVgMgq6m7CAVgJZPHSbViPc5yVfe9MMBr0uvU Bb1LnkLSKQj/k1LKmlg09zVmwcohsMopuMm2KpBKgCW8W0Wka6goI89Vfi6OHTiAOZMnYmirtxSL 1bROLTG57TsY1ezvmNDiVRi3fROjm7+ICW1fw5y+LWA3oBkcBr0F237NsGjgW/Cb2Ak+4zuwtMfq 2YPgMboNXwdjp8MUOA1vhzm930aQ6SDscLdAmLM5lltPweJZo+FjNhre82fCeY4p5huPg/fCOdiy Igh+TgsxakAvDO7TGUONusJi2iRE7T1I61YebtHCVE1LVRnpFoqFcoFxS7mkZ8gn8BIXYXkpx0Ur 1t17JEklgNy0KQxLQpbi1NkLZIXnuMWCRYAl4KqEdSnWK4KtOgvW9wdY2m5CbZDVUMC7ruvwGbZg fc1dhBqA1W5uuBLIKebwHlxAn3bpyoXOyO0sAdKHyuO55UwRWsyJRheCAWmrO3+IG2uzJ69ps+A4 kgofKPenEGB1WHjikXPtee5p9/2nUF9nglMZu+++DMxec4ML+9ORQ8v50YiuAS2ySIosuhGEP4sy aW5FVuRThbUgaYgXXdJk4G5KX1vOi0bY6aLvdW9D9Yt+zlh2HZ998Y1S7/wNCXiP7Yj8niUZtpof A9/9mXUAK/SaoktNkZt6TWP6J2lmFL2pef0u9T4L13ajZb+TdTjenbkdAwwAq0Eb1ncHWHk1fFga 0tHHl7pdh0JKqiEj1SSJ1oAr9VUbcDX0Xje5tIbcVOoQIKXsSJR0NNnlPM+gb4IK4erKySvgbsF8 nD8eDVdbG/Rv3wZ9Xv07prZ/D1Z9usCsc2ssJMBxHtQTo175E/r86ReY26c1fCb1guOQt2FPgOU8 vIUCqpbN7I0V5kZKCTXpifm9X8ZCug+9xnbG/D5vwaLba3Ad2xVLLUdhxfxJ2CiuQXtTuE4bAvsZ Y7F40Rx4zTcjA/w0WM+YgGHk2OrBwPqe7ZqjO4FeqLcbvrj/EB/dvIMyssjfYVD7Hbr+SujmLBJX JxNMC9O7WKvu3rpFgFWGeLLG7969G9OMjTFm7DgsW74KV2LjGWtG65YExlMOUhoHWHXkorpkrirx aEOEoyqBaGPkoyrZqPoqiaYlJu4ZdBESYJ0iwDJdS4B1mADrKLqTsbiHo/wgPt3S0fY4+jifxsMa V8SmkwVoNusIAdYJgisGkfK17YIYpbQnq3xr62haY2K4EMkCqemLnBdgpQIs+azvnHq9tNmmph6p S+qUc/J9TxZpU861IoiQIm131jkn98n1cp96rVwnfVbbkffyvdIG6+nAfnUmwFGvl1cN4KkvU03/ YpT75FWKep28yme1b90U4HtKqVutV+7r6XRKaauf2xksP5KryCY4PAtvzmZMHe+ReqS/Uk97m+PK /fJeXqU+uUaRI79T25PP3Wv62op9P5GoscCU3f1EuUd7TtQxSR8044gm6NWMQ61P+ivfi5ykHZGR Km91XNqyaWzetK+TfqjzKn1+w+IIrUQaS4xYsIZ4nVfmU+6RtmXMdfLW9FP6Jd9Lf7ad1QZYdffq exakXrlf0VcZE8eoyE1LL96bewwWq+NqFyTLNXF4x+qoInPt6/TVr45N2lDHKK9yr1wv71XdkGvk vBRVB6VfajvSL5kX6aecV8at9ZxL3xcfqg+wBFg/Df2TZ0z61HLeMaV90Vd1vGp/pT+aPmrGqo5R rpP50eimZr66EDCr+qzotI7Mn/bvlvKM0LLfaf5hvGu6DQNm+hosWE9kwbpPIJVHC1YOLVi5SknN EqDVeBFSUrUIOalKUKqSkarko019fRyRqRBXZjIGKzWDrkG61UrJKZWem4/kNKauSUvFuuVLMbhn D3R841X0ful5gqGOmNW1PWZ3boOAMYPh0q8zRv7tfzDoz7/AIqM28BjVEQ5D38Rqy34s/bF4amcE GXeha9AIa6wGIMSkB7zHt2XQ+0uY2f5vWNivOeyHtIHTqE7wmz4ATuN6wW5EdwTNGoPgeZPhYjoO vrRiLXWaD8+5M2A/cyIczKdg6tC+6N6yGQZ1a4slbg7IJPv7x9VV+PBmJe6TVf42SwXJUEvo6rzJ GKu7d+6juqKKQfLJiIqMQGDAYsyfOw+L7OwQGhKKrVu24+y5CyivqEQlr5fYq9r4qwYtWLKbU5tl v/57IR/VJhtVdyuqgfJq8HxD5KO61BASI5bzbBKNagBWe9M1aDvnoBLIKeZwsWI9zSJpeMYHXkJk bAW++loTz5NV/gF2nS+G6bJraMmFaKD7WayLyaeLpxIHr5TheGIV/Palo4vEP9jK4szFgz+wKUU1 AIuv8lnfOel7W/4gW6yMxaGr5QyKr1DaPkx3pJyT79rz3jlrb+Bs6k2lLSnSn4WbEhmQW117bveF ErpNT2JpZLZy/kzKTcb6VKCfK7dus2/duIAIWLNiXSERWTh6oxIOW5MwgeMVYHKS9+y7VArjUNJh EFCpcpU+mLMvh6+VKX2Ta3ey/SnBV/DunKPw3ptG15KmX1KGezNuhe3sOFekyEjOrT+eT7ByDNNZ 9408jRtPjni6n6SuSUEkmeN3y4/kKNf778+Ay44U5b3P3nRFDgJw5Py+y6W1bbntTKHMjyvfydzI 9QrAuvOJ0n9JG6KtHyKHyUsuI+BABkReW88UKuMNp7xPU14yxvGLL6ENF0Q/tiUyFFluYP+VAGLR Ocq4KfOmtMtrRSek3eDDWWyjWtGZLacLEZurkcPHjHca7HlOkbmMQ8ZqszFBkbXog8xLGK1do/0u ooMAAI5zK62quvc+8hzU6OFI3wvK9VFxldSxMmWuXClbqUvk056v1rRYXUi/XTsvF9JvKX0c4nVO ka/eZ0zGxnHJ2ET/Za6lz8epHyER2XT9EixyPHsvltTOl3wv8yxF5CCylftMap4t6ZfopfQzmv3c xn5L/+XZEVm2IvhZfKAOYI0LuATn7clPrH/TQq4qY/Xak6b0Z8nhTEUu8jzJb4Lo81KO6VhCJTdR yDNfrXzuJX9o+L3IcULgZepqmqLP26n7Ri5naGksxNm0W8pY3HelKs+gzPHT/M2qp9/849lx3iG8 a7KVAMvHALCeEGClZuVqASyNFetxRRtgaTPAawOlpoIruU69T2WQ11tPLi1ZTKCcQ86rTC7gaTlM T0P3WVFhHkL8fdCrfVuM6N4FE9rTNdi6OSw6t4Vt7y5Y1IM791r8A6P++guCrF/Aoe978B3TkZar txnY3hurZvclmGoNv0ntsHZOf6Usmd4FKyz6KNaswMm96EZsgSkt/0xQ1g47XM3gzgD3Qa//HtO6 vAk/ughXOlphnactQhZZwmPWFHjPmQ4/GwtatOg2nDYapiP7Y+rg3rRumeBc+H4UpyaiKi+bIKsU 9ysrlPLBbZKR8jU7NRUbVq+C2YzpWGRjgxWhS7GXVqx4puVJZFqeSxcvo5CArII7DiXIXWgpGrdg aacg0gVaZQq7u36AJbFYKuVDw+zuPz2AZUKAZUWAxUDObkwJIVasp1m6cbHoyR/Vmcuv4dPPNIHE h/iDOsSDVAs8P5DWl+Qa118YLRAjCCauZ99VrjvMRaELFyMp7bhIphTVuAj5Kp91z7XnubYEHfZh ifjw0y/xwSdfwoqWg7kEQGLVkHPy3XtWURgfcBFnkjXWGTkySt/HWC64RTc1cV5yBBAQtJp7FGN4 Pj7/Ht7/5Assl0WA/ZZdl9KeMRcSNZBX7rn18DMkEORczqhbXAVQDiaI7LyQVg/2b9HmRAY6f4nC 6o8wjaBqDxcQOaoZBG22nMm2uZCe4kKpHtKGgMJhXLBKbms2B+RVfog2XBx7cHGx2RBfe+26mDz0 dzmNiQQ1xVobCR6y7599qXFXZZS8r/RHXK5Sj7QZTjAqx5dffQuTpdcU2bYk2DvOhUwOBWBRN2Tc qn7I3MrcXNQCEt9yA4NYGgX0ScC4HOIaPkAQJ33PpizUQ0CYpk5a2powb3KNtC9tCmCQI5GyHulz Huuj8/BlDYBXAJbHWXQSeXMcAla+/OobxDP2bxIX7RM1YypgTN9Efn6H1tStXLjl0L5X9zkQQt5x 1BsZj2zUCCSoFD3KqdCMaSNBo1wj/etNoOBDcKEe8n4oQV9vx5N8zvQ/Y3JfVxnblVKIy2UvAavo R36lRifPEpzKNWuOaayVcpwn2JBzogd2/IPwPnVe2pJz66kLcohuj/O/iBACUpkS6b+MQ/oq+r2Y 41CPyQTmot9Pon8D+EyPIoi7nHmnXj/foz51FnDFvp5Pu6l8J398hlEuUQSKmvHcVMbSkfquDVBF 3mklD3E+9RYefqQJyv+Cc2ofloR2BO9P8zdLuy6x7Hecd5AAawsGmBoAVu2E6rxpmovwvmKtSkoX kNV0F6Gau1B1I6bnSHod1U2o5i4UF2HTiprrsC4HYnFNXJfGTaiUvDIl2XEm3Y9JmTncRVjI9DIl KMjPxoZVSzGQO/V6tnoHo9u0wNh3m2GBUXfY9+uGqc1ewORX/4Axz/8SY//+S3gOao01DGb3n9QW wTPEctURdgNfgc+EVti2aDg2Wg8iwOqEgCntEGzcA8tM+iOALkXvsd3gP6UvbAe3hUWvFjAhUem0 zm/Ce8ZwnN++EjGbQhE43wSuJuPgN9cYfvNn0KplgiUEX97WJpgxvDfG9+0KGzLJBzraIHr3VpSk JeDDylJ8fvc2AVcOYg7ux6qQJVhCwOjn6Ya1y5ch/vp1FNKlWMqk1EnxCTh94hQKSEVRSVdi0wDW v8tFuOFZIxr9GlGnLqP9jNVoY3mAcQayk5BWDS5gT7N0Z33yQ96Pi74sXnIIkHrTPFJZBGTRkCOd P5497E+gOd1bE2kB+rDm2lVROcriK0UbYOk79y6B0xRaU2SRkWPV0Ry0sIxSypqjmkVJvpu6hJYi njMikCmn60uOmwQ3svh5706r3Y2272Ipf7yPKYBsM/u8cFOC0j9VPrLYC2jy5b9sFUwIaJI+tLA8 QuCh2fkoMEPOST2TOLb3a1yly49kQxa02atia92nAnpeMQmH957U2p+wqbxXxiuARwWjIot2JIht TZAlYEo9pC9vz4pEJxtabQi81N1xlfc+VcCSAKXVlOn+SyXKLXYc09+mHoAxF3L1sF5/A6258Ep/ tQGWjLsLY1K09UMAgQA6AS9y3OWuMZOlV5WF25/ARpWLgKsxfheUhVDmWg4BYyIPaUfG+Lh5ExnK HC+jRVEO2eFoseK6Mt5ui44jsUDTB9GzQe5n0Iryslwdq1hOpR9eu1MVeS+kNevrmt2RR2mRfNnk cD2AJfd2pPy0x9mJ1hcj51O18hdgIwBb9EFAvLrb0oMWI9GZluznHJ5XD3kvOtfYsyVzrI7t9vv/ VOoVQLi8ZrxSl8u2ZIwioJQ/C3IkUw/EIiby3nA8D7sJ1l+fGQFXWqFUGVlRBi3YT+mvWNKU+6hn Mh7pf8D+9Np+Tgu+jFdNn0z/pM721M1BBFqiD3KIHsncdeRvwZ4Lmj8UFdRJ+YP1zuxI5VV0VA75 Xv48jPO/gGLuwJRDwFQIrWBvmkfAnTIW3ZFDLJGiP0/zN0u7rs42Uegw9yBazAhDfxMDwKpVFJ03 TQdY+bUAqzE+LO3gd5XSQaV1UAPd9XFi6QauN/RZvVf7VZsfKztf+K4qkC5xXpJjkMHtKekpSEtL RML1Swjx9UAfgqter7wIs56dMM+oG6a3fhOT3/objN/6M6a/+UfMePsP8BvRHlvmDqPlqjetVUZY OrMbHIa8rhQBVRvmD8Ahr0lYbt4DPmPa0trVGYsJsLYsnIzNLDYDW5EbayjW2ZpgNt2NM3u3hJvx CFgN6Y4VdhY4vXUFVjhYwnH6SLhaTEAI34c4zIavtSnsyMM1wagLppNR3nvBbGwM8sGFyP1Iu3gG e9euwvqgAKwlwFq/YhmOHj6ItBuxDODPRxUpG+5W32SS6msIP3gIhQRYN2/SRSg0DY+1YNURtDZl F+F/dJC7ArCmr9IBWLKAPt3SkUR9g9zrAJZYC962iOCP6unaRXULAcy7BCXy49ZmXh2QEGtQW36W Ug9g6TnXzCy8ntVgMhfvtiRRlSLv1cOX//BbzYnCe2xP2xoQzFgUAV2ffK4BgrKIyY/8GN/zuJp1 BwNdT6OjuNZq5SPg8ZiyUKngUYDYW1wEWlodgR/BjnoIgJDFwYeLvHqI5UqsHhu5MG46kY+tpwpo FUmnRSUSAQQndffWjaM+yNSMbeqSurHJfS3nHCHwY+wIF7NSAio5oummkXpFvu14j+u2JLhxERYW f5FNDF016jF/nQAsyodjqA+wGAejgHBt/TiujFeAihwCpKR+ma9+WnIRUC3XtWG9MmZtuTQzi4DM iXo0NG9imZE5FmuiHGKJEWtLF4Jc0R3RITk0AOu0Mt4NNVacz2m9CzuZr5SNPLe5Rt4CRN5k+9oW LLlXdFZ7nDKmyYEXa8G3zK3MsQBOaV+AqxwiBzkv8pu/tg5gyXs519izJTK7UePmFPCxmn8Qtp4u UMYguiHvZy67iuYcl2qFkzad6JZuQZByIrGS1shr9eZD+iUULNJPmU9VJ8UiJON5k/LU1bVmMx89 pz5HTdU/aU9AvmpxVQAW+yh9USlaYqiT6jMvr/JZDvlernub+iJ6K4eMQ0CbyGgAn0P1edvG3xJ5 jp/2b5Zan1j2O8w5QIC1mQDL2+AirH1K67/5sQGWNshSA9ybCq7kuscBLInBymKAexb5rzJJ6pld LNYtxo6lxCMtMRZHD+yG7UxjmA3sjfnkwZrUvjkG/f0PMH73JSzo/g5mt3kRps1/j8Wj2mOX7SiE 2Q7GJpuBWGbWDR5jm8Nt9NuMxSLAsu6PvW5jlNdlM3rBnwAraEofbF4wEYFT+8GJOQo3O5jigL8d PKcOxuROzdDr5d+h0/O/waIJA3Eg1AMhtjNhNaI3Zo9kML3JKLoMpzI+aw6tWXMwc6QRhnR6F8ZD +sDelDsR7a3hZzsPs8YO5/f2OHnwAK6f5wY0cnrdr2I+RY6znNa6IuZUPHP8BGKORKGc3F8KwKoJ ci8kIalQOEguQw0PlmEX4SOPxb++qbFgTV+JNrP3MZAzHF1pDu8mC+hTLh0XHOW/2ToQIovF2+bh GMxzqoVlExfdFrMi0J1ttyb4US01Yu1oy4VJSr0fdz3nmpkeRqDWv/GJAef5g8x7WSYvvlArA7mm pVUkCVajMJ3/2MX1J4e0ZbcxHkW0QomrTI710bl0C2ZhHV+lD90IXLTlo4zNtf7Y3rMkwLKMpAWn DjRMDbqIZjPr929GyGW8wT634sL3Hq9/jwtQG4KjVuxbgNa9U7gQyhgEnGhbsNSxSd3qIfdJ27Ir VPqqLvzHZTFj/cJKLeelPen34aulyrjPMx5NPeavjeUcaPp0vAZ4ST0ybqVeHf3Qd53IVp9c5Fpf LZCpyOU7zJtcq1rAMun66szxdFXGQ5BEvaoFWNQt0bHtNa4/0bMhBE5v8Zy2vGVORV6698q8ao9T ZD0t6FKtjAQoy1hEHiLT0tsagHWSMWsyjyI/kaOuTBt7tqSN9JqNHFll72v6ybrUV3nf0foo2vE6 MwItAUlyXKJVau6aWJwTFyJBzXuzI5R+yCEApxP/BHRlP2WcflqWURmPyFNb11Q9fSr6Rz2p1T/q 0bvsl4y/gjtS5Th2o6L2mRfdjI7XgHT5Xq57l78H9fSP8yx6NVDP8/a0f7PU+jrTst/Baj9aTN9E gOVlAFi1Gl3/TdMA1gOFXDQpgwHjmSrhaMMxWBqXYE1anawiBsWTnJQlLYs5DLPFrVfCgPdi1kl2 +AwGv5PGIYvgKZsUDNl07WXy+wzSOsj7HFI4ZDLRsQArAWfSD3kvOxDVcyprvGLJ4q7BzMxs5OTm obiI/FdMQ1PJkpUQj2unjmN/2Hp4zLeA7bhB3EX4Fvr+5X/R539+DuPX/govo3ZY1OUNzGz+OwSR jX3HwuGMr+rGgPZefO0Ov8ktEWzSnqBrIC1Y/eg27ICVtHAtn0lX4oSe2Gw9EdvsjGHd+124jCBf lsVoLDUbgXU8v3reWNgOa4NpHV/CsDf+jEkMag8yGYtN3FXoPnUs0/MYwX7aONgbj4Fx/04Y0bEZ ejT7M4a0fR1OvM6XcVrGg3tieJdWsBw/FGHLAlGQkYQvPryHe5UlqCzMx+2KMmQkJ+Hg3r04GnGE OQwrcPs28xUyBk0ISato3SrlzsICAs9CUlcUCcgiy30eU9bkSlEY7xm/xvf6UuXo5nfU5cFqStqc nwDRqAZgtZu+Aq1n7WWcAXcS0hwuP8RPu3Swlh/Fk7X/OrecysfbZocxwPkkCSxrXAgEAJ25qHXm YiA/omnFmnir69l3FNAhJaVQ4wKSV33nmpkegtdOjWtEDsewBIIS3stirGXl8eQ1sth05cLYlt8d jdPEH0l8SgbBxqJN8UpskhzlBBZXMm9jlDdT9HAc3XTko29s784OVxa5gH111ioBSdI/nz0ptf2T xUMWaVk0ReatCaykPy252Czen1Z73VTeKwu29DlVjUMTGdSMTb5XD1/WL7LV9FUWOI2LRbEWsE/S Trt5R5QF+f5Hnytjtlh+lS7CS7V1zF55jcDvEJpbhEOAmRxSj9zb2UbTV+0i9arWB/U6aUN3zhuS y5szmzhvO5IVGcbXBPV/9sXXMA2l25ALcYtZ4YqLTI6PSOTZz/mEIgexDqrHNlqA3jE/TMBxVJP+ REA2wYqAM9FJOcQyIv0W+WmPsR1lPZHWTInlkmP7mQLlXqmrh10daAgnYG3J+qTueVoAS97Lucae LZlPdcOCgCfRw3cICKWvnagjMv+iK1L6OBxXdFUZ7z+/xDVaWEXf5LkQ3YuoiVF7wDke63tOGY/o VdABjV6Jy22i/3mC/kOP6KnM/Q+hfzJHAkjzKj9Q+iDz2EN26VGGMraTNbFxuYxpk+vk+qbq1dP+ zVLrkz+e7a32ornxRgPAqn2SHn3TVICVRqCUmFGIJL4KyNLeUajuLNTdYSggKj27lCCqEMnpArLI hcXPmTllBFvFSEjJQ3xyDtJYXy6BVA7de1kEWQKqpAjgSud3GQRi2fws9UkMmAA0AQICqMRdKeeE a0tAQT6BRkFeBvIz0pDFWKSEU+dx4UAkLocfQcSmDfC2EetQP4xt8zIGvvhrDP7TbzDs/36FqQRa bh3fgXuP5rBkrsGAsW2waf5ABDIGa9mMTlhr2ZMEo52wbl5P7HQcgnVz+9KS1YFxWN34SgA2ayR2 Oc5EyPQhWNCrJVbOHMUyAk6M5Vo7exjOLbfBIY+J8BjxNsa/+lsMY7uLuGtw6xwL8mhZwHHcGJgN 6oeB776ODn/+Ofq89jsMa/0ixnR8De6sa7XbHFiO7YuR3d/FqB4tYW0yBtvWhSL+yklUl2Thg7uV eHCH5KoJN7B9yxbs3bWbJKXFuH2HiaFL81kKSNnAeNriEtI9lJJ8lASkklaHmwdyCViFVb2hPJDa KXNUkKUPXOljcG+Iyb2ITO4CoDdseEZjsNoZL0driz3KTpkuNIeLFetpl3Zkiu9lf0xhs5ZjQ0wu XjfZz8U6CpHcZSZHBWOhjBxj8NqM/TBderl2x6Fm0YjAO2YHkVTjGpLXt/lZivY5qXOs7xkGmmsY s/deKKIV4xDLQew6pwlillir0T5nmH9RM1ap2zT0EsSFJIcAmFaW4YxT0sT5yLHtdD4XR1r4FHBR v+iObSPH1mzmAbzFvnnvSqqtY6zPWaUv4/zO1gbFyyK34kgmetuTQsL6CJy3JmDBulgCm0Pw31sH xFZHZeEdngs+lE5eJc1GgTTpJ/vUZm4kpgTWWefWHs3GUPdTGOZxiotWOC0rmgBpAZFvmB5U+v/u 7MOIvqEBlXfe/wz9nI7jyHXNPMjhT5kvWB9LIBaJiGulyjmpR2TVUY+OvGF6oBakynVt5wrACK83 5yKXNymXt80ONSgXmRs5Gps36fvS8LqgbOn3IFfSJrBvZ7mjUA6xPk5afJ5A4zAtPZdrraSy6cFn d3KNpfYovHYlY9aKK3hl+j66DTUxeqKjoqsydu25lvnptegYwbYmhkn0RM69bnIADptvKOcEFC3c EEfak0hlvixYt3rIeznXrZHnq82cSCw5mFZ7j8TzWa26RnlGYhjnVJ6Fsb5n0ZG6K3MbQn1QD4nr G+PN/J68VmSxaGNcbZyZ05YEpZ9yX1Khxr16OeMWenI8b/C8rp6+Snlo/zn4vvon8tfWP+mDZI3Y GJOj9EFc8KO9T+PV6fsx0pPhAjWxieujcxT5y/Xqn5/G9KoZ9e9p/2ap9QlFQ3tLAVgbCLA8DRas Wo2r/6bpAKuQAItWrEyCJYIaXVClj7pBQI8AKQFWArLkfUYOLU85tGDRkpWUxriutDwkpmTjyvUk vjIoXQhICaBUkJXM79PYrizGEtwuFiwJlhdwpZKfprI/GQRfiqUrOwN5OWlIvRGHo/v2Y41fILzn LYAXaQzmThiLcX27Y6JRJ4xknsFpbV+BLVPiWLZ8HSYv/xnOnZvDnYHp5i3/H+OqWmOr7TAsmdIe wVPbYvvCAQj3Gotwn3HY7TyMVqxB2LRgiAZgTetN0DWD9A0jYdLuZTgP7YItNtMJ0CZxd2Ef1tEb m+YNx+pZPeA29HXY93oVc1q/hNF//i3GvvhnzO7UFnNJNjqi9TsY8PaLmNGzBWb0eg+TGSBvNbw7 fKwmI8jWDG6zJ8Fy3EBMGtgF04b3wfRxg+G0wBzRB3cgOzmWQItWxYQ4bNu8Ebu2b0U+8x1WVpE/ q6yIgf8F5APLU1LqlEnyZ0kOTXCVR7nmNQFcqTke/8sA1i50nHuAAIsWDrFiPcXSiYtQT7tjdNXU xd3cfPAprSaX0ZqLRHfbo/znWqEErcq//5kEO+klD5QdYRv5Q9tWFnUuDO7bE7mAadx2ErTssiUe btsS6p1z25bIf+mHYRJ8kZanjxWSRw/e57EjEZ8TzFTf/xTmBG+tLQ+jW80YBVRKG2dTNC4Vufat mQcxnADlE+48lGPy4nO0LgnAqi8bdWybjtft6pJ2py+5wAXjFBK06BO20kLS34mxQlxkZy27gts1 IFDqv0crnvxrF2veyshMtOA1JiEXa3dLiSMopeg+trEONaZFLBOHLhej+8Io9CcwVa0Cyi4xWgjM KEcZu3oI6JzNRV5k+e6swzh8RRPkLofI5SqBQ075+7XnKu99QndSsgLA1EMWdGmvM+dUlUXH+ZGY QxBw94O66wTE9GOf7LjIq0dh9YeYStAznEDhek7d7jKRSz+Ry6xDMA259Nh5k/YE6FxIrdtlKfMU yzpFJnII0EmlvARsv825tN8UV2s9VcZL/Stg/JbMgTP1aHLAOaVd9ZD5FJ2V+dWe8/YEjgMIRq9n 3Vba2MzrLFdcVdxg/6QLUkCJ6ElHgoNhHicVEKMeV3mPnJP+N/R8iVzbURc3n8itBUdyfxFlJ5ZB 6fMM6rZcI/WIPsmzJEc0Y7/azqGFSAAwSxs+Wz4EkOIaFZ2RfoadyFN2J8bn3cVAFwbG8zmYQMCv WoulHtGLHnwmjanD6m6976N/5ksv0RVcZ03W6B93w1KGHSifvecLFRme5zzKmC5y96BsRDh0uUQZ WzteN2/1tdo5lb6J/vXm3K87VvfnJ6P0IV23TFgtgPgp/m6pdXXiH8/2lrvRfNp69J9hAFi1Cq3z pmkAS3YR5hNgcSehWIzIMq4NsBriwxIAJG5ANdhdjb+SVwmGl/NigbpKcBV+5DjOX4pDfFImLl1N QFJqNvPvkZWdlqtUAqxU2b2YkYt0oYfga3J6Dvmtsmn9yiMoI7hinfFJGbhBC86VK2cRsX8v1gWH 0h1og+lDh2Nw+3Z0r7UnOOnJXXp87fY23CYJ3cI0BBKouPTpCK/+HWHP8zMYgxUwsSO22zK34Lh3 sdK0M86FmiJh8wIcD5pGcNUfO51G4USoJYPaR9EVOBgrSSxqM6AlZnR4hYHvY2jNssB2u+nYZjsZ S7nD0GHw25jf689Y1Od5uPd/Awvbv4xJL/wPhv3xVzD6wy/R74XfY0b31nQXjoDH1GGYPaATJnd9 F3OG9Ybd5OFYRBoHXxKUes83h/U0uhFHGGEaLXEzyN9lPGoQFlnORNT+nYzLOo2928I4/t0oK2Lg e7Ukuy5kvFUJSiu5WYpEpQKoZA5kx2UuczbmFlLOOm5BfZ/FavjfA7CmLUNr853oOGc/upCxWH6c n2ZpT5b4sd7kcDrDIO6TuQxEzlXeL6aFpiNT9LTnotBj4RF47kjg9wzm5ffbTuVhwVpSBfC7Drym tx13SEUzIS3Py/3yKmVrzat6Tv4Z917E3W9crMf5nCZYyVCu2346D2toBZJzAq50xycLk1noRS5A uRjiysB19rkdF0qXLTewPJw/6mxf0mXo3lc7NoLH2rGxLU+CtEUbY5V2pW9S5L1J8AVlvK1mH+Ki fhZrj2Yp/dtzvoD/6rMxhedkzNKO9GHW8kvKv32RVwgtGyIvqVvGZb8pFmM5HokRkTqnBp7jgq+5 dv7qq+hLK0wYP4uMVPksPZzOuhlTwrqlrfXHspTv1kRlog/lNp6ARG3PfOlFBO5LqR2DKkeRj/RD +tiFdUl9IiN1rDKHm9hnkecWylN7/B7bE7Bw3fVH5DJ9yXkuvOHK3DRl3mQuOs2PUCwvUv/ucwXK XM3juFfRIujM92bsv/SvC+Uj8jbjgr+ROrRd5M3rRfajPckDxe/8CSR31MyVzOMOzqforPRJe867 kSuurdVhGFG2AXuTNToo88txzlb+MNAKzPZkDqUvOzkX6vjlvZxrN+dR/dNuQ8Yl9zsQFEq90pfd Z/MRtD8FfdiuKnuRu/TPKeyG0oaiW1r9lX5If6RfMqfKuNgHqcfIga5xjkP0xmlznHJe7ae8l7pa Ui7fV/9knP0copV51n5mRU9U3ZZxOrJtaVf6Jn/AZCwdeV4dh7ZeST2i36JXUq/6vMl5mQvR6af5 u6XW1Yk7CNvP3oXmU9cRYHkYLFgNIKymA6w8JJCmQQFZSsocDeFo46Sj9ZNDq7FSYoHSFLobWVd8 UjqSU7Nw/UYSIqKOI/LoSb5PRlxCKkFUlgKgsmi9yiBgkyKgKp20ERlCXkrAlcF4r3SCNeU8g76v Xj5LzitfmJDV3GzUWIzo2hXjenXHzOEDyDPVA+PI0j683SuYM7QzltE6tJKcVEEThsCVoMak+V9g 3OIPBFidsdV6CFabdMLWub1xavEURNF6tX5uD1qt2mGzzWCcXWmNCD9zbLWfDEeSkk5r9yL8pvTD DrK373efi4MeVoj0nUswZgxfAjb7/i+SX+t52Hb5K+a8+yeYMZn0eBKbjnzhfzGne0uEzhoPj4mD MaF1M4xjjNak9qR56NkeFgN7YJ4Qoc6cCp/5s+FvO5cEpVMV7iwznh/WswMmDOqNWYzlcmSuwzVL /HE+JhI3ywvw8OFD5iqsJlhlQmgGuOcKGSuthEUVd1FazcTRRTfJFSYs+MKG33gRRvemASy6Jcvr F31M7rLJQeMiXI9t27ZhL2PHIiIYthITg/PnSftE6omUlBRkZ2eT06uQnF4SU3ZbGdNHH32ETz/9 FJ9//jm+/PJLfPXVV/jmm29o8PlW+TOqlgbU/v3n+EWdWULrKjXIve20pWhlvoM7ZfZxsWYcFq1Y T7N0ZX0dGcfwrgV34pgzWLSmtLaku0osZiwS59BqNrlmeM17sw4or22sZLHSfK/kAuN57fvfq7m2 3jleowFC8iN9uLYuqU+KnNM3Nrm+3ZxDSv3SV7VfrdhHaVetU/de/WNj37mwtZX6tMYs7Xdg+7Iw Ku3xvbZMpB3d/rWlDNQ6RD7SD1VOsnh2nCcWC814ZeFWr5X7HpXZAeVe9XppS21f2lZiTXiutg72 X67Xlq9cr2yG0NERzXV186OOpd6c1cypyEV73Npykb41dd5kfC21+if6IkXqk3kTeWjPV/350OhZ B8YdylhEF7X7L3WoetDQnEvb2voqMlevlTnWng9FhqxTA64I+h73jHFsmj7VPC8yJrYnste9V71O U/ejz670S7ufLWcd1NJxxvxp6Zi0pz0fT6Z/us98ff2T+ZO+a/dNPms/a7r6p+pVvd8Sykb9LXms XB8ndz3fi2W/3eydeGfqGvSb4W4AWE8IsARIJZDJPZGvSVrgqjGQlULAo7FuScC7xrWnnVpHXH7K eX6fRyJLAU3X4hLpLkzAidPnsWvvIVy4HKtYrFJoscrOJ4dWLq1eGdm0YGUT3OXQ/UhWefZLeeXn +Hi6yLZshMWMaejbsSN6NG9BcNUT1pPGYuqA7ujHHIODOr6Obs3+H3q/+SeMbfc6rPrRejVhMHzH D4BtXwaRd3kVgVN6YLv1MKymezB4/DtYOvk9eI98jezurzNlTgsCpjbYuGA4djpPwXKr4TDu/BJM uryC7YzDOuxLS1eoC04uc8aRxdY47GeJbY7jscqiG0ImtYJDj7/D4q3fwaLZnwi0XkbgyL444DwH oeajMbzZX9Dhlz9D59/+Bv1f/Avm03XoPGEkZg3qw1isadgZHIBg+wVYZDIZrrOnw5bpdszFikVK h5G0wo0nUel8k0lY5uuCK2eOcidhMaqZdqeCzO+FReIOZAwW8xoWVdxBXglzNjK1UCatV48DV/K9 hmyUFjGWxmOwWD/dkNpFH9GokMc+ewDrWwa5nyS/0tRQtDLbzp0ye9F5voAa/ogbikEGBh0w6IBB B2jZ34d2s3bgnSkEWNMNAOtJXYQCZuLTswiysmnFIsAhqFFLQ/FYutatR5nd8+mmYoA144BSaB3L oNswn24osVZduZ6II8dOI+bkBURGncRxBqunsc0MpuxJYT+SUjJo3cpkAHwuMnkuk1asVIKunTu2 Y9TQQejwbnMM7tYNgzp0xIJJE+AwYxKGd27Bz6+RzLMTRjPWqneLFzDgvX9gQtcWsCFdQrDZOAQa D4HTUCZythyO3XajsXjY63Qf/gn2vf8frLv+L7xGvYHg6e3hyBQ6nkz6vM56NGyHt8EYBsY7j+uO Az7zcTTYEdGhzogOtkckAdaRJfMRGTgb+1zHYMu8/nBl4mizN38H567vYLvZBJz0XoT9zlaY17c1 ev/x5+jxy+fQ+TmWX/wMk1u8iVk9OmJmz87wmD4JwQvmwMl4EnzmzESo43z4zJsJdytjWNICN3FA N5iOHoBZk4ZhrvEoBLouwJZ1axB7+SqtWZW4c/M2aRvuKImfFcufyJ6JoLMZj6XkcSS1RWPlv8OC pQAs8itNCUarmdvQwXIPOpOxuAuDOg3FIAODDhh0wKADh9GRfzzbWWzHO5NXo5+xm8GC9cQWrOwn BFi5Sj5DTdHkKEzPEdeehs5BgttzC8oJnpjzMC1XCXRPSs1R4rKOHT+HQxHHsG//YUQeicbVqzeQ QYtVnuyAy2MAfWomsuguzCNgsGc+vt//7//gj7/5Nfp37ASr8ROYloaxS3NMMHNoN4zt9TZsmCfQ jQHoXjYzsH2pJw6tWYwgsqnbju4Dp9E9sXj6QOxy5nfWQ+HV729wI8ByM/oLnIz+jJCprbB+Th/4 T+4EL7oRfab0xNRO5M7q+TrW2dGNuNQR5zb44XCALfZ5z0HMcntEL12Ig76mtG6NRohxV9j1pCXM qBX2WE3BlUA3XAz2wLrZk2HFwPZxpHAY+btfYehvf47Bv+Nuw7/+AUNf+BOM270Lu5GDyN3VH950 FbqbToLNhGFYbG2GFS4L4DZrKukbBmHWuAGwmjwENiYjsch8PGwtmPvQ2xcRu/cg6XosbldVoYrW rKxsyo9ErMV8n03LlgZg1adn0EfX0DQL1i1ar+oXlZ5Bm6ZBqDaeUQsWc8RNDkZL062MM9iNTjSH d2ZQp6EYZGDQAYMOGHTgkPLHs635Nrw9aZUBYDVkvuL5psZgJdNqFZ+eSQtWFi1YWYqLLonnknQt WZIQWkkKTfoFLuJSJI+h4s7L0hTNeQIt5gmU8wKoJJhdKBqSUhnAzp2D6QyOF/qGZAIu4dA6d/E6 du7ai1179iMi8hj2HziM3Xwfc/wU4m4kkt+pmq6wuzCeOhXP0frzyl//jAkDB2Iayzimx/FnkuWV rlbcSdgdcyZ1hxf5qg5tDUVV5hV8Xp2N65Hb4GMxDg5je2EpKRf2MZfgBou+cO35e/Jj/RmBI15B yIR3sNGyO3YsGsZ0OWOwzGIgLLq/BlMWP9P+2OFhgROr3XBhUwAilzjgUIA1ogmwokKsEeY4Dt5T OjAZ9DsIHN8dh+zNcMLNFnsYtL6b+Qi3LjTDsrmT4DiwM6b95f8w4Xe/xpQXySrf7O+Y06ElXIb0 heOIAVhIclS3yQyoHzuYAGs4vGZNYxLpCQgg0PJjqh3rKUNgMaYPrCb2w4Lpw+FKGggHi1mwnz0L S329EcU0OxmpybjJZNKVDHovYGqdXNI5KGBK4cBSebAkn2N9TqynGeReTJqGZx5gvcc8W+1myU5C UifQimUoBhkYdMCgAwYdOKgArDZmWwmwVhoA1tMAWARU4iKU/H4KsOJ7xUXI2KhEBqJLSVLiogiQ JE5LdvnxOo37kPfwO7lewJZYriQ2K1lAmASry05DAimxXmUK6SgpF9JIapomOwfFokXQlcL609K4 SzA+EUePxWBJcAhc3dyxbt1GRB2Nxrnzl3D8+EkMHjAAf/i/32Nwr14wGT0GrV76O1769S8xtX83 bPSzw2rPWYxb6g/7OZOxb/Ny5Cacx/2SdNzMvoEL+zZi6QJjBFuMYKD6dCyd0g12HX4Lz75/QsjY Ztg2pycOuozCXucxZHGfglVzhmFm11e4G7EXtnmZY7vXLIQHL8LBQFscXGyD8CUL+dkGe30tEDx7 AGyGNkcISUmPeM3GEdfZ2DB9FPyH9MSqaaOwy34WdrrPQ+hkuvde+Rum/eG3mPqn/8WUF/4IH8Zf 7WLKnCACq1nd2mDoa39TaB2WWM3EgpEEkb07kaB0NKkopsOFVrGFZIU3pTXOZFRf2JEF3mOuJVyt OO6ZM+BoNRthq1fgxpVLKGJ6ndLSEpQwnVAuLVjirs2lmzCPwexCiyFB6Ar5KBng68CVvGewO8/X j8O6iULFanX7EeuVWLN+chas1pOW4D3m2erIQM5uc3cbikEGBh0w6IBBB2p0oMucXQrAenPiChgZ uxpchE/oIkxKERAlYElyEgrAyiT4EesTY7MYDyUlke9T6O5LJmCKpxUqnvckKwmiSfHAVwl213BY EUDJdQyCT2N96fwui7sAc7irMJOgKpPnMnlPSjLbIF1DGl2FqSmZyCE4K2Cge2pyGuJibyCBYOv6 tVjs2LoTdrb2mDJpCtq1aI3+Xfpg6ohxaP73V/AHWrP+8nNatP7vNxjbuyP8bUzhQ0tPoIcLjoUf QkZSIgqysnCrtAjppHcIdbDC4tmjscPdBAHjO8KyxS/h0PV38B/xGsKdRuNE4Exsp/Vq+eyBdCe2 g91wEpGSpX2Hzzzs8puPfYE22O0/HweWWONQ6EIWG6x3ngqnSd0QZD6MQe8LcNR3NlaRnNTb6B0s HtQSayb2xaaZYxA8cSg8+3SBV+sWWMhciVN//xsM/8VzmPPOa1g2dggCRw2EVccW6PfH36LX//4W w//+POb24vWML5sxqBemj+wP29lkkrcwxhwT7jI0McbMUXQXTh4LZ1Naukymw9vKEk7mZnCeY4V9 5MpKTiI5d0EuysoqUUjG+7w8xsEJ8z3nKYvu1wLGaOUwuD2HcVoFpVUK+JKdiHkFpQRYvKfsJvJL byKXAfN5ZbdRyN2JTQJZBF3P5i5CJQbrIlpNXoI2M7eg55zt6DXXUAwyMOiAQQcMOqCtA92stuEd WrCMphkA1pMGuaeScyqZYEe4poRWQeKekpIz6NIjCKKVKl2JqWI8FMGVpNRJpOUpgYArieBJKQLO eD5JQJhCVCp8WrRSCb2CnCOYyuBrBncMCsjKEUJRfk5jm6kkIo0nhUNifBLSUtJx/UosYq/F8XrG XtGSdvbUOYSGLMX0qTMwqFd/jB8wEn3ad8X//ewX+MPPfoYXfvlz/OVnz+FlpsQZyVQzXtbmWB7o jwtnziCfbsr8nFw8uEV+qKQ4+C0wg+u0wdjpYY5l03tg9rs/h1Wrn8F3xBs46T8DMYvNsGYOdxxO pqvR6E0EmQ3GFjdzWrDmYH+QLQ6F2OEY3YSXdgbi8DJbrHGcghDrMQjkTsO93laI8rfGDn5ePqET /Pu/CZcuL2BR+7/Btfvb8BnYFf79umGVUS+sG2CEea+9hFG/+SXG/fF/MP31FzCr5VuY+vY/MOKl PzK9z6/R57e/hp1RT2xzs4fXbBPSNoyHybhhmDF+FBzmWcGRZRHjteaNH4Y5o4dyF+J0+NOatWDy BJiOGg5bKwt4uNhj86b1yMnMQnU5dxrmFyogq5ipdIoJuvL5mkaLYyaBbS5jtXJp1con4JJchsou wQqxTt1SQJYArALuTpTP+tLmyLkC7mCUItauZxZgRZy4iHdGueHdsT5oN9EXbQ3FIAODDhh0wKAD 9XSg3SQ/vDnCHT0nLjJYsJ7QgpUt7jwCmvj4ZKWkEOgkp6QhjQAnle474bESoCUWq7hEgiBec/Fa PM5evIbT5y7jzPkrOHfpOs5euMrA9VhcuHJD+XyRAes34pIQR2qGFAK2dAK5pMQ0WqdSEMtzl+T+ Uxdw+GAkNm3YjOVLV8DDzRPWZGd3tHdSPq9bsx4uzm4YNWI0xg8bzd2DvfHSH/6EP/7iV/gbg91f oIvwhd8QaLG8wrQ4fduSZsHVCecJsArzCxRQUU03WXbCdQTakWfKYgx2EDSFGHeDdYf/gVWbX8Fr 2BvYaz8K+5wnkAerB5xGtYXbhK5Yt2gSttPteDjUAZd2LMH5Lf44vckHV3eHYI3DFHJttYSvxSBa uGYx0N0KuxZNpqtxGDab9MKy4e/Ct8c/4NT+eSxs/TxcmGw6aGB3rOUuyB3c+biCr/NbkBOLge6j WMb+428Y+Y/nMeylv2BKs1eYlPpNTOEuQ5+p43Hj0G7sZn7CGcP7Y8bIwZg1eTymDB8Ie7Op8LCc AdspY7FoyjjGa02Dp5U5XYbmsOJuRDPeO2/2TPh6eOBY5BFkZ2TiNhNE3759h/FZtGgVFBFo0S3I /IXCO5bDXI+K9YqWrAIBWQRNJZV3UFx5WwFZOcXVyquc14AsDQCTUsDztQCLn59JgPX1V8xfRhI2 G591mO28DJYuhmKQgUEHDDpg0AF9OjDbeTmcA9byH3kxviURoeGoL4GmBLnfu3sXNy5fQVJsLLJI /JiVlko3XYpSEummu3DuImKiT+DMmQu4TN6qCwxIPy9AiuBIXs8p76/iIr/TFH4vwOnsJZwl+LrA 70+eOItTJ8/izOkLOMfzlwm+zvO706RnkM8xx05g/94DOLDvIHbv3IP1azcgbNMWRByOxAqCrGFD RqBn914Y0scIXd59Dy//vz/iz7/+Nf5GV1ozBry/88Jfee7/8DO6DF9//q/Yw3x9BbS65TLovohA oorJkOPPn4H/QgssmTcJ2xjkHjqjF1wH/gN2vZ+H08BXEcodgFsWjiaZaBdYD2yOdbYTsdXNBOtJ JBq5whEJh1chdt9SxKx3x9HVLgieNwa2YzthtcNURCxdhD1uM7HJiml2ZvXD5qldsGbku1g97B2E krbBpd3z8Oj2BtaTi2v7lInYPnUKdswwZpB9V1qvXsa0Zq9iEsu0d9/GyJeZo5Duwckvv4Ahf/kD LLt2wMVNa5BxnDlLF87D0M5tMaATE0uTWNXBYho8rEzhYjYNi4wnwJaAyp2s7/52JCudPQNOpHtY ONsUU8eMhuOCBdiwaiWunD+HqvJy7jYkgCLAKilhDkPKR3i0igisChmnlU+QlStAi5xYQiparFiy aMUqqSLAoiWMRVyK2gSj8lncihrXYjUB1jPIgyWspZWVlUhkdvBLF5mq4sJ5QzHIwKADBh0w6IAe Hbh86RItI8kKA/TXX2vygRqOOgk8FmB98gnu3rmN04xXOsNyKToKcRfPIeVGLJLi4pAQG4dLFy7g VMxxnDl1mu8vExxdYWwU097QEJDC2KlMYVin6y+VVq5kWqkSaKG6QQtVIl2NqXQxXr+WQJB2WQFU Fy9cUyxaEnMlbsNsugplUc9hMPzlC7SCnTpLa9cN7NmxG8tDl2PV8lWwNLeEUS8j2C6wRaifP8wm jMfbL72E3xJM/fFXv8Qbf/0LXvnzH/F/v/g53nmjGYK8vFBGq9X7995noHeJEtd1k2Di2pnTcDCd CGe6CMOcTZlbcCD8xrwHv3Gt4DnqPYSa9sb6BSNpMeoOz8lM+kw34lZXU+z0tcTxje64tDsQl3cH IXKlAza6z8QKu8kIo3Xr0DJHxXV4wNMCmyyHYtWUztgwvi3Wj3wHKwe+hpA+LyOoxyvYOKYTds0Y gdV0361l8uftjJmy79weE196AdPfegMzWzZn7sQeMH7vHQz+A9PskM5h/It/xbwu7bBh/izE7gzD ZsaWmQ0lDYUV6Ru8XEjXMAnzyPDuOscUTgRUtiQotWHMliPjtOScN4Pn3ebNgvVME8w1nYGZkyfC ycYa4Xt3IyM5CcUMhC8qYKo3ptspIRu8JIoupIuwiIHvRYzPUoAUQZZizaLbT3YHFtLVmF9SocRv aROMymc5L0XOZ1HuzxxNg9DBf/zxx8oPhgCtStLHG4pBBk9LB6rJk/Lw3m3cvlVt0CvDs/WT14Eq /kbeuXNHSashaTQMx3ezYH0iAItrzdFtm3Fw3UrsWbUU4dvDcPpYFC6dOomka9eQxYU4O5WWLVq3 0hOTkU5AK66mdIKnTAKrfAa1Z0uAO12JWfycRcAlr0W0hFTR8lHGRbqq6jaqq8kuTpLRa9duMGXK UezZvR8HD0Zwp+AmBC0OhqeLB1ztnbFr2y4s9glAP4Kq5s3eQYfW7WE6zRTHIqLwoKoCezetQ+s3 38Dffv87NHvhb/j773+P3//qV/jdr35DC1dfxIQfQQVBwoO77xM8EmQRwJXQipXOBNFr/VzgbT4W oVZjEcBAdP9JHUk6OoD5BfsxJc4ErJw7HD7GfbBFeLLczQjEGJe1xhnXDgQTYC3GxZ2LEbF8EZbZ kLl90TQcCFmEA3Qf7gtciGNBC+hmnIh1M3pgzZhWCDb6O3w6/R4hPV/EtnEdcZRxWrunD6MlqyO8 CaT20rLk0qMzBkuAPlndLVo1h8uAvpjTuR3G//3PMP77X2DPRNErJo9DuKsDTi9fgn1+noz9CkLm ueNIOh2NNQE+sLc0wzyCqtmM0bJmTNZCc2PYsXgy7U6w40L42syFM3cZOs1jfJaZCWZNmYT5BFwh ft44E3MUhdmZuFVehjLmM1SC4CmrEoKl8oqbpMeg20+Y3SnDIlqlSukqlNgssVJpLFh1RQOwVAvW Mwqw5PGQHwr5Nyb5dwzFIIOnpQPffvM1Pv/iS4RFxXHniCTR/pdBvwzP2E9eB+S30gCu9EPLx1mw PiEwvXPrJvavCMKuYBJWrl2OiM3rsH9rGKIP7MPFmGO4cf4sUq5fQVZiAgozM1FOq0cFc8eVMG6n jC6jSi7CUsq5AMtrAQFXPK1U5+n6O3n8NKKjmX/wyFEc2H8QYVu2ISgoGNbWNrCwmI0FCxZi/PiJ GM6EzVZmsxFIYHWeQe1neJ987tKuE2bPZHzTnoPcDZiHspxMbFoeiCHcXderYxuM7G+EsYMHw3zq dFiaWmDCyLEwn26G1cvX4GhkDOO9Mgj0aG1hbFF5bg7yYi9ih78j/E2HY4npAKyYNRAbF47BSsZN 7XCbgfV0CwbPHobtHjOx2Wk6X81wcoMrbhwMRhxB1tktPozHskUYwddO5iHcE7CQOwodcHbzYpyg JSvC0wx7mCB6NS1YXl3/DLe2v8Xyvi9j75TuiJo9FBGzxmIl+a6cu7TBuonDsYpcV3Navonpb/wd Nh1bkQW+OxZ0bYspr/wV5q+9iMABvXGQQOlaSCBiSb8QHeSHoyuCkXkqCh+V5qKqIA/7yG7vZLsA sxjkbsEYLLt5s+GywAqeC+Yi2MkOIY528JpvBV87awQ5M2CeFizLaYzPmjgOfi5OCN+1A4lXLyq0 DpJyp5wWqpJSAioGwIvbsIA7DIsInIo5vyUsupQM6mc1/koJcqc78ZmMwTL8AzNI4IeSwLf/Apbs PI83p6zH1MWnUH7z/g/VlKFegwQMEngGJNBUgLV7iRdW2s/BBjc7hAV6I2zFMvJIrce+jeuxN2wj IvfsxpmoKMRfuojMhBtIvnYVN67H0f0XjysMar/CmKpzZy7iKJM5bwvbiaCAYNhYL8I07vwbM2Yc Bg0egoGDBmPK1GlwcHBCaOhS7Nq1G1euXKWbMQ1JCUlIoGXrxpXruMZ4rqWBIZg+aRqMJ05BaGAw ckgZkZmcjiWebpgyoh9BVW+Mo6vMdeECnDt2DMUM0M7l7sToyOPw9QyAibEZBg4YBltbF5w7dw0l ZJG/y0D36oxE7FvijlXWU7CbIGmrw0SE0XK10W4CNjNofavzdGyg62+tDT+TK2uf/1zErHPClT1+ uLYngLFXDgRVVji4xAbRq9wQtcIN1/esROXFw7i4wZcEpjOxT+qa0RPLBjeje/BFrBzwGtYNfRdh jNc6YDYC+ywmI2hQdzh2bI7V4wZhJUlFPft0QuiYQQgY1hf23VpjTotXYf7K8zBlwLtjh9bYS7b6 TeS5sh/YFzaMvdod5IV7eem00t1FDmkXrsfdwDYCJU8fD7i5OMDSZBosJoyFHd2Q7rMtSF1hCW8W dxKTejEdjxdjuZzmzoKdpQUWcbehlwPZ6Ok2zGTMWgWTR1cz7U4JXX25dPMVFJYqlqxSWiOLlPgr NbhdEj6rjO60bGntLnxmdxE+A8+koQv/gRL4lhnIg3ZcQLNxS9Db8RSMfJIxNeAkd4fc+Q8crWFI BgkYJCASeCzA+uRT3GMM1sGlvnCZOhLTerSFcf+emDNlAqxnTGUhvxLpAAJo6QhwdVFeF7u5wMPO FnNpgRo3ahwG9x+MQUYD0bt7b3Tr1E2Jl5o2cRrmW82H4yInrF69jtarQ4iKOoaYmBMMjL+IRHE1 kmsrn7FS5cyjV0YrSSIB1h66B33cvDBjsrECsAK8/HDuxBmkcNfiUroRJw1n4uNRAzB7+jh4Miny ldMncL+6Gveq7+Jm5V1UcPHPTMtnvNgFcmc5o0+fwXBz8+O5HDysuoWS5Dhs9XXE8nlT6AY0xUb7 KYggWeipta7Y6GiMldbjscXFRCk7vSwRRsC0e7ElotctYnC7I6JW2ePwUluEL7MnXYMHLu9cjvLL R/Bp9lWUnj3IBNBO2EH34SYG0K8a9S5WDGJg+7AW2DiSFityaq0e3hlbpgzFbtPx8OvdDotavwbr 916Ge482CDMmV9YIIzLLd2J81gSEDOyFwb/6OYx+/jNMf+lFzHjtZQx7/k8YwJ2GDqRruHp4L0rJ 1C5uu3Ky3Gcz8fOZq1ewhfxXs2fOJBAdQcb3yVg0nfFYs0ywgC5Eq4mj4UzKBx/buXCdbwlnWrsc CLrm0/q1yHoeVixfgdOnufuSbsKbBFnlBFvFdP0Jk34x3YF5EgBfXFULrIq1UuYoNA2qhetZpWkw /CwYJPC0JaCxXF3Em+NCFQbsfu4XMWlNMUFWIqb4xaC06u7TbtJQn0ECBgk8AxJoEsBiDFZEiD/j j0hQOWYI5gwxwkTGBvV842X0YBna9j0MpxXF6N230Kd5MwxnXNDMYQNhPm40Rhn1xcQhQ+Cx0Jap WnyxMmgJtq5djyP7DuDM0eO4zqB4cc/dpbX8wZ2H5GKi64jWqLMEQBs3bIWvdyAc7F1hb+sEZztn eDh50GIVih2btuPgrgM4F3MW+WR6v8Sk0C4LSduwmPxW3E13aOcW7GesWGF2Om5VkHmc6X1ySSNR xpQwtwm0Pvvoc5QwNc+smbMxevhonD15BveqCADS0rFpaTBdZYsQ7EoeK3/GVx3bh7MHNmO9jx3W eMzHJh8bbPCYg3Uus5leZzTCSDJ6cnsQ9i13Rthipr9Z7oH9awMQtXU1Es8dRVlmAu4UZODjogxk xuzDbo95WMl8hyvGcCfhiPbYNLoTwkZ3wfqhHbC8X3uCrT44MGMMNg/vC882b2Duy/8Pzq1fR+iw 7rRevQ3XAW1x1MMGEc4LYdX2XfRgUuhuDOgf9OufYRjJSccyPmtW27ewdMZ4JEUcwEMGqFdxF20B Y6iyCFavUb4HmUg7NHQtHOY7wmamJWOyTDGfgNl+tjk8bebDfhY/T59MkDULXrZzyABvyvis6bCh tcuN+R7XrxA2+CuoLCtHBV2GQlRaQjqHAgmAJ+AqoSuxmOCrtJI7DDmn+ZJUmu7ETJKU5shORAPA egaefkMXfnAJCLgK2X0Zb01Yik5z9qOb7TH0dbuIUaHZmEiQ1dcrAVN9CbIMlqwffC4MDRgk8GNL 4LEAS2Kwbt7EQQZP73Kxwwa6kVbSqhFqbQU3xunYjR2BBaOGwnKwESyY0mWBEFoyPUswd6etcnfE MjcnbF8WguSzZ1CVnYWPqirx2b17uFtCAkvuBoyi5WplyAoE+S1BoG8g/L0C4O3uB2d7d9gSMLk4 ecHfNxjBgcuwfvVGxESdQHxsEoPpM5BLtvgCEpvmk9Q06WoSTkWeYMB9MncIZiP2wlncuHoJBTkZ KMnPZSlAVUk5wdZN3GUw/ccPPkY5wZbtvIUwmTId1y9eIRdWOfKZJ/H8mfM4SDqIvbt24cKp42wr DgcJ1nasYYD/ltXYGuLJ4HBLLLW3wMEVXsg4cxBJp/Zj02L213Iq/OhKPbx9A1IYz5WflYocgrzS onx8WFWKalrITm1ahnVzpzA4fQA2CIv7mO7YSMvV5hFdETaiB0tPhA3riQ0DumBD/85Y0qkFvDu8 hYD+7TG/06uw6vY6NllPx+lQf6wjDYPJW68qgfBGZH0f+OufY+Lffoepf/89LN75B1nn56Dk4mnc I1t7Xi4JXwlmswhmC+58iGuJOTgScRZrCLTmzTSF5fRpcJw/D75O9vBjbJb3ImtasMwxz3g8FppN JqWDGcHXPMViOc/UGIvdXXCIbsekGzdQQXBVQfBWSVBVUl7BP+XiKiSVAy1oxQRgxZXVBFYEV5yD XOHVKq1QGP2fuV2EP/YDaGjvP1cC9AoSXF0huFqm5LPssSgGPRxOoo/bZQwJSCbIysKE1UXo63kD U3yOoaTK4C78z9UGw8j+GyXQVIB1eLE3eZzsSVNgyUDveQhfGogT61chkjvXDoUEMCXMYsYu+WHv El+6ExdjV5APNhGUbfD3YvHGOj8vbAxajD1r1yBi21Yc2ByGdUtC4M1dgYvmL4S9jR0cmO7G2cGF VqsArFyxRtlFeO7sZaZzoeWHrO8FpFQoZTB1LkFCAikg0knjkMeUO+mkdMgmU3wJE0YX5zB1z5UL SI67gjuV5XQN0n3F4OxMxnFdv3wNJ2NO4tC+w9hAsGa/0AEm00wQtiEMVbTAlJOCoCA3j25Eko5m ZpPvKw2FWek4eywSO9avxpkjB5B2+RRO7duMsGB3RIUtxc20SyiMPYGwJW7wtbXAaj9n7F4firjz x1Fdkofyojz2kSCvMB/VtCTdK2Ri6wvHER7khvWzxmHT9EHYNrU/to3vhR3jSf3A183DOmGNUSuE De6EPaP7Yu2AzlhGoLVyTF/Y9myB6W1fgv/kIQj3sMc6EolavNcMo/78vxhG6oZB//NLDPjtcwRc z2Hya3+FJ1ncT5IjqzzlBkoZ8J6Wm48sWpNyaUGSxM5lJbeQTMC6bd06Ulz4kd3dEtbmMxnc7sB4 Nhd40c3qtnAO3BdawdacAIyuxEACbe9FNrAxN4GNhRlWLgkkED2JIm4SuHf7FuOz6GolyBKLWT5l KpasIqFukKB42WHI99kEWhncMWoAWP+Nvzr/BWMWy1XonqsEV8vRiYnCeyw6jp4Op9HL5QIB1hX0 84rF4IAkjAzJxMRVBTAiyJrsQ3O3AWT9F2iHYYj/LRJoCsC6y12EUbSWHPJxwV5PRwZ6L+TuOUfs C6ArLNCLJJoBOLYqmLFIHli5aB7WOdlwJ547ljvYwJ/WLlfZvTZiCGbT2rXQeAocuYB7LbDGUiZr 3rF6Dd18x8mnFcs4qgRkpKaR0iGHeQlzkU1rUjbTtKTRvZfBPITZeQXMfchUPYkkOiWrfBpzIgqP ljDM55A0tITuqTTuZLx6/hQunjmBE1EROHr4MA7v34+1K1bDhkBu8sSpmDh+ilKmk9phxbLVJEzN RDVdWQWM98ph28LuXkJwcItWmJT4OGxavRJ7t25i4P5FVBdkoSDpGq4dP4zcuHMoTbmC9YGumDSo J11pVki+fBoVeQLMUmi9SiewykNpMa1seXnI5Zhu0npzl+eSokia6k2LIFnjt5oOZXD7cOya0geb 6DJcN6AFVvV5C7tGdsHesb2xYVBnrBvRG6vG9yfpaWtYdHkbXmMHYM+iuVg3cwrMW7yBSQx2N371 eUx88Q8Y+effYuwL/wer9m9jCWO1jixfjPijB1CYFk9aDMklSFDKFEFZBKpFTPJcyZ2e5dzxGX/t OjatWQMvZyfYz5+LOQyad2Gw+1rSPqwloPahRcvWdDI5tKbTSrcA7tyJaGthAlu6E4MIxsQtG3v5 HGOzbuLO3QeMyyJorWbwO2WbL5YrSbXDgPhcyWvIWKzMvBIDwPpv+aH5bxqnxi14FW8zEW6nuQRX 9ifQ0+kserteQm+Pa+jtfhW9CbKMPK9jkH8iRganY8LKfJ6/TpAVRf/67f8mcRnGapDAf6wEmgKw hKYhMtgH+72ccMjPDft9XUiy6YCtLrZkMl+ELa522OyyEKsWWiKALqtlzPW3O8Ad6wjEQrgIBzJI 2o271oK4O22NmyM2+HpiW3AgordyQSbNQ9KVS8hKEoqHDMXaVFJUQECSTasVU+ewpGakMQUPU/Mw 6D0hJRXxyanMYZjN75gImoBLeJnKGfMTT4C2k9axFSFBcCQtwYTRI2BqTKuL3SK4OrnCctYcmM4w h5enH3bv2q+k4cnnIl9MV2E2KR5yad1JT89g/sN0MpWT4JRUE2dOnsJ6go4TR48gNz2FFBTZKMvN RFl2KvKTr2PvhpWYMWY4po8biT1h61GcnYYKccex3zlZmQRt+QwIJ3Bj3RnM1ZhPQHObfb3F72IP 7CC31iwsnzIQYSaDsWP6AJKPtmEuQiZ37vUK1vR9GxsHtsb6Qe3J9t4efgM6wZuuQxuj9nAc0gM7 bWbhJHm7tjMVjodRN7oEX4bx60wATWBl36sNnPoztovM9GfWheDq/jBkXz6JW4VZqCgWsMc8jpRh DgFsIeOiSsW6JPkGCQKvkZx3Ey1aro4OsGVgux3dgoG0QG6itXKVjzM8rS0UFnhnxuS50xXsws8u C2bR0jWbQMuRGwi4A52gqqqaOwiFnJSUDiX8nMc2BGAV0Foo7O8ZdBGu37AB69evx7Zt27B3717y n0Vwo0MMzp8/j+vXr3MHaQqBdrYiwwryEgr/58OHD/HRRx8p3Haff/45hHxdqIqEI1ToWESn1dLA g/v+c/zi/f/Yp9owsH+bBIitEEzLlYCrzvMO0Wp1Er2czhFQXUYfj+sEWCw1AKuX62UYEXAN9ovH yCUEWSvyeN1VTPKMNMRk/dtm0NCwQQJPTwJNBVjhQZ7Y426HfV4O2O/tiO0MAF/F+JxgAqog86kI mDkJ3sbj4GU8FkvnzcQeusrCQ3zJyRSIcFq/tpFVPMzdiQznjtjm64FdS+hWXLkU0WEbELVjC6L3 keYhMhzXz55GekIciUiTmfg5hbQAJC/NZP5DArDYxEQmjM5iYmkmkaalK4VgKJdWrXymc7lw8RIc nZwxgSlf5s6aiUUL5mMh44lWLmXc1MHDClN8XGwibgi7vDDE07VYXFSBcu4qFJCVRRdkPlO35OUW KJazIsYLXWRc1rq1G5maZy9dkomkciAAYZtCqHqzrBQZpKNYMMsC/Xp0J/WDB+IJCGTXXmEeU/DQ 1VhAeoSsbCatzsjm7rpSBnlXITW3hNxRFbhHt1l5cgIpHpZisTHJS0cyr+H0/kyP0xcbRjRHcM+X ENr9VVqzWmLdwHbw7fwW3Lq1QPDYfrDt2w6mbZvBmXkLDzvOR8KqIGyipcquy3uw7tQc3sN7w3tk b1h2aY4QkzHMgeiAM5tCcfVgGOIYsF+RlYjK4hwmuc4iwBKgStZ8WgMLyc5ezd2Gwm2VxFi2i6Tc CAvbDGvK0ZpAy49kpssJsteTpmOVnzsCnG3gbjMbzvPN6DKch2Dqh3y2ZcqdHbv3IU92gBJMFlCW 4h4sYNxVocL+LiSklUini9AAsJ7es2yo6d8sAbFcLd13He9MXonO8w+jl8OpGnB1FX08Y5WiC7B6 uRBkEXAN8o3HiCWpGL88F71cr2CSVwQDGQ0xWf/mKTU0b5DAE0mgSQCLLp9djPfZZGtJbig77Haz xYYFFggymQivSSMQSpC1Yq4JvKaOguvEYVgxfyZ2eNohcoknTq0OIsVBCKLoRtzl7Yx1dC1tclmE 7T7u2LNY4rWCsZ9Aay8Z4nezHCSJ6YnD+3D5jLgNadlKTyQAyqCrMJOWrAwCASaYFssW32cQGBTQ 0nScLkbTGSYYNGAgFi20IV/TLlwnOEiIi0UarV15dIcVEeDcvv1AYW4XYCUgJ4cWpRwu8sUEFnm0 pmSQYT6f1pxCusvy6UY7eCgCgUFLcYaEqEW8voi59zKYjDovh9YUUhKcPnEa1nMXwNXZQ8nDKGz1 uawvO68Iqdypl5VbjMzsIvaZbPakLsguuom0/HJkkXOrhG3eZo6/3KsXsMPXCd5TBjH34RBssRiK tWNbIaTfq1g1qDkD3rmrkDFZQT2aw6PLW1g8tAscer2LKW8+j2kMYl9MSoooZwIaS2OEkjNrC4Ps w+ZMxYLerTDhnb9gZqdmMO/aHE6je5MgdSJWLDLDhQNhCsgSS1ZBEfnD8nIZm0UwWFCBbFrY8ujC E0CURatbEndVnjp3HpvCwriD0567QedhVYAX1jPuLoTzGUKLlq/TAnjSXbmUwNtzkRWmM4/ibMu5 2LJ1O125GbQ8cSehpMehm1B2GArrex5LOuVvAFhP9Pgabn5WJCCWq1ABV5MEXIWjl+MZ9HZmvBXB kwSx9/GM0w+w6Dbs5XyROwuvYJBPHC1ZKQRZ2ehJ4DXR87DBkvWsTLChHwYJfA8JPB5g/RO3ySO1 lu6/ZbOmYRfB1T4PAiSHudjuNI9EnHMYm0W27wAXbKA7auVcspu7WtOFuJDXLUQ4wcNRAq3jy/wR tcQbhxibtc+XhQHw+5nGZe9iH+xk2RXkj+2BvqQ58MHmYD+ELQ+iy20tTkYdROyVMwx0v0EAk03r Ug7dRsl0v9HVxV1qp0+cgBnBVb9efciJ5c0YoMvIo/uttLCAIIh0AJKsmGBB0vJI2p50AqQs5jfM JkWDlDSSj2ZI0mcG0GcRHImlKZcg6yR3Eq5YvR6bt+4hyMgh1xPpI7KZ8ie3FBWkeTh34ToW2rkQ gK0giWcqA7qZvJjfpWYU0BVYQhdmET+XIT2rmHFjDCzPY1A3wVUmA8uzCdYyCWhKCWTuMNYr6SRZ 7Jd6Y4PjLKwwH4qVE9ph0+RO2DS+E7aM7ozd4xl/NaA1XNq8CM9uzeDQia7AN0nF0O5tBI0diPUz xmEtwe12y2m4tsIXJwMd4DSsC8w6vwHzzs0w7B//g4F/+yWmtfkHk1R3QNB8YxzftR55aXFkYc9C GjcGpOdXIqOwGul5lBMBYCY3DGRRDkW0tBXSpZdMd+wFMvbv37kVoZw3f1ojV3Ajw/JAT1q2bBHg ThoOWi2DvOzh7uKM6TNmYupUY8UCKJbBW7fvK6/5jJMr5EaFHAK5dFoRDUHu3+OhNdzybElALFfL 9sfhnSmr0XVBOHpLvJULQZP7NRh53SAVQ3zjAIvX9iQY60s34iCfWAwPTMa4ZZlKHRM9DhsC35+t 6Tb0xiCBJkvg8QCrhqYhwA07XKzpIrTHAboJD3s7MC2LO2KCPUmeyUWdJcLfBft9mHuPLqndBFe7 XebjIPmaogi+oskEfyzYG8dC/HAowBMH/D1wmAv0Hh83bPd0xU7G+GxjbNZ6d2esYJzWMg8nrA3y xQ7GOO3buRFR4Qdw+SJ3FJKANJeB6OKuOxoeSSb3yRjY24iLfQhS4xJQQtdcfhbdeGmptH4xPosu v1y66XLEVZfKmK2UbFqZaK0ivUM2AZAGFDEZNb/PJsgS6006Adcu0kesWrcZp8/TCpZF8CXAg9cW l99lDFgu3H1IajptFg6En+DOuHsET1VI5nVJmSV0fbGOvAqk8HMGgVUmwYsAlyyCvAyClkyCiywC rVxaxGTnYjlpHAqvn8XZbauwaZExNpj1whbTXtg2rTd2Te6D/VP6kxOrE/w6vwbvzq/Aoc3zsHzv BXgM7YWdtBZup/Vq7bRRiPGwRdqWZUgIC8Yh7/nwnNAXs8mbNb7ZHzHo+Z9hxMu/wfT2r8C8XxvY Mqn0yaN7+dtdgJTcbCTlVCCtgBa2AgItujIzac1KF9BJ914GZZ1H915FJYlEmZfwwumTiDywF/tI XbGcu0a9GWvnT+Ad5LWI1A2L4EnCWT+/QO4EXY29e/YrrllJEC0lXwLcxWLI/IUSk2YAWE1+VA0X PosSUHYL7otF8ylr0GVBBK1WZ9GHVqm+HrEw8k5AXylNBFg9nc7z3osY6H2NICsR45ZmoAfPTXA/ xMD3W8/i8A19MkjAIIFGJPA4gPWxMLlz6/3FjStwgmzuUYHuiCDYOkJwFRXkgegQAU1eiAr2wBGC rUiWw4tdsc+HKWPcmV6Fi+6RQDdasTx4vSeOKFYsN6UcDvTAXm8X7PZyxkHG9ewj8ApzdyCBpx02 epI/izsU99C1uJMxXDuZXy9i5w7mPTyHvKQkROzehbFDh6Br27ZY4u2NDMZoVTA4PpMuxExasLIY GJ3OeK0cJidOobsuKZUuO1qWsgl+MsXClE3KAroOcwkgsrlrMJlgLJuxU3kEE6fOnMXaDRtx4FA4 3YYEXgRkqXTzFSpJjSsRsmw9ho2chFVrt9JdWaQAqISMIiSypGQLwKJljNau5Axarmi1yi+9pQC0 PL7PzhHLGYEGd+5JwHceY8iEp+tmIQPOyZt1cusK7HQxxYZZzHdId+H+mQNwgEmnd4/rhPWDW2KZ 0Vvw7fYKFnV8HQGkcDhsb4UIRyvsmDcNp2i5it8chKTtpInYugRbHGbAhpYvk7Z/h0nr5zH93T9h +nt/wcRWfyNRbHPs3xyKykq6PBmPlcEA9/R8gk2CnqxCIQWtQhKtcCmSqJsM7OlidWNfZUfkLSbU Li8tRhJ3WJ46cQwRB/di55aN2Lh6GUlg/bihwAWbNm3lDs8MBvkziTathtkEsJIgOl8shKyziPkI BWAZXISGn6efrAS+UcCVWK4EXEXS4kSA5HaJVqs4haXdyDtRAVdNB1jnlN2GfVwvYIDXVQxbnICx S9PRnUHy410PoIwpGQyHQQIGCfx0JPBYgMWdWndv3cKplUtosfJCDAHSUVqiopb64EgowdVyfxwV 6xWBVThBlJyTcpAga78fdx0GuCqxWMd4fQzdhNHLmYw41Ec5d1AsXnQhHvR3JUCTc9444OeqlIME YPvoetzPGJ+Dvs4K+IpYuwJndm3HNgbITxrYB93ee5u58sxx5lgEebASyGGVTncf47ToPkznbjgB USncHZjM2KjUHFqt8itoUapkvBHpHApykMDg+fQ8cmmV5JMTiomeufsviUBt545tWLeOvFcMuJdU PZIWJpdgTNjKd+85gMkkJnVy9UBsfAoDtqsI1Aim6ApMZZG4IgEOmYzTypJSE5Ml3F152aUkMmX8 EdsXl6TkCJQg/VwSgOazlDKeLJP8Xcc2hGCzvRk2WgzHDpO+2D+tK3aOaY2NQ94hjUNrrB7aBg4d X4NznzbYQcLScDLKb7WejK0LpyLCdx7OrnZl3kMvHAyYC3/jfrAf3BoLezeDZbvnYd7yT5jV6R9w HNcLERsDUZBOHq8Culzz05XxZ5NOIpN9FitcSk455URrVtkdpBRVI419LSTFRAnBVVl5OQPYxaol aXIqCGjzcD02HidOnmbsWiSOkKU/PjGFSaDJtSXko4xZKxKqBgK5PBYJqBcXoQFg/XR+Kww91ZHA hiOJeGfqWoKrIzXgigHrBFf9fZMIsFi+M8A6rwCsHhK/5XKOIOsKhgXEY0xoGrouOg3zwKP4/Isv DfNgkIBBAj8RCTwOYH2iAKybjKFi6hdSLwjIOiogiyBJSvQyP6VE0ZJ1JNiLxZtAyQvhi90RTguV nDtGy9fxFQE4sXKxUmIElNWArAhaweQeAVjhjOeJZP3Hydsk7UWQV+sAAZbsXDy0xIcB8UHwJ6Aa 2aENBrR+F7bGkxAWshhHdm/FhZhIJF49T06rBMY9SVA8wQLdhelc+MXlJ6zh2YwtyiFgyKUVKruY AdwEWGk5pGQopXWlgoAnN4v5ECOxnbn6Th6PJl0D3YyM+yqgVauCu+HOnb+IGSZkNrdeyDpzlVit dIK3DO4MTKbFKpVFAJYUDcCSOCwWBUSRC4tALI8lVwFeBFM8n0WrmVA4FNDSVsrg+puMHcu+dAL7 AhlAzqD31ZNJxzCdzO6jW2OF0evYMKwlNjO1jgAs85b/QNA4I/JhmWDTXOYmNB6AVZYjlSTVMcsW 0ZI4Dx4Te8B5ZAcs6tccpi3/CJueTLljOgh7/Rfg/P41SLsahfxM0lXkczNAfhZfKSsmxk7JJFcW wWhm4U1asSqQSoAl5KD5RaSaKC5hzFkpwWWZkhJHeK7Eg1FMS1cRLXMlJBMtpEsxj7sRC2oC5uVV PZctdBC0ZKVxXgwA6yfyQ2HoZn0JxFzJQmeLjehkfQR9lHgr8lp5xxNcJSvlyQDWaXTnDkRxNw7w vIyh/jcwOjiFsV3n4LHlMj77/AvDdBgkYJDAT0ACjwNYH9cArBMEPUcJeI6TeiGGJTqUr0sJrviq lJr3UQRXkQRW8hqlxFz5KEW+jyEQU+4h4JJz8r1yHctRAqwjfI0QUEZXonKu5t5D5HraTXqAJVbm mMQ8h0PfJc/T5HFKYPyRjWtwcN0KHGA5umMzzsdE4cb1qyQsTaFFK0fhocol11MWgZBSuKsvh2Ar l6lrsgoYk5WVRpCksd7cuBGLrVvDsH3bFtyIu07LTgFdePkKZcPly1dhS6Z5m4X2OHX2vMLpVCBu M4KlVMZziWswla5H/QCrUAFYBayrgKAqjy7JHIK2bFqwxIqVT2tWAd2QeXRH3iEB50cVpYiL2o81 dmbwGdsDqyZ2x/pxHRHY+zUE934dG0e0g1vPd2Dc/AU492uH7Qu4c3DeRKy2GIH185gQ2qQfNtqO x+lVjvCZ1hdOozojYCrzGjL34XKzIdyoYIZzYQG4tH81LkVuQk7SWdyqFP4xxqcxxiqbwCeLQDCT wEqJJWMcWToBVi6tdXkKYSiZ7gmQcgigJK9gLuUgLs+i8juM6XqAKqbiKa+6zY0BTJcj8VaSAJr3 CMjKISgV0JnD+DOxMBoA1k/gR8LQxfoSOH6V4Mp8EzotOKqJt2Iwez8fgiu/FE15YoB1RgFY3e1P KiCrv8clDPOLw6glyehJ65aXAWQZVNIggZ+EBB4HsFQLVsxSghm67Y6Jm5DASOKxpEQz/krKCYKn 4/x8VCxSjNOKoZswWqxcvFa7qIBKXo+INYzfx4g1i/ccYmLliMVuBFceymsE3YwS33WSFq81JC+d 0bkNJrRuDsexw7GbwfEnmaonmm7DqDXLcXTtchwmzcN+prSJZH6888eimJ/wMnLJWVUkRJViJSLQ yqPLUJjis8gBlcU8hVmSxqaUbr3MNBJd7sb6dWsQHX2UvFjpCtFoNcky00lwunChHUxnWiCaqXZK mOpFrGJSshV3WgndaQKwalyEQs9QY8VSLFkEVzm0WOUz1iqfQC6fsWJ5tAIpxJsEHnncsSfuw9y0 EgbpM70PLUI3ed2F/VsRaDEeLsO4829UBwQOepcgqxlWDHwX9gx4N2/3OhaP74dtBFgb54zD5vnj sWXhBLiPaQ+Xka2w29UYq+aPg5/JIL5O4MYDuhKdTOBPC1bovPFY42SGzeJSPLSOJK+xqC6mnBhw n50h9BeMD2PAu7g909i/NIKoLMagCcjKJDFrBksOQVUeQVUuXYg5jDPLKbnNYHh+ZgC/7MaU3YIK yOKrgKwcAslsglt5VWgaDADrJ/EbYeiklgSixXI1azM6WkcpOQX7kji0H+OtBvinor9/2lMGWCfQ fdEJUj6cRn/3ixjqF4uRQYkK8PLacglffGGwZBmU0yCBZ1kCTQVY0aF+iCSDu8ZNyJ2DjKk6IS5C giEpJwmu5NxRBrRHERidCKWrTyxbwVJ4XsAUXYBHaAWLEguXUug+lPPMyydpY/Z5LuT33HHIgPnI ALoGPW1xkLsSI3lu9dwZsB/Sl6Sc4xFmb80YLXe6In0YKM/C3YZHGAwfyXQuB5aH4MCalYgkgemZ g/uQcOYU8pg+p4yEmuUF+WRaJ8s6AUQOebTEWlOi0DmUMOfhaYQEB2Hz5g2IpQUsjzvrykgDkUZw FRgYjIncrbiege+5dOUVKIzkAhbo6iJYyCTdQwrBlQSIKzFYOgBLXG7ZBFgFNQArh3kJsxnblUVX WRYDy/MYG1aYzzil3NsozCEoIUC5f/su7pUX41L4Dmz2mIs1BFAhE3vCp8/b8O/9Jqzb/gNzu7TA StNR2Gk3AzvsprFMwU6HyVhpMQDe49thmZkR80ZOwZpF05nOyBHpURtJOOoLNxKamhu1UIppr2ZY MKEXdq1bTEvWZVQyFVB+Bnc1cmwlxYy7ymR8Ga1+qexnNgPTJYdhFjm9MhkEn1PG/tJiVcCSx52U uSzymk9KC4lNK6LLsJAWObFu5QhbvuxKFJBFwJbLz2lMf2SwYD3Lvw6GvtWTQPTlLHSk5arjgiiF t6oPdwr2Y7zVgIA0AiwBVwRZT9WCdQLd7I4rpZfjKfR3u0CQdQ0jAxOY2/AEPDdfxD8/+9wwSwYJ GCTwjEqgqQBLicESCxZB0XFan04KPQNLDAHVcRb1c7RYnQiOThB0naB1KjpICoHUYrr9CM7ECqaW KOYyPMIA90Pewq01Hwc8bXDYx447D2342ZrJpedjh5MVNljPwIpZk7CGZKa7XeQ7e+xyXahhlvd2 wh4vR+xhipaDZBeXJNSHVxBkLSNVwerlOE4qgatHI5B++QIKkhNRxvisMlqvSgi4KgiuymmlElLS sA3rsXolLWFHI8kgn8ak0txBR76t0NBlGD9+IkKXLldIM/O4Ky5bAtaFmV2xxpQSNJSR6oA7E1kE XOkDWBoLFi1XdDtmSTA7XYUZBGuSjy9XABYpEsoK7pC24Q5dkgQntPjcv3uHCaNzkHzuCKI3kPbA aiJcB7TF4kEd4D6gPWyZMidgYn/GX03Efldz7HGajt2Ok7HLYTw2Ww/FFluCLy9LHF7mgviI9SiL jURc5HosIxXEjN5vYXL7FzDqzV9j6Nv/B7uZIxG+bSUKmf6nMo80GLJjkP3IomUtOaNQ2SCQRytV Hvm+FMsVwVY+AVY+aSvySmi1Kqb1quQuCgiwCmnVklQ4BbJTkpYvKULLICSmWbSMyZilpGbmGADW M/q7YOiWjgRirmajk4VYro7SJchgdrKy96MrcEBAhqb8QABLLFgKyLKNITP8CfRzP4+hvlcxcnE8 rVsx8Nh83hCTZdBWgwSeUQk8DmCpMVgnlzEGi2BI4rBiaH06KaBKwBU5rrRLDHcGHheARaAVzUD3 KFqaBJhFMYfhEV9XRDBoPYIM4FLC5ZW7CCN97XDIawEOei7AAY8F2Oc2D/tZ9rjMZS49U6yaNQFr rKZgB+kIDnjZEXjZYK/bAuwiL9eGBeZYb2NBILYAW+znYRvzI+7ydsUOL1dsl5Q8JC/dR4qHKOYJ vBh5EKmXzqIghSzm3C13s4hxT2Qqj9zHZNDLlyH8wD4k3oij5aqYyZ6LuJNwHcHVJPj5ByAxKVlh I8+mNSqH1p0cAq1k0g+kMa5LLFipsjOR9Ax1AIvgie5BTWEgO+/LIxgT7iuJP5IYpkwBaeI6E/Z0 UjcUkMKhtLCK7dBSREtPCXfnFXGHYz5Z1zOunsSxtcwFOHsKVkwZjoAx/eAzrh8WTx5IkGWEbbZT sc9lBl/HEmCNQ5TPdJwOnYNT6z1xlrQN1w6vR9Kp3Ug4uRMHVrth/siOMO32D9j0ehnW/d6C1Zie 8CDVw+Uje5Vk1FVM+VNEsJjLPgmtRY7EYAkbveLeY79omSoiwCooYY5BArFc9ju/6BY/E3QRiBWU C+BiYDytcTncVJAj8WoKeanEb1GOHLcBYD2jPwqGbukEtAu4Mt+MDgRXwsyu7BSkpWrA4kyCKyk/ DsDqZhvN3IYEWa5nMdTnCkYsjiPwOga3jecMIMugtAYJPIMSaBrAIk2DACwCpKO+tGKRRuE4Wbtj CI6OE1DF8P1R8l4dY5HPJxk/FUOKhqN0Kcr1SiHAiuL9R3xcEMmA9UhyXx2m1SmC6VWO+Noj0mch i21NseM5WrJoxdpuZ076AVOCrTk47Mf0O4tJcuq7COF+9tjrbk2r1jS6z8ge78jULHaW2MKceDvJ o7WLfFp7vN2wi4SmW/29EEb28R3LgnCAxKUx+3ch4eIlZCel4Fx0DMLWrMNOpoK5euECihgUX0AX 3hYGu0+dOhUuLu6kbkgmXxRBBK1QOWK9omsvkzFdacIMz/Q66cKTJYSl2gCL1wm4yiCwklgj4YHK Y8B4bp6AFFqGyDUlsUxZDBTPZuB3HkGbkKIWiWuOYKSErrji6pt0xYm1K5McX5koT7iC69s2YOt8 Jlce2A2LJw3ESrPRcBnSAWtnj8R+AqwtNqOw22kcTi0xx8VV1ri6YwlOhC1B+Hp/nDm8EYkXDuH0 gVXwtRyO+f3eRMDI9+DPAPrp/d6D2cieOLQhFCUp8aggKCyiuzOXrk8hYxWQpIkXI8UCwVERg9eL GLRexPPFtGaVlN1iLNttnmNuR74WVNBdyFcZZxbBVyZfNWSrsoPzpgK4UhkbZ3ARPoM/CoYu1Ung +LUcdLQIo1vwWA24uqG4AlVw1d8/g7FX6RjAc/18UxSr1tMIcu/BuKuuBFTdFRdhDIFUNLrZHEXX hVHoYReNfi6nFZA1MiCO10TDfZPBkmXQW4MEnjUJNA1g3cSZ5YGIFhchAUs0AVY0uamOKQDLlWCK sVlkdj/iuQhiwTpBgBXN75TryF8VTVdgXXEnQNOAtCgCsHBPe7q35vHVhhYvgjI/B4R7CdiqAVkE UftpyTpA69Yeb1q3vBeSsJTtsYT7OyixWhH+TozhIujiq8R4RQhnFl2S4XRPHmIM2P5gpuFZ7IUN Pq5YK8mK+f2+jRtw4uAhhPr4wHmBNcJJXJqblsYg7yzmMtyNyRPHY97cOYgjO3wpd84VMGZKwJXs QJTUOskZzOEn1hyCpEwCB+HWEoLRDDXQnYAqs6ZkiQVLAFYurTm5VbRykTWd96TT8pVRs5OwgNas Iga+lzG+S/IUFjAIPJ8WrGxSIWQxdqykKA/3SS1RnXgD5zauw+Lp4+Exrj/8pwyB84huWD93HA65 z8ROe+6utB+DSI/xOBE0Exe2+OPQKk/sXeGOc7RiXY3ZhujtgQjzNIf/1O7wGNQM1t1fwsj2L8J6 0gBEb1uB/LiLKKIsijjOPHJVyY5CoaKQQPUSySdIcFRAS1Q+ZSHB8CV0BZYTEJbSmlVIACWWrjxJ LUTwJemBhLU+h+c0YEtzLl1chKTAMACsZ+0XwdCfWgnEXM1Bp1lh6KCAq2voI6Shwm9Vs0uwL3mu +niRqd0zgalwmG+QMVn9fQjAnnAXYXeCK2FzN6KlqsO8Q6SCiFDyG3aedxgd5x5kOcD3B9DTLgqD PM5hRECsYsnyoCXLEPhuUGCDBJ4dCTQVYJ1gwHoU452O0MUXRQLQaAKr43QBnqC7UF6P0Yp1hNao KB9HAitatUgwKudjGHcVQ+Z3uV7eyznNec05uf4QXX6H3W1o1aKFikApgsHtEZIsmp/Dmf4lnIzw +/n9bgbB7+G5fQx838frDhCMHWFAfMwyoYEg3UOIEJ2S7kEC3hmUf4ixX/sICvfSTbmHrzsJ6OR1 P0HXLlqzlro6wnL8aHgvIJA6dQzZJPk8QFeiw5xZCPFyQ9zlSwrYyZc4KVqpsv8/e28BJseRpH/v MfzvvmPeu9tbXntNMsmSLZlhzcyymJmZmZkZR8PMIGbWiMmSJcuSmda88b2/7Emp3R5N99gagV31 PPF0V1VWVlZkduXbEZFvOBLRgy6gHZbzraSTkesM8tJSpZrZpRWAO5UeZ5sY3LeL+X2Xgrj3yoK1 VxYs0vsQu7VTQAUiT2Sn4+YKARcSILPa7gACZxSpZdynBIuRANhhfR7lmIBPbtxiG9yykbV67F7r 8tzvbFzrF2xBj7o2v/OzNr/dw5bc5WHLHvCcpY3vIBepgOiEzrZy8XBbvXiEFc/sYwWTutisDk/K +vUra1jzx9b04etsfLd6ti1vob21f4Md37PFDoi+Yi98X2rzTpGOlioOa7diqYinInn1Xn3u0+d+ uQIPeJG7cB/n5U7dLd2FaBzkBiXI3cVg6fmxAAqcblKKogBgXTrvgqAlYRpId+BqhlVrnWG3dV9l t3ZfI1krWS3RfreVTmp2XWE1uixXcuYSu7Pncru773kAWKJouE+0DHWmHbK7uhfYVfXm2nWNFtl1 DRfatQ3n27UN5tm19efYNfVnW7WG8+yWVgl2Z9dcu6lVigt8//2nnwd9GWgg0MAloIFYAVamAtaT RfgJuEqV9SrDg6szAEtWJZ0DZKU5gNXtDPjKPAOwFLP1NYCFC5FrBABIqdO7veroIHdjCKjx3YmO xysH4iKVWSgr2TwBrkU6tlQWqzi5IpEkrURMGqKVhQJYiaKUSFJQPgLIWqx7xukzWcezxw21rIkj bFzXdvbsHTWs+VOPWNrMybalINMSpk+09g1ettF9utvutcvtzaOy1ggQ7FKcFS6+HUoSvVNgizQy 2+X2AlxtVpqcrQJWpQCQXYovEh9WKVxbxFwpiH2vgsVLlbJnu2K9dsAvJRcgtA0IQfLEZIUDrH0O ZB118V4ArYMCKMgBAZT9Aii45I4cPanVfvstfvI46/DS09ZLcVn96j1qw0QyOqfTswKpL1hW32cs d/ALljyqmaVP62o507WYYGgTJdmub/mTOlvOuPaibHjahte900Y3f9Cm9a4rmotOtippsu1fm2Un 922xk0fEYq9E0DsFhPaJoHXfIa0glPVqlwNQx20fqwRZMcj3MoB1UCsPAYp7ISVF9AwhgBVyhYZW TiIBwLoEfv5BEyI1wAsxoWSXXfnSZPtlvTi7plWWXdMiw65pHpJrm6eVSapd0wxJsRvF5H5Xt1y7 Ty67u86HBUsA654+q6zhnBPWOe0jq90uyX7+1Bj7xTPj7edPj5OM1f5oySj72RMj7P8eG+o+r3hx iv30mYnWekSyvfvB74PODTQQaOAiayBWgJUlclEHrASWAFeZZcCK7+k6BqhKLRO+h1u4vJUr3OJF PbgJidNKE0BC0sWDlaGg+XDhWLrOJUuWCHR5kJWgcuRDXCygNbdrS/eZpP1kyEnlzkQS1eYkJZcG WKXIqpU+erDlTBhuM7u3t5fvrGnP317DJvXU/WdMsjhxaU1TQHy/Ns1tnvi0ti8rsMPiwtovy9M+ RKly9riVgCGLEysHd7qEyLgGZbUSqNoqwtGtADFciQIRSKlitbbLFbZNAl1DCGDpeBkfFAAL6xUJ kEPg6pjL2YeQWuYgIEvgilWFB7FkqTyA63UliV6blW5TB/a2UYo/613/cRGxPmKzO79gCX1elj5f kB5f0PPXt6wpbS13qmLS+tcRZcPDNq3z0za167M2o/sLNqfny5YwUqzu8wZY8sRuNqVvU5s3uodt Kkp1+REP790jkLVfsWmKv8IKBWAS+Nurdu5zHFdnBRb3g25fqwaRb4ArxXNpcUAAsC7yjz64/bk1 cOL0+9aq3zR7ovkge0ryRJN+9njjvmHSR99D8mSTPvbAKz2s2rMD7d5uWXZvnxXnFWDVn3nM+peY 1Zu61+56ubc9UqedPfJKxzLpYA+/IqnT3slDL7ezh19ub4/X72JPNtLy7txi++qrr4KuDjQQaOAi aiBWgJUjkEJsVa4ADJIlLiwEoOVBFkArXBywKkfOgDJWJRIgL0tUWplkaPWhl3TFV/njSX3lSpQ1 a2m/jgp2l3VrsALm4c+Su3Bhj9aKv5LlTLQRiWpTqpJDpysoP1ExWAmyXCWKLytjtGLIxEY/qU1j a3RHdXu2RjUb3b6lZctqtVjuwimKz5o1uJ/NEc3DjCH9LV6EpSvSU2zziuXih9og/qyddlArDwFa pTtKlfx5p7NIkS6HVYHbBZy2EdCueKttAmLb9blFLsLNpcRqKQbroNyBAlU+fQ5km0gkwDoo4HJY efsOl4GsQwIqBL07S1YZwAJsvar8iDvXrJarcKHFTRphs4d0swWD5Trt30xWvjpabSlw1fcFseG/ IqApEDW0jqxZjZSC5xWb3PkJm9P/FUsY20agqpOtWDLM1iWNsel9G1i3evdb14aP2SRxj63JTROQ E9nqYVnPylZPlsIB5qxTAoRqI9YqL4BD2g9jO+CqPIC1Q3pCQhasgAfrIv70g1uXZ7368KOPRYwn AjwtNV4hbpeSonwrLswrV1YU51l8Yord3XS83dUpvUoAVp8CkyXruA2ZlmIri3Nde85KQdl3Pgts eUmRrVMKij3ioTkljpcvv/wy6ORAA4EGLqIGYgVYBLlni/8qX263PIGtHIGsbICWXIfwYn1NyCco 8QAsEmSFA6wUAaykvoqlIp5KwAkOLS8pBK0DpnQ+QTFXSyEdFZBKlCQPVMyXJIFzujZNgCtzuMCV ch+6nIYuX6LIUcXblSpLVr7cggt6drCGtW6wJ6/+hY1s0dDSx4+0zIljxAQ/wuJGDrJ5Q/rZPAXE z5Ila9agfrZo3AhLmj3N8hPitPou33ZvXGcHFZd0QO+vvVoBt1f5Dkl/s0dpb5xlhtyCCobfIdcg QGuTeJ42Yr0S39YukZaSGudbASxZt74GsATojsjttmPDJqUGSrf0hXPkLhypRNhjLG/WYIsb1Fzu v2dtZkfRNQx+ydKGv6TE20+LiLWeqB4U0D+6meXN0Z/c6Yqdm9HTtufNEMgabn0a3WdtnrnNWj17 lzV9+j6bKHC8c+0KO6qUQ68KXJIyCIC167wBrIAH6yL+9INblwewvvj8c/vwww/tzTfftDfeeCMk J0+WK6dPnbS1m7bbA62m2Z0d06oMYNWfdcymJqy00ydfU3vUlnNKqL3vvPOOffLJJ4EFKxjigQYu sgaiAqwPSfYsmga51zIEpLBk5QpkITkjFdOk3IIEwONC9JIJ8GJf5b2lqzxrV1qZBStZlimoGgBS WLPOSBm4Su4DjUN7cWa1l/tLSYx7KQie8ioLOONYygCBs0Hi4CJP4jC5BGW1Sh2ifInD1daxQy1e ge6dHrzbXrz+ShtS91kFww+wjLHDLFGAKhmX4hiVkfUqTrJo6ECbN7CfzRrQ26ZpNeKcEQMtQTkP 8+MX2sbCHNu7aZ29umuH4qB2y5K0W7FRitES2NouyxbuwB2ycjkaB31uUpD4Zn1uE8moC2oPk0gL lkst4y1YsmI5VyEWLACWt14JXO0XnxaB9zt27Lb1a9baopkzrKcC3lNFFFoqGoa8mQNsevc6NqTh 3Ta17f0Cmc9b6sgGljyykSWObGyJY1ta7hyRxc5W2qNZvW1DxkRbnzTaJnR5wdo8XdMaPnyzPX/P jdbkmQds7tjhtkc5Gt/Yt0dtEJA8BMBSUD4rK5XQmQTOXg7oO7FjsVmwxCOmlZhBkPtFfgEEt/+6 BnghYvn54osvosofvvxC/5oO24NtplcpwKo386jNSd9gX372cdQ20W7aH7gHg5EdaODiayAqwHLJ ngFYcrHJMpSpFXjZcsGdAVmKbcrGfahYp7Mgq58rA8DKhpSU1Dq4FHEnlgW8E6NFrBarD1Pl/kvF ekUclmKrzojirzgG8MJVmCpahnjROThaB1E5pAlUQeewRIzvS0VQmqR0O7DFZ48cIvAnQCjwlDVc YKlzW+vwwJ32zJW/sB7KY8jxVEnSYBJOK4eirFfpowZbgixYGeOGW6pisBbJgrVQKXiWCEjOF4Cc LYvcfLkdE6YCtBbYxoJs271uhR3ctsEOi/n8IImh5Q4s3aEchwJVO3bvEbWBQJbciJtlydokdyEr B3cRJF8Wf+Vy8pWtICQG64Bimsjd51yEZQDrYJn1Crcg8Vf7SQztXI1cS7njIkiNsyd+d4/1bd/E thcn2t5lSy1nZj8b1foJ6/38zTam+T0K9K9rCcMaW/zwpsrbKHA6uZMVLBxgKxJH2fq0cba/eLat WDTUeta/z1648wp7XkzxL9x7iw3u2Nx2LsuzN3Zvl8Wu1EoFrkIuwooBFoHtXs4GuJNAmlRCsvJB 1Bq4CC/+CyBowXfRwB/kBz/qANYdVWjBAmDNz9psQljfpbHBtYEGAg1cYA1EBVhlFqw8WXgyFdOU JUCSJXCSPUwWLIEXLxzLECBBMhXDxPksuenKA1ghYMUKQsBVCES5YHZJpmKwvBDszjEfBJ8mV2CS rFdxAlSJomxIlRUrvocAV+emonpoLkqHVrakOySkAnTDB1meGNwXdutgLRTM/sQvf2Id7r/LZrcX HUS/HnItatWh+LkyZZ3KlSUrXc8SJ46vOPFlJQxl9aFoHgQmk8cOsuRxg2ypEk7HjRVR6dghFjdh pKXMmmQZ86db3tL5tnXlMjsiQHVEVqojWt13EM4suQh3aPXhNskWrcLbLEJSAJa3YBF75VcQAq5c HFM4wJL1CmsQQe6Aq/1nwBWEpCIA1QrGnUqvs0+s6WvWbLBWTRvb/XJ/zh7d206VltjB1YmWObW3 DW/6oA1v/Dsx29e12T1fEfFqQ8sURUOiVhFmTu9hy+OG2eqEkbY7f7pty5hkE7u+ZPXuu9ZeFMBq LfqHGUrevbUgw45vW69AdwFIWalCLsIoAKucAHcff4ULNQBYF/iHHtyuKjQQAKyq0GpQZ6CB74sG YgJYJ1+3fMUrZcv1liNAkqnPTICW3GzZ2uczQ+64tEGKe5KkyxLkyhCHNUgWpQgLFqAKSgdP+VAh wFJMFiALCodk5SwEZAGsAFqJAlRLu7UQh1ZLB7gAWEsVZ7W4u1jilSpnkcBV7ycetud/+yvr/Lu7 dVxWsIGicejbXSl7ZEFTWzMFBNNlfUtR+5PLJFGfSQKMjuJBgfQJ4tlKGiMm+4lyKU5QnsMxQ5RQ eqgtGDPIFowbZqnzZtuyjEzbumqV7Vci6YOyXO3ZqWB4WWh2CFht18pCGN3DXYTfBmDtk/Vqr6w/ AKxdsl5tP3BSQEWUCAJgmemp9rs7brEWdR6z/euy7P1Da+zYhnTLnyEQPKmvrY8bZzlT+9hUcWVN 6fayLRnR0rKmqW+mKeWRgNaGpFG2PXOSnrGrDWouEtO6D9tEMemnzxhjK5IWWGlxjvi3tlvpEVmm JHsVU7ZPn/tFhBoSAUHJQVm4cBHuPgfAwnqFELMWWLC+L2+RH+xzBADrB9v1wYMHGohBA7ECrEIF gwOusuVOy3KgKgSsHEAR2EoTKEkdJIoEWbBCAEsWLgGXXMVC5cjylS33YhZ5DGU1ylA8FKzw6WJ0 5zNTqxOdyH2I9YrViqTbyYKyQe7DNIGrVJGPJglIJQlEZQhgpRHwrmPJIh5NET9WgohIE7SacKkS QWOhmqWUOe3vq21Nal5vfZ58yOZ21HVqC8AwRUzuSbpXiqwzKQJ/SQKByfqeJg6tdLkDk+XaTFJ7 CZZfqvMJiilLVLyZ49aSqzRZXFpJ4xRMPmqAxY0eKHqH3jZRz71g0mhLWTDTlmWl2s4NawS0ttuh 3TsVFL9NRKPbrFSga6foHHbLTbhnn0CIaA92lTGf71a6mT3K33fg6BtKk0PqGSV8lhXLgRVWKvoV h1izxEO1S7xUuwSw+GSfNDutmjaze26tYXPVV28eEvP7gV22tTDdliXNtd0rMuzQuhzlZBxswzq8 aJN7N7SMaeoTBbkvHdVKcWitLHeyLFsjlUx7cDNLGdPF8mYMkRVsqM2RtXHegF5WmBpvW3ZtlVdk r1yZYp4XoNoLqzvWN7kqEVYXOu6rAGDF8OsLilzmGggDWB2qLsg9cBFe5sMkaP4PVgMxA6wJo+UO HCSQdVayhg0UaOkvSxDWKwErSQbgSi42AFieQFae9rMFvLLkessUsPm6hI458KX4LABYloBPtpOu lq24qwzAldjcUwWsUnELln2mCFylKSdhmuKzknq0lRWrtSUKaC0VIenMdk2t68N3W53rr7DeT/1O lAVaeSjOraXkPVTdiYr/Slai6hR4s/QZ+q58iSIqRVI4JqCXJNCVKDdhggROrXgBtEStTEwbM9hS JcmifUiRFWuWANo4cXRN1jNMH9HXFk4abinzp1he8gJbJ4CzZ9MysaJvEMWDaB3EAr+bHH9KqwOv 1B6SJStp8m6Rh+4SuNrrQJaY0V8VuDoi4CSXnOOUckIamlDi5O0iNYVdfZfyGx4Q8elBHV8wd7Hd U/tea9mgmR0SkDt99HXbtWmzzZw0xhIXzLBTB3faoS3LLV2rDSf1bSF3p1ywM3rb/CHNbH7fepK6 Nr3rc5YksLUhfpStixsj6113G9LoBetb51k91yhbs65EwfxbxC6/X1QSxwW0lHfwoBI7k19QHFi7 yvivwmkaQgSjZ+OvoLPYoTiywIL1g33tfF8ePABY35eeDJ4j0EBVaCAmgKUg94KxI2WR0oo8ABZA S5INwBoszikPrhQYTvwVwIsYqFx9zxG4ypaF5wzA6h8CWexzPFufWWUAy8VrQWJKmh1yGirwHYCV JitVmlyC6QpiT9dnQpdmzpLlYrC6tbS4zi0cIzwAa2KTOtb2nlut0S3X2sDnHrU4gat0WOgV/B6v ND/xSjbN91SBpxCg4lPWK31Pc5/aF/BCktSepbK4xUkcpxZAS5IiYAXASpX1CrAVL5A1X9asxeOU VFl0CYtk4ZqiZ5okiZs2xopTFtkmUdjsU7C7I+yUy3AXef6wZJFzUEBlr1jR974aEgeuZB3aI0oE Yp32Y82SVQveqVJdv0WM8pu2KYB+BzFdKqPcfvu0snD75p3Wulkbe+i+hyxpUbydVPkjAjLDBw62 bu3aWElmip0+sFMB6+utYNFEm9avhRjt69gExV3N6PWKTezyrI3r+LQsWq1tmQLe82cPtPmDO9rY Do1tUpfWlrl4jm3cvNYBrH2KNTuith45dsoxvJcq3+BOWdd2O0Cotuu5PA9WALCq4pcb1HkJaCAA WJdAJwRNCDRwyWogVoCVN2a4gtb7nQlqB1xlyVKVoWDwMwBL3z3AciDMWa9wD54FWBkKJPcAK0er +JDyAFaGVhdmiL4hXfxXSIZcgliwEro0t2S5CtMFrhLlElzcsZnFd5WLS0BsWrNXrI1IRBtVv8aG vfSkaBzkZhyq+CmxxSdDCSHwxrE0Aac0XIICVekiJw3J18EVACtZ5eIFxuJ0TRKpdmTFSlTgfpJc hqkCVEja6AGy8gywRToXR4oexWTFixZiodyo8zmu74slSWKLX1dYbLu27LA9oicgEP4wCZ4l+w+I doEcgwS2y3p1SEmeiWvaK7b2PTq3TyvySP7MikNWIe6QBWzrDlmBZA3bJxfjLq0oJPchdA4JS5Ls sQcfswYv1bUdG7fZa0fesKWLU63RKw2tR9v2dlD8iZ++ccRe37HakiYPspHt69jYLnVtWJunrW/T 39n47i/ZknGizZgqYDm+qwhMOwiIicB0dH9blZtqu/fuVHuVfFqxVocF+g4KGJImh7yDoRWGApCQ jJ7JQehT5IQsWCEy1sCCdcm+EIKGVUYDAcCqjLaCsoEGfmgaiAqwymgacrUiL1PWqBwC21khqCDw TGgNWDmo407cCkKBsLIVhtmy9mSx8lCghM9MkX6myxqEZIhfimPZcruFAyxchICrNJJGnwFXIStW YtcWAletLEcs4xkKdo/r3NyBq6WSsXWftk731LSOd9ew8fWfF62D8u8JXCUrmH5Jtza2tLtitcpy KKaT3kduwAy5BTMFrBC+pw0ChGl1Y5lgzSJGK5Fk1gJVGYrDShaRaaLAV8qw3pYyXJYxSZzKLJZ7 M17PmQDQwtIl3rBUkZvGKyB+gfaXSH8pc2ZZfnKKbSheZgdF53Di0GE7fuRVOyY5fOiQgMtBFyR+ +MhRgRcxurug8VDi5z3EYAlc7dVqQsAWMVmlCnZnfze0DQJcrDY8Ijfi4P5D7b4777P4RQl29NW3 7Mjht61Xj0FW9/k6tqaw0I4rNuy9w7vttW0rbWPmYstfMF7Jr7valAFaLDBdHGKyXM0Z08lmjeps 04d3stG9Wtp46Ts7ebHA3A7lSDyo9sJ5RYyYUvoceV1uTVmx9AxblVqndL8scxExWJ6e4SzAOhDw YP3QXjbfv+cNANb3r0+DJwo0cP40EDPAEk8Ubr1cBa7nQNMgIIVFKxNQFSYcy8WVCMgSsADkZCME mJcBrDQFuafJMuRAFtYt4q9wD/J5BmCJ+0qgKl2SIZJRgtyxXiGpcgWmkhha8VZxnVvZmJefsra1 b7K2t99kExuSg6+brGe9HBVEkhJUL+kClUPLEOjScYBWKpQQAlVZsmIhfE8HWIURnWbKypUhQJUm QJU5QuBSVA2pAmNJAmIpgK8hPd0nAfG4EEMpepTTT59pAlhZE0XnIOtVglyKyWKFnz9mhC2eNNEy F85XGhrxaG1Yb4d27rDjSkfz2uEDdvSgaB4OHRBwOSRwJbAE0GJ1nqxYe3YfdAmkdysvIN/3ENNU KgJTWcP2wKslq9ZOrVg8pliunOxCe/nFetaoQXNbu7bU3n3nK4tblGZtm7e3yaPHabXjSnt9T6m9 c2SfvXVghx3ZssJK1+TZ1uXpYm7PVpD+PFs0baDNHt/bpo7qYaMHdrQxInHNSo2TO3K3axupfA4e VAJoJZ8muP3AseNiq1dORpGv7hRjfaQFKxxgwQ3GSsJN20sDotHz91MOarrwGggA1oXXeXDHQAOX jwZiA1gnjFQ5mbI8ZcNtpRWD2Yq98pKl2CvE7+cMEbiS5AqI5alsrsS5AgXQcBGm95MFSZJRFo/l k0D7IHfir9K1ehALVij+SkBL31N7yorVRVYWWawok9SjnQNXne6uab0eutumNKmrmKw2Al6iclBA u7eEYeVKlAWL1Yk5AnHpitdKI75rQCetWoR7iyTT5D0kLQ+M8hK5JDM4hxtR1q5sAavs4YAtWboA Y8N6KvchLkbVR4yXwGK8AukTZO1ailtRkiBgSaxWhqgdMgS2ErW6L3HKRK3km2TZC2bb8rQkW5ef pRQ8a5SKZoe98ep+O3nssB2Wheig0tIcPnhIeQjlRlSQ+F6513aTRJr4LXFr7SWRtAhNt23d4Y6X Ki5r29Zd+n5Q547YmDFT7N57HxawSrF3T39kB3a/aqOGjrGWjVvYlnXr7ajS9xxSyp8Th8XbtXOr HS7V/fX9jVf3atXjetuxSWnNVojmISvOCvMSbXlRum3fst5eFeBzwE8B7YcUoH/goOLH5B7cLWvc riNqIyLXZjjJaGSAewhgYcEKchFePm+KoKXlaCAAWMGwCDQQaODcGogVYOVjwSI4XVYoVgXmDhaI ckIgu8CWxH13EjoXDrCIw3IrCAFVxGFJQgBL3wlsd8HtIQsW4ClD5KMuwN0BK1E0dFOclVYKZgg4 pWjV4IK2jW3I0w9Zq5rVrOu9tW2WUsUk9xIwg19L5xO7tXafyd0FuHoC1ASa3KdcXQqizyA5NHQP YZKqVYkpCqSHYyupjMjUJZ4WXUSWrFaZkgxJlkBVlvIepmP5GibgpZWD6XIZQveAVYt4rcWK+5pP UL3AV6qC4FlxmCBC09TJY5RgWXQOYoRPnzPN0udOVxB8nK0vzLIda0rEo7VZbO375e47KHAFyAJw HVaaGoDWWdmv/Id7lAexVOzxO8USv3VbqW0W2CLX4dHX3rSc/BXWtGlbG9h7oG1csdref/Mdy0hO s2aNmtiiBYts69btsoCJOHSPuLpkSdq9dY8Y6Q/afhGmHty3y06eVJzWiQNaLbhN7kqlBDqKC3Kv WOQPOCb5/XJHArAOiegUgFUq92bpYbHZH93vwFYAsIK3zg9AAwHA+gF0cvCIgQa+tQZiBVgFsmA5 8KNYI8BSngLcc7FSCVAhZ8FVCGwhucRjyXJ1BlyV0TRgyTorAlkCV7j14MfiHlkAoLAgd4Lb4zo2 lXuwhagbutji9k2t94N3WtObrrIu995mUxq9ojisdgp6hzMLYKYgbQGrBLkGE8osXkllgCtdAC1L daeXEZYCqMIlWfsQmMaLwBSghWXLi7N6yaqVA6iSpMttliErVqbisDJHKR5tpLjAhskF6WKz+ooJ vrfyG4q0VIHwS5WzcbHcq0sFVJeISyyOPIhTxlrc5NGWNneaZS6aZRmLZ1lBRpKtWb1a1qjtAlT7 7ajis47KYnSIYHhZqvbLQnVQFqr9smDtlxVqtwDRtm07xBova5Zkl1YT7pNVacvOQzZ73lJ78fEn bN7EcfaB8tIeKN1pUyZMtLbtOlhWfpHtPXrC1umaTTvkYtwu6odN+23LplIBtl0ukP3w0QMSEZse 2q0Ae9W9a5csaHtcLsSDcg1CD4GLEIC1FwJSwNXRPbJgKV6MgHy1OXIFIdarwIL1rX+uwYWXlgYC gHVp9UfQmkADl5YGYgVYecrDl8mqPJdbUBYs3IBnrFUALMCUF1yCIdcg1i4sV94tCLDyoCtroOKv sIrBeyXrD8AqVeAIYlGsTLlYjBR/BUUDbkJA0vzWDWzoUw9au1o3Wu+H7nSWrAxZixK7CWB1l5WK YHZZutLkTkwRfxaWr/hOSq3TVczlcjtmk3pHdaUKSCHJAm/JAlTuU5IigQIiUQArmXyHsnCl91Mb JKlyG6b1by8dhNyKsMqnKT4pWa7GJIGtRB1bQkJquRTTBbjStPIuZWQ/rTbUJyBLHFpLtdLQCXkN lXZnKaSlk0Za/MThljBphKXNE9hKXGpFmZm2tqTYtm8Qf5YC4g8oYfReAZ89iEBOqT53yYK1a4+Y 4pVkercA1y5S6Ow5LDJTuRT3n7RVq7ZYwxfrWL8unW3nxo329smTVqKVjA0aNrKJU6bbdl2zUXVt 2gE/12sCdbJCaUUi9WzdtlOrFHWvA/sFiHaJd0u0Eor7ImXPYa0aPHz4hACeeLkE9vaKouGAOLv2 v6rvR8TzJbfmrn1HXB7cnQrGR+C9wi3og9y36fvGbUGy50vrbRC0ppIaCABWJRUWFA808IPSQKwA Kxf2drn1HGiCfkEWrGyBLBd3Bd+Vs1aFYq1yoV8ocwlmlFmtUklNo7grzueRYFnH05SyJr0vhKKd rRC3m9yCSeK1wiWYI8tRvmKdEAhHsWBNeOUp6/vQHdbjvltt5LMP2aJ2jQWaOjmLlHMHCoClKulz qlK8pIjKwQvkpGkCThnEckFQWkZYGn7eEZh60XnKpCixdJIEoJWiND2pSixdnpBwOkHuxfi+IjwV wEolCF7iSEzh1FIgfIaAVrKAViKf4s9KFuDiO5IgK1ecgulTCKLXysO4iWMtfupEWbZmWkFigugd CkUYulFxVKJIUD7APYqd2l5aattcQmnS8OyVa1DpZ3YSi6Xg920CWjvEpr7ziC2cH2f1RNEwafxk e/P0W6Jz2GGDBw6yFs2bW1pqmmKqAGSlqm+PbRXTvKOCkIUKGohtqi8kAk0CU1BC7BUD/T4BKhfc rv39fMqSFfoMldmtMqUOYIkMVXUhO7QCcrusb+GyUTFjkyZNlkyyWbNm2cKFCy0xMdEyMjKsUM+8 SqmHNm/eLDdoqSM2PXr0qFyXJ+3tt9+2999/3z7SCtdPPvnEPvvsM/v888/tyy+/tK+++soY017O 8WN+50c68c4P6pcePGwVaCAAWFWg1KDKQAPfGw1UBmARNwVwIrbKE42yotAJIKsMYOVAIioAldK7 i5M0JVZGCHB3AEwgje/ETKX0UqC5LEu5BJmT9kbcVqGAdrnnZMnK1cq+JSK67PvQ7dbqlmscwJre +EUX6J4ua5eLtyKIXeDKxVuJxiGlu6xPWKDKxAOscGCV1LW5IZyDvNSLA1aAM66lHoGraACLoPhU Z8kSq7wsXclyJcbL8pYk4OhITMWzlaF8hqmyaCXKdQiQSldcVqJS85CKBytXhpJKw6m1RIHxs0Tc On/kEEucOkEga5ZlL1lkK/O06nDLZjuyf4+AVqksTbtsx759zrq0RQSm5DvcARjarmOKp9opkHX0 yCnbtqXUmjVpZS1btLVNGzfbqZOnbUXJcqtbp46NHDbcDh9QLNfu3bZh8zaRl8pqJTfkDoE1uLZ2 7taqQAewZIUSc3zpHtL2wMcllyCuQQAVKwklfp/PXRUArG2qF9muugOA9b15jfxQHyQAWD/Ung+e O9BALBqIFWDlkeRZFqhsufWwYGUIVJHgGYoGVhXmyiqVr2P5ijPKE0jIFW1BmqxWKT3htML1JwuW WNQd0SgB7spDmNZHrjRZsCAU9asF4bla2ol4K7n1FHM1vfHz1ufBWtbx9hus/yN32dwWdWXd6iLL lqgeFLi+VO4/BHDFPml1AFYeQPEdwOStU3z3x8ItWCkCWgjlXHnKyRoWDWClyHqVKBCGFStF4CpJ bsQEJ1iy5FIVvUPmiN6WobisFH0mQvsggJU5dqDAVQ8FwnfUpyx5Al8ZY5TbUUmkUycrNmvsCFs0 apgtGD3cFk4YpfisubZ5RYn4s7baLpGFbtq0wTbv2C7ZYZu3A4xkxZIbbkepXHrbtUpv2z5ZfWRZ kvVo1vQ5om2oa/37DlRcl2K3FEQ/YtgIa9u6jcXHLVUslXirxF2FFWuT3HYbt+AeVDyVgNIuuQB3 Kq3PVsVpbS+VJSsAWLH8rIIyPwwNBADrh9HPwVMGGvh2GogVYOUqZsgFoUMYKitUGomdBbYyJJmy auUIZOUP628Fii8qUEB3vog5M+G70ko6gFVqb7nxZK1iPwNQJUoDt5pQ8VfpxFzJ6pMjIXYqQQSi s5u9bIMeu9s6CVh1u/tmG/fSYxbXoYkDUMRSZQqUhXIU4vIro3LgU5YvD6LCgVQ4wOK8t1hxPBKQ OasWbkJZtojJStUnkiY3YZrits6KjutYYi9Z0HrL8iUXoQuSJxG1ciRCXJoBQ7zcnCmiiEiRJSsF egfRPaQLeKUKdKXpM02fSaToUYB8nmKxcqaOs3gRky5RWqKlAlpxAljxWnWYtWieLRO1Q0lGsuVm p9qKNSsFrHaKcFQrCWWF2rl3n0CWAJb4sDbJ/bZ1m+K2ZCnaIdDUtnUHe+6ZF23FslValfiqrV+7 3tq1aWsD+ve3Y8ewQh0RUCvVdaW2RfQJOxUjhQULtng+d4rmgbQ8u+X2I4ciSZ5domcRjSJ+n08f f1V+DJYsYgJvxGNt1L0CF+G3+90GV10SGggA1iXRDUEjAg1cohqoNMASTUMWlqsyFvcs+K2IuRKR aK4sV3kCVrkCCjmQdApEOUDlwBSrAwlkDwn7ALB0kX5mCmDlyxUIwIpXrNXU+s9Yz3trWNNqv7TO t99oU+o9bQmdmsltp1WB+lwqoJUsVvcMEY7mKG4LoY50ASyAk3cFelDFfqQbkGNeIsHXGctWGcg6 kweRXIhlEgq8F8ACgGG9ErhKkiUrQVavBILkoXqQqzNZQCtF7UuV1S2DlDwQk8p1GC+AyGeWwBWp euIFGondyhmj/IayFsZLlwkjlIpH4CpN/Fkwwc8fOVhuw/GWu3ieZSQssuLiPOUELJVVSnQL4rHa JcoFAt+3CCjhNtwhvqzdSvp8VLkO585aaC8+V8eGDh6hGK59on04JHb3XtahbQdbuXK1wFmIWR1w VoolTG68LbKE+ZQ8exRbtYdE01oZCAWDT+a8V4zuiN/n068e9CsII3mwCHSHaHTj1p0BwLpE3wtB s2LSQACwYlJTUCjQwA9UA7ECrNAqQoEjeLAIdJe1KkvCd8BVthjSQ4zsKiNrTaYARaaY1JFsWany FGtUIJLSPHFE5YiWgWMZpK4Rb1WOwEWGLE9xbRvZyKcfsFY3XWnNr/+V9Xuglk1VCpx4Aao0rQxM lsswqbMSPQtk8T1N7sRMgapsLGACLFlyy2U6ctKvA6pMWZTCJQMrVBnAigRe3kXorF/h8Vlh4AqQ FQ6w0mS9SurZQqzyTZws7ab4LlYjCmQlUlZB+nBopWu1Yar4t2CMRwBfgLAkxXDxPUPHcmXRyhUb fIZS7qRI0keL4HX8CEvRasPFAl5Lxwy19OkTLGnODMtMibe1ywptzbIiW7tymZXu2CbaBoGkrdsU iyXApZWHuxSsflhxUaUCS90697THH33K1qyCMPSYJSUkW4+uPWz48FGyKom8VGl5iOVCNsv6Bbgq ZVXibgLfAU6IrFgukTOgCnAl65XE7/NJGaxXFVuwDgYWrB/oO+d79NgBwPoedWbwKIEGzrsGYgdY 8GCFOLBwE2bIwkIiZZcKR+CKtDKZZcAKuoVsfc/TsTwBrhzt85knAMb3bK36Y+WfS+asuKkMxU8t alnXRj15v3W69VprW/23NvTRu22BkjfHa6VgSmdZqyAZVQB8lkBLpsBYsoBWgoLfkxSvlS6glaUA eSQzLGAd8ASYyhadQo6ADZ9IlgANAujyFq/wVYeRFi/qiBR/XSgoXjkRuzSypZ0bK9he8WBaeZgG aSnxWbggoYXAkqX7JculCMVDnvizoICAb4vjWXBqDRDQlFUrV/pEp+nSWZpAaaZISrPEBp+mRNIk ll4iuofF40fZ0pnTLH7WNFs6a4blJiXYtnWrlUh6i5Vu2SJeKwEsxWbt3CbgtOuwnTh2ypLi06x5 0zY2d/ZCWbH22+vHT9rUSdOsYUNZBNOzBIzEhyVKhW2yfG1W8mgC3HELArB2qI6d+l4KyJIbcLes WcgeMbojfp9PgNi5VhEGQe7n/SccVHjxNBAArIun++DOgQYufQ3EBrBeN5jcs5UOxqW8KQNY2bKw 5MolmCNCzUwFdKfhCiPFjT4BWQ5gYa0SOWiuGNFzBbpCwEpAAr4rsaonCDzNqP+cDXn4Tusmd2C/ +2+zabJaLW3T0IGrxA5NHQDL1GpBgBQgC0khCL5jEwewUuUuTIPeQZ8Ep4dbpcIBFiArV8KnB1zO mlUW2O5jttJlAfMWr/LAFcdCACvkjiSgPrGLgGCP5nq2UOxWumOFlwULdyFlnCtRx3TO823Fd2km i1dTBdPL4ibrG9ekw7tF0D/gk6TXInZNIu2O8h0mC1yReidx1ACLnzDSlk4abwvGjrJFE8ZZ+vx5 is1K02rDXNu+dq1S7yjIXUHrO2W52rF1v+0TSNorjitchc0at7LszDz74L2PrDC/xNooPqtTj962 bvNWO/La686CtVWpd7bLvbh1h1YUlsoapRWEO2XF2gl4Is4KIAXIAlxJ/D6fgLAAYF36v/2ghd9Z AwHA+s4qDCoINPA91kBlAVYuBKJaKZitYPYcBbPniXYAkAXAShEoSCYJsyQVl52AVSas6QJUIZAF p5UsNdpPVdqaOK3+m9boeet7763W5sYrHLiaIwqGhPZNHLBKE/1CFult9Jkil2A6BKICUghgy38H WAG4HNAq47zyLkDAENYqb8UKB1feipVRZskKp2rwVqxzASzckKmyVOFSTOzS1Elaz5Z6NgXGKw7r THA8dZPbEFJTgByuyTIXI6sUcUMmyYoVz/UCZHmDFYclyopMWdoy5TLM0ArDRHF9LRYYjZf+UkXp AJ1Dspjgl5I8WqsM48XUnjxtqsVNmWyLJAUpybZXqwz3b9tuu+Tq26kVhViyjoocNDerwF56vq6N HjlOAfAH7PixN2zRwqXWtIVcsGmZClh/VdYqUT5oNSIB7gAt3IPwYJVqBWEAsL7HL4Pg0SqrgQBg VVZjQflAAz8kDUQFWB9+ZKdff92Kxw4XDQOrA5XAeSjUDKJrUFwVcVc+l2CGrFbpAlCpAgQpSknj PhVjlazvafqeoXgsUuBg4QJwTGvygg149E7FWt3m3INzm7zk3IGpSm+DZMt9mCswlg6BqPYBVAAp JNwt6MEWn4AkOLTg00L4Dq8WjPCZAjqAKb5DXpotS1amXHeZ2ueYF8/HlUosl+KrUrVKEMnoK0ta P1mvZKVKllswsVtTgSPFg8kt6KkgvhbbFeZaxKqVrLpwEaYIhIW+hzi2EgXM4lVfEvdRsHxaP4Ey cWql9SdAnvisUJxWIp86lzpQqzEFahPUH/FabJCsAPgUVhqOG2lLxo+05JkTrThpkW0szLYtq1ba hpVrbMOqtXZQgeWHFMw+deJUe+ap5232rAUi7fzQtms13yjRNrRpKUCbmSOW9qNlqXeUhkdga6cC 4ncgMLMr/goLVrgVy1mtyo4BwDy5qCcYDScZDVyEP6S3y/f+WQOA9b3v4uABAw18Bw3ECrBKxo2w AoGrQgVaO4ClYHUPrsgjGAJZWjmo72n9xXulAPZ0cgwKgGXIxZWuY2kCV6kObAk8CDDMaVPXxr70 iM1s8JyzWmUISGGxAlh5yZErMVfXsJ+JK63MFRgOsLzbkNisdOKdHMAKgSy+A5gAWYj/HgJYkJwK YJUjgK10xVCl95GlrLcAXy8BPH0HXKVqP6m7YsAEsBL1icUqcsXiGctXWUyYA1gAK0mSE7izWGko gEWQPJ8CWAm6j6N8UEqeFIEpyrBCMVX7XEsZ9lMEZhNFkZEia2K68kSy4tDlOpQLkZQ7qTPGWfaC 6Za1dKGtX1Zie8SIvktyQomYN6xeY6+IF6tHtz62ffseO3bkuGUlp1rDOq/YzClTlW9wlxjUtyoO SxQQSo+zXRxbm3Rsm76XBgDrO/zagku/ZxoIANb3rEODxwk0cF41ECvA8hYsAFbBcCVyJsCdYOwy K1a4Jcsnb87SOdyHUDdQLlsxWQS/Z+IC04o64pGWujgquffKLFfEWuUITAG0iL3K0n6+gFmhViXm CghlyyoEkPJB7R5csZ+DFUogKkXnPbDyBKbhn96iFbJqhQBWligiEEAXLjrEWbgEcjJlOcoAbJEu B7egLE58kkrHgStP+RDhnjxjzSqjiSAm6xsCxQMgKkw8EHNASvd3/FplwCyZY2pPqoBsysA+lgJl hgBWumLkEtQviwR85wjQzhHYXTB8gC1U2p08pdvZpLyGa/ILbNOKlfaqkkjHL1hsjeo2tPGjx9vp E6fsoOK1xg4faR1EPpqWkmIHDx627cp3WCpS0q06t00ga5foGXaJxZ0g9/BAdxfYXnaM+KtYLFhY tTYqkD7gwTqvP+egsgurgaoDWPf2XW31Zx6zPgVm9WYetflZm82+/OzCPl5wt0ADgQa+kwZiBVhF ivnBclU4cpCIRAecib0iwB2gBZhyViyXDBowJdFxAFauyrCfJ36sQrGZ5w1ROQEsrFiQhKYLSEG7 kCiglS7LE27BHIK8dTxdACtXLsVCxXgVKCYpDwDkgJbAFMSiistKl6WK/VwBJA+wIq1WAK5wa9Y3 3YeiSSgDXIAsUvTkqI2ALP8ZSuETCmIPuRqxioW4sVzgexnQctxYEXkNcV2WB7DKy23owFQZcSnJ pQFYWK78MfbT4NXSis50LTjIUjxclvolRS7DxQJXs3t2sJlKfD1HbPmzRVY6V7FaiTOmWvqCeZaz NM4ObNtqx5Xbr3ubdtaifkOtPtxgbx9/3VYpEXS9l+rYsMFD7Oirr9qBg6woFKeWpFQM8PBfsUIQ moZwqgaoGfwxKBp8gmef5Nkneg4lew4RjXIsAFjf6acbXHzxNRAGsDqm2b19Vtpdfdba7b3XW+1e 66x2z7VWq8dqySq7rftKu63bcru12zK7tWuJ3dql2Gp2LrKanQqtZscCq9Exz2p0kLTPsertMu2O 7sVWf9Zr1rcwAFgXv5+DFgQa+HYaiAVgnVIMViEAS6sGC2UtKdBqNoLbfYA7IMsBLHiw9Mk+5/gE YAG0iM/KEclmITxPJEBmlR2uO5GFZglMQRoKUSjf87XiEMmGsV3AKUeAh/0Cgaw8AQtPLJoGkzuB 7/p05QTEzuQxLIup8m5BD7C8q5CUPIiP0Qp3HwK0sGYBrJA8USjkilqBGC7AFJ8ALySLYHQoH8ri uzz56JnUO4CtMvFpd3xuQw+4vgayvLWKBNOybgGwAFwQmJKSx1uzEogxY/GAdJujZNHpslyx2jCZ 1YaKj0vAgtW3i80QyJoj1y4kpQvFCp+gJNJZC+fazpUrtPJwvnVp2sQmDR1mJ2WxOin34dRx461t CwXuL11qr72mFYKww8OnJUsWIMsTjYaTjUIuyn4IgJHcWezvZbJjzwGBKXIPwt4OuFISaYLodWzj toDJ/dv9aoOrLhENnAVYd3ZKs7t7rxCIknQVkOoiINW5RAAqBKJqAKIEoG7pkGu3CETd0i7bqrfN suptMq166wy7uXWa3dwqzW5qlWI3tkyy65sl2COD1zuA1WD2a4EF6xLp8aAZgQYqo4FYAVbxOAW5 K8bHW7DyBaDyy1YR4gIETLnJvgxcFYxUMHwZCMvR+QxWEELbQOJjASHoC3AROvccKw75xDIlUJUD F5SAVB4WKz5xD7p9gFc3US1odSI0D2WpcgBp7GcrkJ4UOukQi4bFVbl4qrIYLB/I7oPgsXSFB7ef DYgPuQ09wPIgK2TdEo+ViEPdsTIrlwdb3qrlAR0pdlIARgJZrCJMKhOoGhxdA+dcmZCQegfglYT7 kdQ8AC4Y4pV4OolVh2XnlmrlISALaozMIaK/kHUQVvhMgas0ga0Ugd2l0tMCMeYvloVrvo4tUEB8 nBYrTOol0DV0oK3SasOx3btah7p1bdOy5XZKVqu9Iilt36yF1X/5FaXTWas0Osfs4KFDtotchwJI PlVOeLoc0uOwj3C+VFxa3oqFpercFqxdgYuwMj/WoOylpoE/iADuqD3QerrVbJdm1QWmbmpfYDe1 y7Mb2+bajW1y7IbWWU6uF4i6vlW6VROIqtYy1aq1SLFqzZOtWrNEq9Y0wa5rGm/XNVlq1zaOkyyx qxsutKsaLLDnxpfaKzMEsLK3Bi7CS637g/YEGoiigVgAlltFGBbkXigXIfkGXc5BgBZAqizWiu+F AldF4mpy8VfaB2zly8pSJIoBLFjpAj9YZFKdNehsDBT5CJ0lqSxYPQRwFAsFrxYpcWQFC6d6ILkz AmFppsAVHFuZWL3CYqqog/3wVYKRQe2+THnHfUwWLsOQ2zAErvKVX9CJvucO1nFJ9iBiyyALJYhf zyELFM/IykFntSpLKB3+6a1b4Z/hCaY9oAJgJfYQyBLwSiQJNTFbis9KkCsxXt/TBgtoDeuu4PfO lqhnJtF0OjkOh/W2RSIsnSNr10IRxS6WG3FKj042rZfSF02fZHFKKN2tQT0b0aunla5fb28dPWYz xk+wZx551Ab1GyDurD3OkrWjdKdLBu2TPe9RLNZeMcR7YR/hfKkSTPs4LGKtyltFGMRgBa+m74EG /mD7D79mj7abbtfWmWTX159u19ebatfXRabY9a9Mtmo6Xq3ORLvu5QmS8Xbty+Ps2pckL46xa15A Rofk+ZF2zXPICLv62eF21bPD7LdPD7LfPjPEbmuxyBZkbTL7KojB+h4MmuARfkAaiBVgLdPyf1YR FihwmiD3AgEmD674BGwBrDy44hNwhZWrUGALwLVMefaKBbKyBAJgLwdoAVgKFJNVpCTIfLLvrE1l K/9C1ifinHDbEXguIIMFC9oHgYYsrVbM0QrFbIGvzDNADLAVClovTyIBWEXlwsEZ4C08CB6gVSi3 Z4FY2XOHyrI2RG7QMKCVLoqFEKN7yCrl0+ucyWEY5j70AMtZuuDYIvi9zFrlQVW86CASJACsJVq9 uKiniEr7tJQIdA3QfQSyUgYptk1tyBim5NFqX7wsf4ukl/my8M2VpW92z/Y2V8m2Fyk4fon6M2Pi aBvYspk9ec/dljB7jp08oNyFu/fYlDFjFY/1ks2bNVt5Cw+IukFko86CFQJS5wNgbdIKxkmTJ8uK NclmzZplCxcutMTERMvIyLDCwkJbtWqVVjNuVp7FUtuvmLGjR4/ayZMnRS3xtr3//vv20Ucf2Sef fGKfffaZff755/bll1/aV199ZYxpL+f4Kb/zI5145wf0Ow8etQo0wGA7deq0pWTm2/ips23cpBnl yHQdQzg33cZWKNNs7ESVcTLNxkkoP3XmfNu4ZYd9oUEebIEGAg1cPhqICWCdfN2Wizn86wArZL3C cuWtVsWjBaAkgCkAVvGYQVYydrADWQTC58uaUiDJ0cSfLRCQp1isfLm3iof3tGIFvxcPVxD8UNLr AKLKKBTO8FOFrFQeYAGskFytpsuXO4zPEADDwkQqnrPgihguH6iOGxI3Yih2CncidAwhDixvwQpZ u866GT3tA8AvHJzhwgQYFqr9+bIeIXkALZGFZourKlOWLM/ojuvPAUVWI4al8/ErEM8ALGflElu9 7g8QSxIzPYJ7MUGM8RCSQky6tFcLW9i7uS3o1VTSTJQNAnNDu1jSwA6WqLitVOkgdbCsWfpcoudc rGdepM8FAqVLtBhhgeK1luLyVV7DBUMHWN3HHreGzz1nxenp9slbbzlXYe9u3ezJRx6x+CVL7cRr x+3wEaXF2SvL1T5ZrgS09ol8FNnPJ/uSveQsjNGCFQCsy+c9EbS0HA0AsN55911buX6bpWQVWWJ6 niVl5JcJ3yUcc8fDvvtj7jP3G5KoY0hSWkiy8pfZq8dec/8igi3QQKCBy0cDMQEsuQiXKfdd/lAs WAMFqM7GVznrFZYrgSoPsABWywWsVo4f6qRE5woAY4rPAmQhuApxGRaNlEtxeB/t97Vlo/rbitH9 bfXYQVppqGB58hg6UfC84q8yBZSwfp0Vue0AaYrrQvIAZ7IosUrRf+bKjYc4UFcmOXKfZau+ENO8 gBCWL33PEjhDMgTkiPkqYrWjzqXJeoaQwiYDF2TZNdnEhqkugFXBCAXwjxTYkuTre+5Q1S9rUjpg B1oF0uAQHwaoIyBeAA8BgOFKJBYrWfQPjt2dXIZQQpQRneYOaK/YM1ydWk0oQlJXRt8TRHy6SJas heLjSpCVLFXkpJCS4jZMpE5Z0FIEsJKktxQ9e7KAXxI6kM4XCWgtVSB8rvonZ8poG9y6ud133dXW r2VzW5WWavvFBL9pxTLr362rNajzsqUkxNtrx0/Y/kNYrw7JNXgk9J3Adhd3FUoIvRsaB+2Hx2Cx etBL+CrCTdtF0xBYsC6fl0XQ0m9q4PXT79pzvZZajZZLrHa7JKvdNsFJrTbxVqv1UrutVZxkid3a crFkkdVsudBqtlhgNZvPt5rN5knmWs2mc61GkzmS2Vaj8Uy7pfEMJ9UbTrObJXe0jbOs1fsC9Qca CDRwmWkgVoBVPHakQAxACZoGgSzir8rcfwAqBJC1YvwQWzVhqMX17mTzuraxBZLkfnJV9ensyntX YpESGBeP1nVORF6qBMaUm9WxpT18y40WJ6qBIgE3R/Og1Ys5AlyZxDiVSRauOLnkcuWey5cFqWCk rF+jBN5kBYMOokAADuE7qxezJTmAMO0juV8DcCEQh4SSVHe3Hs89bvddf7XLB5glF2QmYIw0P2Wf /jvs9FnEYQ1TXNYIAa1Raoskb7jqFMjKlNsuQ0DLicBbJqLAeC8+XisFslFZpZJFNJoKU7w+swWs FiqB9L3XX2n3VrvSuj77oOXIUpXSmwB48htqdaGsW0tFvhqvz0SoKATeUmWBS5QVLAGqCIGrdAHM NIGrZAXnz+jUzGpfe6UNa1ZXFq6elqDnSVG/LBDYavfkQ/bkzdfZgBaNbHV6op0+sMcObttsvTu1 t7rPP2PJKYn26klZrw7LZXj8Ndt3RMDqAAzvB20bqwUV5L4dtncFuZfqGCsJw1cQ+pWEfHIuAFiX 2csiaO43NXDk+Cm7v81Mu7Z5il3XtsCua5Nr17XOsWtbZdu1LbPsmhYZTq5unmZXN0u1q5ol21VN k+yqJon228YJknj7bcOldmXDJXZlA0n9RXZF/YV2Rb0F9qs6c+yGlsn2yMhdtrR4j27+VdAFgQYC DVxGGvg2AIuVhC6uCpdgGbgq0ue6yaIBEDXAy/fcblf+5H/sxbtr2yM1brK/+ou/sMdvrW7LVD48 TssDrGWAM4Gpe2+41v7iz/7MfS7HilXGoRUiNZUVS65DL9nk7JN78QzAGuEBligiBKDyFeDtgJRA FdcifPeSoxWNZy1kHmDJ8qXjS7u3tR/96Ed2/S9+KguVklUT3xUGrL75XaAJC5NAVJbccrg/c+Su yxEAzB4SAoKArWxcnzwDlA8Khv9aQLxLkSM3olLxpMkylTtICwF6trBf/te/2wt3VLd//ru/sbuv u8KKhip+TQCLNDskkQZEIUkuFY+C6sl7KPcix+KhcsB6JUtbIq5R6azGb39lf/Znf2qTOyq3oyyK i8WSv1BgOFkM8PMH9bKna1SzF+661WbJUlmYsMR2rVtt21avsL6dO1rTRvUtLlE8WkeUw/CN12W9 OiBL1mHbd0j5C6FiAFABsPYBsFhJGACsy+hVEDT122jggNIgPNZmvN34whC7+aURkuFObnpxmGSo 3aTjyI0vDJYMshufH2g3PjdA0t9ueLZMnuln1z/T165/uo+Tak/3tmpP9bJqT/ZwcnvTqZZQuEOB hYGL8Nv0UXBNoIGLpYFvA7DyFejOqkBcg4AsBHCVJEqAf/37v7N/+4e/t3jFR22cOso26PgDN1Wz vnWft/X6XqxExSVlsVq4EZESAay1k4Zb44fudcCm9RMP2WpZwiAozSfGy61QxBJFMLlcgArgzlfs U54Ei1XRKLkbyyRktRL/FsBKZfmEGsKBrjDAhQvRuRVlycovk5DrUNYeuQiH1H9eliBxYAlwZQlg cTwnTDjmJeS6DAEmAtuJvcoS4MpSHFaOLG4Ev+cKDOZhbSMgHloF4sSI09I1fGbJvZel+KlMWa2w XC1RjsMr//e/7O//5v/pXHsb1+xFm67UQln95VIUAANghUAVLPAckxtTLkeE/SQHvlrbUn3Ga8FA gqxaKbKejWz2ik1q31RB8L0tTn0UL+vcYn3GDRW1w7jB1rfhC3b/1b+2+uqLcb272YJJ421tbo6t ysmyru1a2yt1XrDE+CW2f98ekZEesQMHDtrBw6/KXYhb8IDtkdsQPqxwHqxwy5X/HliwLtYvPrjv edPAHxSDxaqL7KxMWzh/js2bPSNMZur7OWRO2XE+o4nqSBA78G4R0X2u1RzBFmgg0MDlo4GYAZZi sPKGAaxkWXIAS+6+stirVROGWZasTD/9z3+3f/vHf1AKlx62fsoodx6X4bQOLWxWp1a2TGAKy1eu 3IErxg1xwCxX9SyTtQpX4J/9yZ/YP/1/f+ssV8W6dqXKQ1xK3sNixWcVyCoFYMI6xWemXHlFo0g8 LRAkKR5Nm2TtEvDieMHI3rLcCPTIhce5dACUQBeSi9tQ1ql8AQskywGrzgq0720lAmmFZccKBURW 6N6AMNyFuAgd2NK1WQTY63jxiJ4uJmqprEYApSTiqQR8AFrOSqVjfBYIGAKy0gm6lzWpULFbJYrZ AhThKiwYJjekwFSxPp+9/WYHNhvcX0urKzvbylHdxeQu16Dch1i5uB/0EKkCUwuV/HoJORplpcKC BWDL1v0Wdm5qs9o2sAUkyIYYtUxPCYohi+sFlYMSdSs2bhEgS8+zWPvzBJLr3X2bPXrTNfYLWSEb PfeszR45zOaMHGFxM6da9w5t7OVnnrAl82crcfRuBb8ftTfeOGm79yhf4ZZtWuy0VeAKUtKKrVgh gCUerCAG6/J5WQQtjdDAH76yN06/bdMTSmzQ1BQbOCVZkmQDJ4dLovYTbcDkhJBMQuJtwERk6Rnp r+/9J8ZZ/wllMn6J9R+/WLLEhk1PtfXb9tlXWiYbbIEGAg1cPhqICWBpFWHJhNECNspDKEZw2NyL FDtVNBrr0xBZr0ZZqycfcYCg6SO/s83Txzq294KRxGr1l5VqiG2aNtZayjL1P//2L3bvjdfZi3Ij 8v2m3/xSgKivzVTs1Z/88R/ZzdpfLosWIKt/vRfspl//wq7+6f/aU7Vr2NoJQ+ypWrfYf/3zP9qv /+e/bHqHZjazUwu74Zc/s54vPW2rdT5fAKtkjHLyiRX+RQGF2tdcabWvvkLfa9md1/1W7emt2LBW 9j//+s921f/9jzV58B77rYDEL//rP6zvS0/ZeMUm9Xv5Gav28/+z+V1a2fzOLW2sjt17/TV2xf/+ 2JX973/5Z5ute68YJdAm0NX5mYft2p//r9117RX2TK2b7aZf/dSmta4n61dnte2n9n//8S9W5+5b 7Va557hv3Xtr26px/US+2sm6PPuIXJH/p+f5T6t7320CeF1tZrv69rd//Zf213/5Fy72qsnvblf8 1UP2cPXr7Of/+a/2C7kN42WZmtK6vjV/+B7p5Ga767or7bEaNwgc9rBFAlSNf3en3firn9lNuv/V //ffNqrJSzaw/nNW66rfWP0H7hRI7mMzO7dyffKg3Lg/Vl9cKz3Gy2rY8cWn7P/9xZ/bH+Em/c2v rGPD+lbtit/YT//3f+x3d91h//Pj/7R/EpCu++ILdvzQfktNSbJOnTpZ0yZN7O6777ahI0bZ0ddP n9NNiDsRALZ5RxDkfvm8KYKWlquBVxWDdV+rafarZ0bZlc+NlYyRjLYrnpXo2BXPjJSMsN88Pdx+ 89Qw+/VTQ+3XTw6RDLZfPTEoJI8PtF89NkDS3375WD/75aN97ReP9rFfPNLbfvpgD9U1yuKLd+v+ fwh6IdBAoIHLSAPRAdaHdtrRNIzRSr/BsgwNlWB9Gqz4K7n4xg0TFcNQ+xe5BrFAZWvp/zLth1Lq iC1czOHF+r5l2jird/89DoS1f/pxe+meO933p2vXtCNLZtr9ciOyP7pFA9sxa5zdff21br/dU4/Y T/79X9z3BYqNGt28vovT+rM//RN7/s7bFC9Uy+Z2aROyiMk6tlJurqXifPqXv///7Mf/8k+6dz9r 8Lu73PUtH3vAts0YZfO7tXb7vxZQGNesnvv+t3/1V7Io9bL699/h9mtc+SvbPHm4TWvbRDFkf+6O jWpSx6oJDPF9WptGtkpA7sr//W+3P71NfZvQvI77Xv3XP7MVsmrly0r1z7LIcWxSi7r2n//49+77 1LYNbc24/gJ4oWu7Pveo/b+//Ev3HSvV7A4NQu377/8Qx1Ynu1n1vXBnDXFfNbd/kMuQc6wW/F+B ov/8p3+wOQpcT5HlarRAVJIsZ/+t5/6bv/oLWySrVpvHH7D/+Ke/txGNXjjzHHMFGheLD+uqn/7E mj76O5vaobmr8//91V9aqvQ1sFno/v8pHTa9/26boPirf5bbl2NDu3SwH//Hv7vvj955uw3p1d19 f+ih39nundtt3drVlp6da/sVmhIeh+VT5vjPEMAKeLAuo1dF0NRIDfDyPCDwhHwAAP/0SURBVP3m W5aWlW/zFyfa3IVLKyVzFsRZNJmrMnFJGQp4PCqity+CTgg0EGjgMtJAZQBWsQBWCQBrpCxFWklY oGD3kjHaH10GsAR6cuQ+XDF+hOgZRijmaoxNbNVMbj4Y3AdbzSuvkAvw/7M5XdrLonSHAxWjNJlD 5XCVrFT/9c//5FYbzpZlhXO//b//tTr33uEC5e+74ToxlHexw4umW6vHHwoBkP/5sZIed1f81ggF yYfITHErvixrFec7PfuYYrkG2y1X/Mr+4W//xia0bmibp46wjs8+6s7Xu+8Om9qmiSxnf2z333CN 3HD9nUXrj//oj6zVow/YxknDbJ7ACNdiJYtT4mksUD/7j3+T5aqLDW3wgqvnHlnGVssdWUfB4Vzb UlaltaP7OFD19//vr+16WcOWdmtlP/33f7Vf/vg/5DLsbEMbPu+uvfnXP7eXdN2DN1/rBBdh2yfu c+eeuu1GWzW6p41u+qI7dsMv/8/Vf52sZUVapfjKPbVduT9X0PrDt1xvy0f1chYtjj1/xy2yZsm9 Krdostyk41q8oniuv9big/8WUBODvtyB/eq9aC0ee9Cu0DGuqSUrWJosgM/fd6f9sXTy1B21rPWD 99mjN17v+qOa+m/WkAH2kx//l/3ff//YOjeubx0U+P6///VfIZD6t39rQ4cOseMnTwlciZg0LNA9 AFiX0UshaGpsGuDl+fHHH9vJ14/bgf37bO+e3edd9u0l2PGwvffuO/bFFwHAiq1nglKBBi4NDcQK sFZOGuvA1bIxw50Vi1gs3IXFY4bJYjXcfl1myVnYs7PtnDPV8nSulwKi//tf/0XuqIGyMnUoswxd IcqCvu77X/75nzuA1qvOc27/weo32qGFU+2xW0PxR7gID8yfLIDQRcBolLNSTWjVWMDpcbnEri67 5gZbO5E2iYdLkqcYqr+UxelPBRA2TBkuwNbRlfuNXIobpgyzNROH2C9kueJYimKuqsslyffOzzxq m3TuHwWmAFzZAiBYsO4T8OL8sEYvWf+6oXbWEwDZNWOMXIE/d/vTW9W3zeMHCDz+jdvPEMnp5gkD nbvQXSvXXIuH7w6BsWpX2YaJg3Tf0LXTFCO1Y/pQufxaCSB117l+9iuBMM7F92oloHePFg38nT1U /Vp7SACM431ffsyGNXzO+tR5yhrKFcixv5H1KUP0D97aN1IWq2UCWCMbv6R6+8oCdmsIdD7zmIBX X0eF8XcCf0/XvtWqC4Byrnf9Zy1B8Wp/q+N/Kmtkpvp1Yd8eds1P/ted766UOg2ffMx9r33zTbYi Zam9qP1nH33Ifvmzn7rjd8lFePLNt22nkj7vEF3DdugbWE1YtqLwrAXrYGDBujReAUErvosGAD2A LFILvPfee1UiH374oUtXwMs62AINBBq4fDTwbQBWiUAVVivAVYkm4ZUTRok9vKf9/L/+00mLx4lJ +pn9y9/9nU3TyrMt0yYo7ikEdP7nX/9VYOe/XbmWjz1ir9x3j/1rmfsJN+GOWePlBmxgfydXWI0r fy0AcY91FCgY36qR6Buuk7XmzxxnVtuymK/fKC5qtXi3HHM8PFzjBile6xZZYP7I6inWiO/ct6Es U2smDlW82HC1LeTmI97rL2T9efGu2xQXdYcsSbfZ//fXf2V/JeCXo+D6Fo/c78ohHZ9+RDFQN7jv L8ktuVnWra7PPWZ//qd/aveLL6ux7vXXAnbVFTMGu/vG8QPt5TJQQ4zV3woA3V3tt3KT3m6pCmrv 8cLjzvJ0j469cGdN6/jUgy4QvsmDdzpAxX1YAXjfDSEg+eStN7p4LgeEXn5c7XnQtZP6/k8WtUmt GigmrI/AX8iq9R+q46W7asqSVdNZuogp4zhcV6vHDnRWOPafvb2mYrpCgK57nSeVcqeT/btcmViw utd9yVbPmGiP3lrDnf+FLFe4Ee+66QZ7RaAqdeoEq139Jvt3gegbrr3a/kf1LJoz3Q4rOfSrr4mU 9OBh2yMr1o7SfbZ15x4rJfGzSEe37Tpgu/YfsS24CCcFqXIun7dF0NJAA4EGAg0EGohZA7ECrBUT x2hl3xBRLIQsVsuU/BkBYAG21kwarVVpfWxaxzY2tlVTm9pePExa5r9W1y1XmUJdC8iaoVVoU9uK ibx/L9sxc4r7nNmptc3tKpZyEY2y0hDKBohKWX04oXUTR+MAv9aE1o1VR1u36nB+t3a6po1iiTo4 YOUAllYlrpC7kToW9uhgQxrVcTQH/66A7EytRFyt1Y6ci+vVSXFLrW2y6p7XubWtlwVsueLExolg c1aHljZPMV2FAnGzdP/p7ZrYzPZKRSO+qOntmrrvS3u0c0zxRbKWzVWQ/XjFcf3mv//LAazxTevZ OnIuKjVQgto4Uy7IyYobm662w/i+doJWQ+qzSOSoMzs0kfvvZcVHvSTeK61sFKgb36K+9NPIZrRv 7Jjnl3Rvpfs2UnxYD0vTSkC+p8hClia33wzFh41v2UCkrO2dVQoiUxjvpyg+bLysaqNEyVCkoP6p bRvbuOb1XL0JYqSH/X6WgvQnt2ronmOR3JfjWtaz+V1b2GLdb3TTOjaq6Ss2sXUjy9Eihbg+XayX 3K0P/PIn9tCVv7Rp7Vta0eSxljZ2hM0e0Num9Otp88eMsAXa79emmS2YNtm2bVhnh1lleEQUDrv2 2ZbNO2yXgNVuMb7v3H1Yn0dtC0zulzLA2nf699Y66YDVXbjH6i7eG0igg3LHQD3ppaolGH/B7+9b jQG9u4YWHrUPPw1WoMaMis5jwcoArBKBJFyEyzSRLlfyZw+wsGQVSbBkrZk05oys1spDV16yQtes k5sRwLVG5VZqv2ikUumMGylAhYwQA/wwR1waAlkqP3mkE1yDxGmtERBCOL96Iu6+4bZKx517sIxb y6XpUfnDi2fYwAYvnbFebdHKRsqFAuGHKjZLwifB8SN0vWK4Qvv+GGl7BNiUugcpFoBZrs9lSu8D dQM0DbniyNoii1hSr5D781rFka2TBa2AvIsCS8VQPOi6lZIVSk9ToLgpUujAi5VHDkaRowK0oIbI U/l8reBbpiDzEsVzLZPkiveLPId8h94BmocSMdbDpUWSaegjVo4ZIHDY37HQZ4hQNFMAq5Ccjrqm EMoKklHDAVaWTihH4CpLzO6FAl6USxNlA/xixWP7W5pyK8bBBq8YsRy1PVWUFIu6ifSUpN0CsENf etKeu/qXVr/m9TZJwDFt9BBLV6xduvp82eJ5tlokpPHq4wGdO9i4IYMsPyXFdou24cSrx+ygmN13 yGK1d88Rl79w5y4FuW+7xGkaWghc/ahefkjq5gUS6CAYA8EYuLzGQMMC+1HjQmuTvF+wIXAxn0fs FFNVsQIsH4O1XGBpuSxXAKxIkAXQ8oIbEWC1XJYNPrF8OetX2PeSUSqveC4Y3Utk9cFSFS4AqXAB OEUeCy/vQRaWqkltmtodZXFaL9xV2zaKl8uzyPNZJEAFqKpIiuD6IneiOLEgJEUAVf57sfiysGA9 LzcbAOvX//2fLlAeDi0vBbqmAPCk6wBGeQJYOTC9O+G7AFdZnaH7wNEFKSk5DgWOSANUJuwjgC2X b9Gx0WP5CrHSE9AOwMrSZ5bOw/dFeqBMAap0gSYkU+c4litwBS9WukBVkvizknUuW8dyBcpSVSZJ 9BNJCuQnZVFCbyWOFrcZ/GbDRcD6yi3XWRvFfs3qoZyKE0dagiyYs2WJnDuon6VMmWAJM6bYrHGj bXR/6WfyJNuzbZu99fobtmfXXtu+dZft3n3Qdu055CxYk6dMscniwpo9e7YtWrTIEhMTLTMz0woL C23VqlW2efNmKy0tVULp/Xb06FHH6/j222+7kJePPvrIPvnkExeeQh7cL0UTRP5dxrSXc/wI3vmR TrwT7Rfysv79/aheno1Z9pqVHHg3kEAHwRgIxsBlNQbumbzVftSo0P683TJL334y2isvOH+eNRAr wFohl1CJJlJvvVohK1RFAMsFv+NGlKWqRKDKxWuVWb/88WIBriJZQSKBld8PB1O4/lYKOAGyIs+z D7jyliysXVPaNbPBDV+Wm6y+LewuF5rOkwfR5UKUAKxKlA+xIoHslETUAJ/wtDqO/V3HAFgLxJXV 75VnFUxeR7xUjUSrECIuBZg5ATQJYAGGygNYIXb3s+VJWB0OsMJBlgdY+SpTgEVKdZLGB+JTQJYj T4VMVFYqB64UCwbQAmB5gtXIT86nCVwlye2YCUu+AuLTBLBSqFfPni7XaoJWdgKy0of0tgSRqw6Q Jev5G660+rVutElyNeZOHWsJWtQwvlNbAa3eliaAlSxS0unKWzl9hBZEJKfY/u3b7ch+pdYRyCoV /1UpbkMRjUYCrKSkJAewioqKbPXq1RcXYGGSx3K14egH5/lnF1QXaCDQQKCBqtdAvYWl9qMmRfaj ZkV29dB1duq9j6r+psEdzmggZoA1ZZyAjUCTLFeAq5gBlsoTp1U8NhQQ72O3+ORYkYhKS8SnVYIV ywv7kmVnZKhiq3BBngVY4W5BABb7+XJl+eNYsdbjYlQ8F+l4PLjyAKskJoAll6Lce+UBLG/ZIvZp jbi3kBVKA+TBV4HACcK1xFYBgIjByh8mC1KZBStXwAfQhMsRIFdASqAygEUeQ8AXYMun2XGWqzKB s6sAQFUGsBxIk6sR61Q4wMrQPRDAVo4sVDlyDQKyAFZOAGI6xrkUAa1UWbQAWDl6riKB2cyhfcWG L8Z40WEQB5csS1m8LFvdn3zAnr7ml9bgthtsQpvGlizKjsWD+9j8AT1tiSg5EieOtuSp423p5PGy aE2zNfm59tqB/XZcMVl7SndZ6c5dZwDWFFmx5syZ4yxYycnJ3wBYu3btUkqeA3bs2DGxxr9x4SxY HmBhvQq2QAOBBgINXG4aeHkBAKvQ/qZjif2oaZG1SyJpeBCPdaH6MVaAtbIMYGG1igawAFIeTDlX orNkETv1dYDlymHZwooVJstE3fB1GfY1gIW1Ktzdx3eAE+zvPtjduwsBXL4sqXtceh9JiY5Ht2Dp WuKPwlyEZwBUGSgCGHkJWaxClqvwY/56D7DCcxPi/isKq8Ndp9isAlEscM4DKm+94hjnCbDH/Ugy asCbu7euJYWQB1i4AbFKZQCosGYBsgBTZYJLkPMc5zNNiahzVHe26s5Q3VmqM21QT2fBildqnSU9 2zlXYpYsd4sVdza03nNW5+ar7QVZs0ZoQUGqqDucCDgnCTgvAXSpf5cq7i4/frHtXL/Gjoou6Ijy GO7fvce2llmwIgFWVlbW1yxYAcC6UG+D4D6BBgINfK808MoihTkoBqv5zGX2j52L7S/bLrPC3YGr 8EJ1ciwA603FvayaPM6WyaW3YixB52fjr8JXE4YDK45TzstyAuPLkVAQPLFZZ4VVh5GyYjx0EF+3 YHlgheUKcFUewDoT/O6D4Ms+o4ErzuMixKp0xt3n3X5lAArrFlKIOGCEsH8WdIUsUyStJoYrFFsV Hl/lwFJZPe5TwfDFo5SLcZRAms6dcQuWxV95gOUsWGXuSACcu4+EpNa5uhfgirRBuPyyBagAUAig imMFCtjP072yBMiwXCUqDovzy8QFlq9zxGAliEOMOCwsWEsUb7VE6YeWKM/iEiWZTpVVLEmuycEv P2UvXPcbq3Pj1Taq/stKIj3IssTkv3Rwb1s0sJfFy3WYLPdy8sxJlr10ge1Yt8peP7zXXj0ougZR N0ydOk0y1VmwFi9ebCkKjM/OznYAa82aNbZlyxatPgwsWBfqfVDufQhu+/TTT12wW7hEHqton3PR ykfWHV4+8vry2uOv/673op7KPEu056rK89Getbx7R+r12/ZpND3Fcj7avSvT1orGT2XbUt5Yr0xb Khq7kW2J1oextJ06CESN3OouFsBqWGiLizZbh3krBLaK7MZRG+ydDz++qO+UH8rNKwJY8Od9+NHH 9qaS+RLkvkwxWB4k+RWEHlR9w2qFpSsMYIUDLb+y8Fygq7zrYIYHYHkaBm/FAlzlymoEuAp3EYYD q3JjvByAqtiKVSSKAixS4Vaq8O8AomJWFeoT91yhAEuRVgHyWSCQ5YXk1PkEkDt3X1fnKiyUhQoA 5UTAqEjPQV1FAkX+OGAqPLCd611QPPUomJ24Lq4t5r4OYHEfWbK0X0jiawGpfH0SuA6wQnLKQFee jvMd61YabkTViSWrcKyScev6dNWdpgD6JFFnpAxQMLzir9LlUoxXkumFStkTJ6AVL1C2WKzwg154 wl667gqrKz6wYS8/a0v76Bq5FlMEUNMFjDPkKkxQnNbCKbJkpcfbri1r7MDeXbZdcVjTp8+wadOm 2dy5c23JkiVnAFZJSYmtXbvWAazdu3fbwYMH7bXXXjvjIvzggw8cv2OVBrlXtYuQiPw333zzzLuG fR7Mb5BYEsnvN160v//977/2buJ6jlfl9o5YxA8dPuQ64PDhw3YIorNXX7UTJ064lQcc49Pvc97v U86X5fyRI0fc9dR1/Phxd47r2ec75/AFv/766+68P8e1fp9j7FOO+rjOt419yvnz5bWV6ygffo7y /v7ltY06qZtrI9vCOdd++b/5pO2+PeH73I86fNt4jnA9RtMr5bm/15vXcUV69W0rr+1eV16PlWlr tD6PbKvvx3P1OefD2+rbcq4+L0+Pvk/DxwA6Ch+Pfj9cj75t/lx54/Fcfc69wtvOd39/vvtz5xqP 9L8fr+W1NVKP5/rt+P7gHRK+uXdY/QJL3XDIdm3far/tX6yg9yLrkb5Pxb5etirfIT/Uus8FsADE vMs/1Ps9EmC5wPUyN2D4p19ZeMaFCMBSWQDTyvGiZpDwPRxglQem/DF/jfucEAJY4VYsLFgkLc7D QiSAgpvwa5QNslYBrnywPAHyThSTFbJQVbyK0LsHQyCGwHjVH2ZtYr+EVYMCUySRBlwVKz8hn4Cr ELAS4AFs6TO3zHpVMFwcWqJbKIJKwQEsXat6S6BooA5nwQqJK6OyuAzzdR11OKAlgIV7kDYWqw1c zz24VzG0EgJKRWpLrurIkeSOkQu1TNjP1n2zBOAyZRnL0T0KVLaA87p/pixiBLjnApAUP5Y2sKfi uNR+AbYsJZOOU77EhUoonSiKhywB2yVaaTi24UvWXoSmT//6p9b5wbscj1n+xBGWoVyVcUqrtESf CwSSF08fb6mLZ9mKwlzbuq3UZs6cZTNmzLD58+fb0qVLLTU11XJzc23ZsmW2bt0627p1q+3Zs8e9 I3kPnTp1yt555x2HQwBY/o9ilawirAzAAujMmzfPmeFAi3v37nWNnjlzpjPP8fIEMY4YMcI9BA+A b3Tw4MGGT5SHAWGOHz/eLZvkPNdNmjTJocu33npLaHS6EyYSNq6bNWuWQ53RNtjA8/PzXZsqu737 7rvi2NhhGzZscG1hUqCNxcXFDgEzoXCe/Z07d7pn5TgoGXTMsZUrV7ploewzuaELjtG5B2XOpG7O URfXLl++3A0A7rdp0ya3v379eneeY9TNcYLzuI7reTb2qZvy1MO9fFsZTJzfrhUXvt2YR2kHwnfK c58VK1a4tvl+8+e3aUks57gH7aA93It9yvu2bty40bWHujjPPnrbt2+f0xNt4Vrazj71ct7rkfPs 88mzcp62+Pp5Jsp6vTLeaDsrQ1atXOWehfKcp20sw2VJrtcjbUOoG93Rdt9W7sG1HKNt7FPWt5X7 +rb6toW3Ff1yPc/M/cL7HN3RdnTn+9yDEs5htg7XI206HNbnXEMf8jy+bXynTu5HXegYPVAfbUEv 6I+2+vGJLtjnWfwY4zvXUz91oUP6iD7wfcw53+e0jf1wPbJP+/1vhX3GMddzT/RCvX4MoBvfVu7P bzuyzzdv2uxeiJznej8+eRbaTlt5fp6zXIAlmpnc0jfss7eO2/T0lfZXrYvs7zout9UHTlf2VRCU r6QGIgEWf5qZrMoDWCWjCDwXrYJL9qy4KcXaLJeFAlmmCfTs9xCVA8BolbiwVisGh0/2l5XRNmC9 8ue+BqTKgNg3j4lLS4ztK8aXgSRH2RCid/i6tSrUxnJFrisSURM8v2LsECfLFFgP0IJYtGCYQEqY cMxZpRyJaYhraxmADToJB94kzuUoS5j4qJaJIR3hu7NkAXrKgJZz3QGwoF7ALShQg7g4K+f+A0Ap Hks5DJcrEXTJWAEnfS9UfkEAlgNZIxWXVQa08p1LcoDa21/X9lOcmESfHCtSku0iAchCAv8FpvLH qOwYWbUk+XI95qqOXOgeiOeiHQJWhWp3gdqdB6eW2gzAQgBb6YrDSpc1K0/ALV/ALU2WrGQF16eL 7ytTACtdVr5UgbAZIhltJVb6J371E+v+6P0W17ebJYp8dqlchcnSc7J0H6f2xet7/rwZtj4/z9Ez gBEWLlxoCQkJlpGR4XCAn195LzJ3eKPF6dOnHcACL3iAxXhl3J53mobKACy4I+69917n7wRk4efk H0rnzp3tpZdecg3mZfjAAw+4lzwP0rp1awewhg8f7tBjQny8U0T//v3dJAFnxZgxY2z06NFuosB/ SnlWA/CSbdSokZRD0Gr0jQlw4MCBTsGV3XgZcN3LL7/sJiomFMDhyJEjXXuYIKZqf+iwYdaxY0c3 GQAMBw0aZH369HHPUOeVOk4PoGgmBK7t27evK3PixHFr1aqVQ9pYf7p06eLKNm3a1PF1+P1mzZq5 +6MXgGq7du0sPT3dAQjfNibVunXruuvRI5Ovb+uAAQPchDhLoLdly5YOmAKAKfvCCy84lI+eR40a Zf0H9HfXMxDR/zA9G+3jGOW5B+AlLy/P9R96AGB36tTJnadtTKLch7a1b9/eTbwLFixwz855xgj3 9M9SUFDg7sH+kCFDHNiYLCbe4SOGuzaxP27cOHc/uE2op06dkF7RAxM516JTQD5+dsr07KmcWaNG Wo8ePVzZxo0bO4DJeKK8bzvjkfM8Az86AD7Xozf0yo+Ve3fo0N7VjemZ6zlG2yZOnOi+oy/GBG3l WsYAuuI4z8VvBIsOuqEO/pzwZ8GNJ53nvvQ5evN9zsthpO7Vv7/+BeblWlxcnI0YOcKNIcAM/fBK nVfcbyw7J9td++KLL7o6+S3RtqFDh7rfI8/CHxn6lPO0hXpoKzwwABXGMWUYI+iP+l555RV3LS8o nps20l8se/Z9Gq/fMGOI8US7kHr16rnru3fv7trCmKM/uWamrq9fv74rj37Qu+9jyjC22R82dJh7 BvRKOZ6FMcB7g7FEGf6ElQ+w8qxov1hpPv+9HdpXai9NUcB7wyK7fcIm+1g8N8FWdRqIDrBCLkKs UkXDBTQUuFwkiwSTeMnowQIDchtKSgRWShTYDIBhf4UA12qIRyEWlUA6CqkovFiAKyxbHOPcKoBY hFD264IljBgw1Y24e5R9557cW8BpuTtPubOyXPFdXz8myge1l8TQyyAplSuwCDA1VEBEAMtLEVYr wFOZJQxrGNYvxIGsMqC1TEBrOeBKAKVYwKpIAAVXX8jdxydxWaE4LKxQIRcgLsJQIPvZOCsxvAtQ LR/XT3oEYAmIaR/he/FoWbNGAYp6OPZ6XLb0hQNZAlgFw1j1SP+UifqocDTASm1ABK5CwfMhfq0i tWOZANgyAJaeocAJoEyWL4FDgt2zZR3MUsB7JvxcerZ8QJh0UqRVk4XSQ6Z0ljqwu+PJShSgmtux lfVXXsdGSj7d9u7aSnjdSGmU5G4U+EuTntPVbifqrzQxvs8WuJqrOQbjjadoYE7lfcy7iXfVZQGw eLHxQmfCo+GgQMi6eDBe6mz82HjR8pIFHfLi7tGzh5tk2JhoeHkyEbPxouclzD9mNhQBWAHM8fJt 2bKFjR07xk2WsWxMgkxkld1AsAABAA+dRB2ACf5t868cqxoT4FtqFxPA2LFjnRmSyQqwBSBicmBC yM/Ld8/oLUj+nzmTVa9evZy1AwDJhMGEDuhYvGixqxPwyb35zmQCoOBfPUChefPmro20B30yOaal pblrqA9d8vwgda4H0HFv6qdtCBMnn5SjPACJic37qTlOfdTNJEl5+oFJnTJMvgAb2k45QMjceaF9 AAFLZNEBFkHGCP8s0CP7AGaAB7oCDAMkKcvkTZupn76nTYBEygNWAbIASH40nMf6sbN0p3sGgBNg mPGWk5PjwB1toY3soweeEwsVbaU9nKcvaQfggT6mLVyLfmkrkz5t43loK22bMGGCq9PrgnHLjxjw 4vQoMOOtQvQRdfK76N27t/vDATADDHsLIXqhTvSIDmiXt+6kpaW65wZcrJZVlN8H5Zo0aeLatG79 OneeazIzMt04wjTO78YDPfTl9bhfK28AWIBgLEEc79atmwNEvIAATfQ5+gDI8WzeMkq97APEeD7K oweAIfdln/FIW9ApfeZ/O+idPy70O8/K2J49e5Y75vucPkJ/3sqGnhj3/E7QI/V37dbVunTu4spE bpF/Et9965QtW73BftpLrsImxTYkj2sCAtLKvhNjLR8OsJgjIi1YH2keeOv0KVszY5ItnyCXn5bf Lz8jskhNlOh4idw/TvTd7UuWkyZnomK3BKRKBKBKFCBfLGBVLPBUrO8luAs5Xo64Ml8TMb9D6xAp slYVlUkhgANW+bIyxY4eIiQlrGRU+6CZ4Dv0EAUuOTRuRgEKASwkTyAgX1YWJ1iA4M8SkCoUeEOK BCoQvhfIEhMSyoWASY6sPlnOxYalSPFhAmkEjSN5Aly5AlqIo0wok1wBHX+cMvmyNBVgbZIFC+sT 3wvHCkAJdOXpWK6AUj4WKlkR82VVzBPIylVC7TwBK/a95KltucRa6focXYcrMBfR/d19XLC76qVt rqyXgXIrDrBsWe4ypZMMgShisDL1LDkCYTliqy8kwbbY9rN1TdIgcWUpTitpkOK01I7Egb1twIvP 2Ms3XmttH7jLZillUJJ0HKdy8bJ4JciVu3hIH5s3fIjN1TtooeY/3mG8q3g3eQ4s3j/Mn8wPPuQC ww/veDxoGIh8bCfjlvF7XolGK2PBolH33HOPm3iJicrOznIAin+6TC5sTES1atVygIAXOS9hJi4s BlwPyJg+bbpLGIwbsU2bNm7i4GGZyCjPyxdwhmWFl37PnuLXUH2xbLyoUXJlN8AikyETWL9+/RzI wkrHZIM1hHbTBtrMJMiED7gBYAEWmXyY1FNEiAYw8hYPH7MF+MAaR10AM18Gfbm4GsV/Yflg4gOY MKFx3LsLsZAA/rA6oCfKADbQIxOatyg2aNDA6RN98yyAI0Aw5wHClGdCw3WEJY37UYZJmXticeG+ lPHuIY4zsaIDJmlcOFgXAMOUxR3EProAzNFnfOccQIZJG70BFgCC/BCwRvE83TXJF+QXOHCGbhhP tA0LD1aPvXv3ue9YwqiDtgBwRwwfYS1btHAAi4mYNnmmXvRIn3jAhq5aqCzt4nlpK3XxQ2Qscz/A KzqjHb6PAQnx8QluPKFLrGM8H8/g9wGc9D0gD1DNmEV3ABnAGuMZoQ4AEToF1AC00QfjxIMgAArA AmsNwnjC5cy90CHjku/o6PSp0+4lMnHCRPvg/Q8c0EGvvDzQBeCQ5/N/GhYvXuT6Fh0D0ADOfjwy jvltMg7WC7gBYtArLyXaSJtoJ2PRxxNiQaT/aCfPDmikDACP+rx1kT9jtAO9ALKwcgNyKcO4De/z uXPmWtMmTd0Yo4/5I0D9Xo8NGzZ0dUUDWAStvvHaERuXvML+tEWR/VOXFbbx8FuVfSUE5WPUwLkA FnMEfUGM7XsaX6f0vjmhsfnqoYO2X7/P0u3bbIveK+s0xlfovV0oq2223gupSYmWoHfV4gXzbb5+ +3NmzrBZAvAz9M6dpnE9dZL+yE4Yb5P1e540flyZjLeJ+v1ULGN1/rtIZP2qS7/1b8i3vUdYXRNk VEBc3eXV58pyvkzG6dOXc9ewH3bs27bpa9f5e1VSh2rPBC/faAc69ed5Zuo+e2yM3vej5N0Yr+ec rD9okydOsCnq/+lTxfQuo8cc/VkDX/Au8dYr3tHePcgc4P9Q8l5kzsPIw/uOdxEAy7O4X3SAxcub yQMAxI+KyZrvPByTOFYgJlQAl4+bYmJmEuPBABX8i2XfxwJ5Kw6TDC90QAMvVF7kbEz8KCyWIHeu YRLkpcy/3spsTPi82AFauBmZXJlI+2tSG6VOpqOmqUMBOjwbqJhnYZ8OZnJvr/v2kbUCYMFECuik Luph8sbyglWBNvJcuGO4Fr0y4eFCwQLAhM1goT3oB+sAkyuTF3WiH6TuK3WdZQZLABY2ytAmXHy0 H3AHIAN0MqEDkHwcEX1E/dwHAMLkiKWF/qOdtI0JEbABIGRCpTztR2groOH0m6ddm9nnOP3M81IW wMHES1vZp23obYbayr63RgEG0COf6JlnZh/QgHsYcMT9qRvAgQ44z31XSY+c865O9p9//nk3Jmk7 oJg+QDdYpXhe2gqoop/QE+cAZeiSfdoGgN6xc4fTPfuAM/TCM7DPcawrPAP76I2xjh5xw3EewO77 HFDFOKbt6BngzkuAttCmNwRIeR6u5Vl4Tvb5Pkp6BPxwLWOAZ+caXKuAJJ8GAkDi9cb457fK9TwL 1iruT1lAGmCFfgfIdO3a1VatXmX16tdz7UZvtI+2oDtAJACXuuhTfr+MYV5UPD/76BvLNTrmRcZv hPK0GQDMeANo8n2fQPOE8SE9Rvb5LL0w6QeANNfTHn47PtaNtjJph2+RfxJ5N73//nt2YPdOe3JC yFV4z6Qt9onCAILt/GsgEmARx8JkFQ6wmB/e0aR2WmPmuN5LxBzu3bdfv7GdtlH9vVrW6BJZ23P1 HkzXnJKkPwFLCSfRu2Se3h+zBbRmakzN0FibplVjUzQupmh5/mS9oyZPCcmkyVOii34LkyojFdVZ mXoqUdYxk5dJRW2NtdyZOniWSrQjvGyl71V2n/DrvvY9TK/nKjNVfTxdfywRvjP/0v+MA8YD44K5 xoMr5nD+gDHf8f701nYf4O5JRsEhYJfINDkXHWCd/5/m+a0RqxeTJoICK7MBRrZu2+r+jTM5MRHt k4UG94wPpuaTjvMB0Lh9fFC7D1pmcuA7//aZgHFjcR0TLSCMc3znHgwAH5ROnewDSLAgIFxLHVxP eY5xT75Tzgf+ArCYuGgL9QMMuIbylKNu6glvG8eZXCnvXWAu2Fp1cS11A3YAvhzjHNdTlvt73zbn fVs4jv54Tur2LlIsXbSNcuhl1+5dZ+7NoOeZKA/AZnKmHp6d9nPtxo0bXPu9mZd2+LZSH23BykJb qIv9cD0y6fuAet9WH+ztg8Xpbx/0TltpA8/qA7T9YgCuo63eWkZ9Xu+Up520jfO+z3kGdIFuaJvX o19UUV5bvUUOPfBMtMOPAT79IgY/BtADz0BbKO8D9LmeZ6Q8z0C7uAbhO+dopx9/kX3u9Urb0SNt Z3z4NnMvvlMHdbLPeOGZ0RNluZbrwoPqz9Xn9CHPTn3c2+uRdu7eE1pMwouwIoDFuc8//8LeOX3S 8lautx93F8t702IbX3JYZwJXYWXei7GUDc/bhnulPICFh4I/r/yZ9KuZ6WvGB2OOvuZPJ1ZZJkn+ uPPnCKsslnes8vwZ5Q8Q1lGs2vwBCxdAfVUL9+Pel7oQl1TVuqjq+n3fel3T7/Q/44DxwLhgfPBn E3DFn0D+RPoFWt56xTvEr3rmz6PPQ3iuFYQXzUUYy4/tci2DHxbF+xUGfPdI1x/3HRO5Tzn+zQPq MD3y3dfDMc774/67r9u/dKiTsr5uf57rOManr5NrkPLKU5Zzvh5/PWWR8trmfdL+vG+Lb7M3qXKe spFt9bF4kW33zxb5rH6JbLgew5/FPxvXhevBt512hT9L+L7vI3/v8H4pr+3U7/5dl738y+sXzoeP DfYpF9nH5fU55Xz/RdOjb4vv6/C2+H4NH5+UC29L5PgM16MfB75OPy7PNR693ryew/VY2fEYPr7C 9RapV9+mc+mRNjBRM6FHA1iUwdL1+qsHbUj8cvuRXIX/1kMrfI+/e7m+oi7ZdkcDWI4LS+4Y/z7x iywA3gBxwD8AHADP5IglHAsqcYlYyZlAsRBjqcCFz8SK5SJSmHSrUrjffMWbzp87W59zzspcfa+U 6HrqqCKZp3oXCoTQ3qrUR1XXHdm/9Dv9zzjwwIrxARgHlDNu8ArwpzLcesUfde8e9O+WiigaAoB1 yb5qgoYFGgg0cKE1cK440q9wFepPwd7S7fbQGAW8y1X4xKxt9lk5ZKUXus3fp/tFAixvxQqnasAd 4wE1VgTPa+cpaMJBFpYs3DxYI5g4AVpMokymWLUQ4ggBXrjRL5Skp6VYu55D7e4nG9vvnmtmDz7f PEJaaD9cWtqDL5QjL7ayh8qV1jqOcL7s+0tt7KFy5GEdc/Jy2zBpp+/t7IHnW9mEKTMsLTXlgumm qvqAPkbob9/3jANiOBkXjA/CaxgvngLHe4J86IS3XhF64/9Q+vir8jiwAoD1fXo7fYtnwQ3F6kD+ 0TPweHFVtB2RywazKhKNIwwrAgOZAUiAM6bX8tiz/f2wEvDy499Gvv51RrpvItvFICfgnh8kL9qK NmJm+CG9Lvctz0i7KnpWXvT8i+E5sbLEsvHvhvbgmsDiE23j3xH/oHBp8OOsaKMMeonlWfmHxb+y bXKNUT//8ivaTkt3lMN8Hku8Ia4Y2hKna/yK3YrqZxzkyOTOOIs2vnDboXcsFUnJSc5Sca6NPuJl SHkf2xVtzPDCxF3AixT3U+RW0UIdxu7bp1637GXr7N+6yFXYXAso1hyN1s3B+UpooCKAFR6HhdXA W7F4D/hFPLh/fRgElix+N7i6sUb4sULfEwvKhIorCGFFKpOsF95DVSk5WenWqNc0u+mFIfabB9rY r+9vbVc80Nau+F27MGlvVzzY3q500qFMOupT8lCnkDzc2X7r5RF9f6SLpKv99tGudtUZ6abv3e2q x0Jy9WM9yqSnXf24l1529RNIb7v6yd521ZN97Jqn+qhNrWzUhOmWm5NVpfqoSl1Tt+9X+hnx/c44 wMLJO4RYWsYJ4wULaDi4Ylx5EmPid731ivdZZPyV57+KBFeR1vKwn8U7P9JO1BmjMqsIK/GbC4pW oQYYXKywIxiclVyRQb+RtwZsEGRM4DAIvqKNgccKMvzWDF6CkMub1HwdgAyCxJkACYCuaHLlGgY9 gcqY/PGnV7Qx8fKMTMTEILH6L5LlP/z6Pyi+BhBGEHk0nXAdcUoAFP4xD1HdxP1UtBFbBRgjtogX QDSAxfMR9D5WgeD88CvauDd6AdASHI+eKuwnAWCAJMHmnpS3ovJMTPQT/cmLKdrGv0aC1xkzjIWK NsYJPFjEZNTTuIwGVAlcZ7EAKyNHKng/ktcq8l48J2OLlyzPEYuL0NdBWcbMSbkK+yyWq7BZkf1P 79V26I3KxWhG09cP/Xx5IMvTNfjsHPxpC3cLM+kRg+njNn2cIbEz/F4AWvzW+H3yDgDsI4w3/hBF il+AUxWfWNPycjKsxcB59vKQHHuw3Syr9kw/u/5ZpL9kgN3w3MAzcuPzgywkg8tkiN344tAwGWY3 veRluL5LXh5uN788wm6uM7JMRulztJPqryBjJGOtet2Q3FJP4j7HScZbjfoTrHbDcXbDE51t9MSZ VlSYf2ZRUlXopKrrDO9fgDZC3zMGGA+AKv7wMk58zDB/NgHrvD/Ds1v42Cv+OIYTjDI2w4PbPcCK 4fccAKwYlHRZFmHCY7UYK9Nmz5kd0zPwomIwxrJhkcA6gsUjmiWF+qAfgAKAeIoKEL+7NWCPdgMm +McRbcOKxkoi/O/UH23D5eAn4WgWMs9f5uuMtlKVmAMftM2/qWhgskgvBIAH/7iigQjAHiS2rIj0 nFPRnpVr+JcXy0afsnKQPv3iy68HiZd3PS8qwNhSxTyEp7YqrywvM1YcAvamaFUXlqyKNvTBCkJW CabGQL/Ci5xJl3awmjOyn6L9SeQPwvvvvWulO7banSNCrsKX5+/Qi/WbeQ1j0WVQ5psaiMWK5WOx fKyddxVivcWq6jME4NrxiziwaLEwhD83TKS8M3iPIbzTwoUJt6rEuS0Lcq3FoIX2ysgSqz+i0O5o Pt1uFDC6UaDoxpdHCiAho+wmAaKb6owJiUDRzQJFN78y7qzUHW/V600IiUBRSCbaLQ0mhaTh5DKZ os+pTmo0QqZJpluNxtOt5hmZYTWbzHRSu9kMu6vpZLv+yW42dsocrbAOWXYuVwnvW/qbvkcYB4wH QBXjg3eDX5jmF/IwnnyaNe8aZNz52CtPz8C7JNx6FQCs4O3m/pVAocCLaMjQIQ6RV7QxqLAaINHc PdRDGQAcwCma+wYXDKAAy060iZW6cckxGcfHL3VAKFr9DPjxsmIxGVdkvfLPzz9NTyUCmKhoA6hi wUKP/EijWV4AZI6/SW2HHoEfcEUbOsFyiKWGlXYVbQBJLFdQEsBzFZ6/s7zr0AVtgQYhWlmuZ8x4 SyMv3GgbABLqj3GiesCyUNHGv0osUvxjhNYBU3xFG6AQEty2bds6ABdtA+xjHWOSw7JWLpN73Twr OfDuOatinL518rglFayxf+xUbH/UqsSWbDgW7dbB+Rg1EA1g+bQ5WMi9qxBrOpMf8VjeXeitWUyU /C7DV01j5eV36sWvjGaSRdivKqH+NSuXWZvh8VZvzBprNHaVPdw10Wo0nGI3CxxVFzCq3mCyJASI zgiAyMkMycyQNAYQzQpJ09llMsdqNkPmWs3m88pkvt3aIiS3tVggWShZZLe1XGS1Wi62Wq3KpPUS q9V6sd3Rcp7d1WKm3fB0L5s8a5Ft3ri+yvRRVXoOrzeyT32/+1X4gCrGB+OE8cIfPZ/azefTZXzx fvQLsRh/nlzU818FACvGH/kPpRg+Z1xU/ANk4okGDAAS8Cgh0VxPZ4CKJuRoLjPKMlgBEICZWAAQ L1BcPoA43GHRwCH32LRxkzMNR9t4yfvUOLgWY2k/ZSjLxB0NIPJDBBQCbmPJLEDcCBYXyntet3M9 A0DTUy7wkolm8cKyiIUJtyn/8KNt/OPjObmGl1K0Db3g4sTaFM2yx79K9I7+GAvRAJ9nhOc5o+mF dgKaeU7cyuWNsWgWLOpgbHz00cd24vB+6zxfrsLGRfbz/spm8ObZxPPRdBKcP7cGzgWwwt2EuO0Z I5EgC0DOeOZPBhOjT0jv83FiuUaYRAH7XrAmhwsTbVUJv5ktG9dau9Gp1mDiZms8cYM93CPNaggk 3SQAdXPjGVZdwAnhWI0ms0PSdI5krmSe1Wg2PyTN5wtALQiJQJMTgaZbvQg43dpqiSTObm2NLLXb nMTbbW0SnNRqm2i1kXZIkiTB7miz2O5uPVfuyr42Y36Cle7cVmX6qCo9h9cb2b++3xkHfkwwt/lc qd5qxThiPDE/AuI9uPKuQcZheeSi4fFXMfzWAxdhDEo6UyT8BXGpf/eN9u64aO0FGPgy4d8rui78 HtHqp2x5STLPdV14v5QXVBh5XaxtCTfveoASS9vDrWix6MSXj6Xu8DbFUndlntU/Yyx96kFGZfQS 3k+xtL0q6g4f4+f6PccCsPwYfe/ddxw4rjk05CpsvKRU6OubgfOVeXcEZc9qwI8Tn3LEp85hQvNW rHCQ5elZAOVMiEyM3qLlwRaBygh/zjxHIJ9MrOHCZFtVwh/T0u2breP4LGs4dac1nbrNHumdLcA0 z25qPMtubjLHqgtIVReQukXHbhGQciIQVaP5QskiyeKQtFgsQLUkJAJRTgSgbhWAciIAFZLEMkmy 29omS1LstnapTmq1T7XaSIc0Sbok1e4QyLq7zUK7XrFgsxen2IF9Id67y1Ui+9f3PePAjwnAOJ4E xgrAirg+b7XydDI+qD3SehWe3DkyRU4Mv+lLA2BVtAIthodwRagjWmxPrHWdqxydQEd5otJL+ZOB hNBG/1lReynDSwuJpXys9fp7+rpj1Vll2u7bUpl2V/ZZK6uXWMuH6z1W3VSmXGWe89u0JXycRRtf le3TyjynbzvXMAFXJsg98vcORcObr79mcXmr7e86FNmftJbbd9uJ7/r6CK4v00AsrsJIS5bnD2RC 9Fx3TJIebJ1rnDOphgvv76oSJvL9e3Za50n51njmfms+c7c92q9A1qdFdnPT+Va92QKBqYWSRXaL jt3SYklIWsZZjZZLQ9IqPiStEwSoEkPSJikkAlC3CkA5aYekStLstvbpTmp1yJBkWq2OWU5qe+mU bbU75Uiy7M6OKXZP+6V2/fNDbH5Cph09cqjK9FFVeg6vN7J//Tsj/F0GoGKcMF4A6IwfzxnoY64A VoD6ilyD4eM2xh/z+QdYgBACz/zSWc/KS7Q/Uf08GIzQkIHxQASmjVQMCjE3mzeHkjXjTvC5B9nH 9cPydH50AClPLsc+9eEa8Clboj04KBTTYbQYkPLq4V5ce7mi/aDdl+8/taDvYus7fp+4Ab5NDFa4 ZZAX7rGDe63NnGXOVXjV0HX25nsfRXu9BOdj1EB5ViysrLzfsWR56gYmPB/4TlwWE6InUfbkzUyY HnQxgXphQo0UJtqqEibyVw9pBfS0Ems694i1nHvIHh+wTNanpXazLFLVZY0CTN3igBSSEBIHpASg WicLSKWEpG0IPDlpXyayQt0qEBWSTEmWJNtu65jjpFanXEme1eqc76R2l3y7HelaICmU5NtdnTPt no7Jdv2Lw21JSp69oT8SVaWPC1FveX1M/zO/e2FseELqcGAFVsEl6K1W4IlwzqtzpcWphCHn/AMs lPq73/3OJWEltoS4C/5dQBXw0ksvOd94m9ZtXMAzsRiY9DCtEtAKAONfADnxCJ4luBgw5nPScQ2m e64jLxygixfqjTfe6AIYY3lw6idAuLyEsNHeDfywmejCTdDB91DKnkACHVwKY8CnJ/ouAOuMq/Dt t/Re2WzVBspV2KjIOibv0amvor0mgvMxaKA8gBVOPuqBFhNeuDWLCdFTOfjME6zU9VkImEAvljCR v37ssPWYucqaLzxhbRYcsycGr5bFKcmqyyp1i6xSNWSJuqFFgt3UUhYqWaLOgKm2AlFtBaDaCTwh 7T2AEojqmB0SWaJukyXKSedcSZ5EYKpLgZPaAlG1uxZZ7W7FTm7vVmJ3IN2XlUmx3d0t1+7tkm43 aCVjQkaRvf3mGxdNXxeqn5i3fSYPQBVA3QOrSKtVeNzVt+C9ihz55x9ggfpITsuSfIJm/TJ4kvkC bHgA+JAIpH366addg3hIABaKYCUTK4dYDdSmTRtnyeI6luBTJ2V5kbMqjUA2EGzr1q2dFYv9aBtK 4x6xLl0Pr4/2+WC5cF9vuN+f79H2wyeiyJiByuzHcq9obYl2PmjrQdef0fRU2fPfVq9V0ZZobQ9v K3ENsbb9QrQ1si3nC2Dxu/9U76rTJ47Z3OxV9ldti+wv2i2zot1vRHvFBOdj0EBkvF54PJbPUxhu zfJAC4tWpFWLCTNSmEgvtDCJn3r9qPWcvdZaLD5lbRa/bk8MXSvglCqAlSiAJctRi0RrNXGFPdEv 16o1l8WqXbrVkNQUqKrZLtNqts8KiSxTt8oq5USWKSdlgApQdZsAVUgKrZZAFRICVsustgAVcnv3 5QJWkh4rJCsly+yu7gV2b9dMAawxlpQtguB3Q2nAvm8SOR48oAp3BYZbrM4FrCpBKlreqD//AAsA 9NBDDznyREymuAqxZk1R5mx4jTygGjN2jHMLsrFSCPDExqoAyrGKjGXd8Flg0eI7lAD8awFcsXKJ DRTMfbie87Fs1Omvj6W8L+MtWNEmpHOd9+As8nysExblygNg1OvPVbZt0e59vtt6LmBanvUj2rNE a3us5yOBwLn0/G1AdSQgj1Z3rOerss8r0ltkP1XqD8HBrwPVaBav8gBatD4FYGGl/q4WLH7zgABe zIf377aG00ucq/CGkRvs7Q8q5vCqzDvlh1y2IpDlA9/DQZYPggdsRQIuD7qYf7wwmV5IYVJ/+9QJ 6z13vbWMe8vaxZ2yJ4dvkDUq3W5uk2zVBbR+2yTR5uUrIfmhU3Z/j1y7ulmq3dAakIW7T2Cqg4AU 0lEWKrn7nACoykBVLQDVGVBVLGBVEgJVDlgtl6yw2gJTyO09V9kdSK/VkjWSlXZ3zyK7r1u23VBn rKXkrrSPPnjvguqoqvsjvP/9dw/KPaDy48e7ohljSEUB7bF4x8r5LZ9/gAXYad68ubM4sfGPF3CE u9Av/8d6hGXKkzBynGXWbPyw+O5jqtiHbgCrF53D0nAsVpwn1gKzLBm0uQeuyGgb7YPrp2PHjjHT Efg66RjclCxlDwXRve7aBZs19XJ/QB50BOwTcAchJG5S9mkvHEAszacskyTuT2LW2Adc9u7dy7YI cFIe4Am45Dj7lIN7ikmEfdjaqY962ec+3I/7sk9baQ91s49rFcoGHxgKFxSxcJ4teZisgOiaffoN AAxAZt8TlwJOqQ/XLZZFuJs4Dw0AbccFzD40EeiZSZLyAFrcuj6hJqlhYN72qzqwcALCfbAqFk4o AKiLMpSFJoH9owpcHay6qJPyTLpwYHFPzmPJpC0bNqx3+7QRPdJmyhPj16dP7zN6JMaPZ+WZKY8O sIgSQMk+OkJXXo/0N7oM73N07fscqovy+pzz9Dl9SF+yT9/SNlzfZ/pcbec494OPijGyf/8Btx+1 zzX2+ENztq2hPvdthbMKXimnRwX8Dh329T5Hj+F9DuN9eJ/TVvRJ/VioOY++z/R5/36uP9jHDQ/j P/dhzNF/4X1O/4b3Ob9pxoHvc/TIOOFa6qAu6uQ89+gnvXy9z3u7NnH+fAAsfvdYU955601bt2GT XdEv5Crsng6DfuAqjPaujeV8NJAVbs3yE6GfGMM//aQZ/smEeiGFCf29t05a73kbrVX8u9Z+6Vv2 5IhNzt1XvU2q3SIX4FVNk2xG9m47cvJdy9901MYk7bQnB5ZY9XY5dn2rbFmu8gSu8mWxAlTJQoUI UDlxlipAlUSuv1oCVbW6lYGqM8BqldXuudrJ7Q5USXqvlayTrLa7e5XYfd1z7YZXxlta/mr79OMP L6iOqro/yhsHPq4qctyEg6ryeK6+RVB75JA//wDLIz0eJhz1fSmg5LdYUpREIsbwpdgoA7Dll8LH Up+/N4FvPo1CNBLISG1hRiUon5e6tzR4Jln/b5s4MiYk/88e4kniw5i8mVwJ9mcy5TzAEncl/Cns E09WUJBfxgR+2H0CNjnOeQAC+57in3qoj3qpn/twP9822kF7fNuYrGmv3+c5mJB8W5lYqYN96qRt ELWV11YmVYCiZy2HmyS8rVzH9QAzrqet1O8tOgCy8LYCenAL+7bxnWPheuQa3zbq8nrkHoVFX28r bSktDemVNtJW2sw++vZ6RG++rb5t6ID6vR7REbriWsqjQ3QZ3tZY+5y2cm/68kyfh+nRtVVj4Eyf 79zh9HiuPocXq6I+X706os81Pr7W5yXq883f7HOe0//x8eMT/dH2Xbt3ndVj4dnxeK4+R4/U9237 3P92vtHnEeOTttFWftfnC2DxDvjkk0/t9PFXbUraSvvz1kX2tx2X2+oDFROlxgIugjJnNVAexUek 25D3vg+E92Cros/ygFhVHmMeev/tU9ZnwWZrHf++tY9/x54aucVuUzB6dcVY3SI34DUtUm1k4g57 ftgyaygi0i0aR9kbj1nSqlet3bRNdkuHfLuuda7drM/blBfTiQCVkzOgSsBK1qpaAlW1umOtEqhC ZK2q3XON1e611sntDlRJ+qyXbJCssbt7L5flLN+uf2WCpYtQ97NPPjqzqKAqdXMh6z7XmPB8a/58 JKiKpGHwY/I7/E7PP8D6Do255C8FYPHvmLgyvxzUr2Lw+56nxe97gjysIRxj31s62McC5zldsNSw H1rOHuLsOLv/mivH9b5u6vH71M8//fDznkitsm0Nb3tsbQ21LbKt7JfXVr+UPlKP4ft898leKV+e Xr/WttPf1GP5ej3bVur1VqpIvZ1Lj5SP1ue+refqc7+y1tNLhOutvD4/lx6rss992889PivX576t 36bPK/vb+a40DZEvIucqlPvn4J5Se2GSXIWyYtUat8k+/P0nl/w763JpYDSAVR7YYsKMJrEAsfNV BkvJB++ctr4ArAQBrAQA1la30q+6rFe3KMYKuatbnoBUtj3Wv8Rm5x+wmh3zrNf8bZa6VsncV75q raZusvt7L7Mb28t6JatV7AALy1VFAGutA1j3lQGsjMK19vmnHzv32PdFKhoPHqD7z/AxFf79XByL 3+K3FACsyiotGnHkpXK+vOeKhQjSX1eZstGuKW/Cqkz9lSkbrS3lWUaj9dmFbH9ln7Uy5S+l50Sn lWn7tykf3m+xEo2e633Ai/vtN0/ZijUb7Be9i1w81rD8gzxFZV8hQfkKNFAZoHWuCfJclq/ICfZ8 7wNSPnrvTeu3cIu1SfzQOiS+Z0+P2u4oFKrLenULwetaDXhdywyr1jrTnh2ywuYVHrKfNUy3m9rn Wdc52+zYaVKa/cGOv/WxdZqz3W5oL9egXIFOzlitZLlSjFUtWa1q9SgDVQJWt2O16rVOlqv1TrBa 3Yn03SjZJFlv9/RZaQ/0LLQb6k60zKJ19uXnnzir4PdFYhkTkWUq+x6qxA84AFiVUNZlVRQ3CS6o Tz79xLbv2B41RQ2WhTVliVGx0FS0ETRILBxmX+Lotm/f5n6g59p48eASw10Zy0pPgkVxuSH8K6xo Y+IjJojFD5joaVdFLmN+TLjhcD/GkoKHe7OQwrsEo7WH8ri0qJ8+iJZHkfg56sbVFy0ND+2gHPXy GS1nJOfRIfXH4g7H8oP7k2uiJanmOelzdM84i5Yq5/iJ4849zMsNV2K0Z8VFSjyfY8eW2y/S5Rc5 Jghsx41L35a3fVeARZ2Mq1PHjti45JX2Zy2L7F+6rrQtr751Wb0XLqfGVjTxfZuJtKqv4bf+8ftv Wb9FW61N0kfWMen9EMDSCsDqisPCanWTgtlfGa34qG4Fdo8CznM3v24D40rtwIn3z3TNH/QbWb// beswa5vdKKJbgJUTrQYMASu5BeUOrNFtlVXvKrdgmEvQgSuBKuSOPhutVk8F2fcCZG2WbBDAWmX3 99JijbqTLLN4vX31xafut/VDkyoEVeE/sQBgXU4vnMq0NTU11S02IAlug4YNo07GTFDdtHqzW7du Lmi+oo3VlN27d3fuPyZvgo8rAhIAMgLiCb4mmBwwVNHGxNq+fXu3gCA5ObnCskzsBGb7GCjaVVH9 /LAIroYCJFo7PLhi0QLXUHe03IWACILKKY9EAxKURSf+GSp6WEBVu3btHMVIGy302BMlwTLkeix6 YIUtADfaRnB/jx49XIB/LDxxBNwTpM5Ci2j5K1mQ0KRJEyNBdJ06daIS/bKQBIEPb6BWDVcE4Hku Frp06dLFfaKnSEvl+QBYTEIfvP+eHZCr8KkJchU2LLT7p2yxjxWjFWxVp4FoltdL5Txj9PcfvG39 Fm8TwPpYAOsDAawdXwNYv22eLqvVQbkDj1nh1q9nHDh2+iNLW3fcmk7abDd3LHLgikD28gDWDZ2W W49Fe6zDnF12RZtldl2HlVat0yrJaqvWeY2TazqssWdHb7fx2UetZg+sWF8HWFklG5QBKhQr/UOW qhu5FgCsKlTuRa0aCwArJQESsdJXEPwfS8JkHgxLB5Mwq7yiTa6UB1wBUAiwjmbtIEaJ1WmsOMvK yoqqRwLsWaEG8ABoRduwogFA2aItkCDYHpDKhmUvGihj9SzB91gEAYrRklsTfA8Aou3R6sYyhk7o T1Y1YnGKtjEOooFUXwfWKPjoAJRYy6Jt6GbatGlO91gdK9rQOQAIgMgzRAOeADHAISsJY2k/emQB CjFj6Ccy/db5AFg8H38k3jn9hhWuXGc/7i5XYbNiG19yWGcCV2G08VJV5y8VcOABVv8oAGtG3oEz qvj8iy9t44G3bXD8LlEolLi4q2ptC6xGF4Laz7oGIy1Y13ZYZmMzDtlrb31iMwuP2uyi12xOMXLc 5pSEZEbBa7bl8PtWvPNtu6nr+jMA64EyC9YPDWBV1firoN4AYF0EpV+QW+KiYtk7K8ygsIjm2uLl wETJZBbNWsADYB2BjwzgFA2k8M+fiRLqhWgTMXVjGcOiM0IplABMkdaISAUymUIDAg1ENLcZ17Ka DZ41XFVpaWkV9gdgCeoAwA/ALxpgSk9Pd64qgGFDWQ4BRRVtAD2eNV4gLprlEDdfhw4dHGjG0uhJ fM9VP3oDCEMrEQ3UUgcABRoGKCcAh9E2ylOWfo0GsgHWAB+uARxiBa1oo1/I/oAVlntE2yiPBQ4X IRkgIi2q5wtg0Q7G++uvHrSh8cvtR82L7N8VC7PrRMXPE639wflvr4HLDWDNL5JL/YuvbOmKo/bC CLkLBdSv1crBWzoWWs3OxXarwNWt4reqCGBdJ4A1OHF/TErL3fqm3dAlAFgxKev8FgoA1vnV56VT GxM9LiqsHLhwouVexNLBpI2Vie+xbLhjYiFshVIDNxjusGgAhfsySWLlYJUgk2UsoAxAA2iKtgH2 0EunTp0cT5fnXzvXdYA3XGEQ5+KyjGZlAuBhAaL9GeqDaMAWixcAiz6K5sZDdykpyc7NRv9GA030 PaCTzAixWPawAmE5xOULSIy20fcAZwBQtJgt6sbdR9wbz0vfVrR5yxsAdIvi6qJtWBmx2HrOr8jy 5xNgfSXg+r4A997S7fbAaHFjNSi0x2ZsldXss2jNDM5/jzXAu+WTD9+x/ou3W9vk3yu10of29Oid Lj/gda1ENto+265ukWHTc/bLYlVqVzTLsuvbQMkA11WRVZdL8GZirgSubu2K9UpxV4joGJycCWxf JZfgchuZdsg2HXrPBiYcsCHJh2xoCnJYcsTJkOQjNjn3NUvZcNqqd5eLsN9Gu6fvanugV7FisCZb 9rKNonP7/HvcIxf90QKAddG7oIoa4FmPsUbxjztakDDlfZ6vaBO3b7JPIxDtEfiHCTgAKEVrB3X5 NvMdgBPLNZXhLKEtPCvtiWYdow2UAUBEs9R5PdBmLDSx1E1ZQBkg9HxvWHF83q1Y2u7LxwJofVup N5bxwnMCNt0kFMN4rKwuvB7PBeDPJ8AKjUutKjz1umUuW2v/qsnxR82Lbba4jAJXYWV77vtT/lwA q4aY2euNWeXS3VzdMlNAK9euaZWllYRKlyOAVa1tno7n2iP9V9mLo9a7+KtYANa4zMPWZf4e+1XL ZVat4yq7XvFX13daa9d3WSeL1Tq7qsNaqzux1AGsW3poFWEAsC70YAsA1oXWeHC/QAOBBi68Bs43 wPJ/Gk4cUTaGxSFX4Y/FlH3wjYoXcFz4Jw/ueKE0cC6Ada1AVc6mE7bntfdty6G3bZNirjYffNu2 HX7Xth5+R/Ku4rDesWNvfmyjU/fb1a0KogKsarJgjc44bCnr37Br2q+0W3tALrpessFq995ot+kT oJW07pQV7FAMVrfAgnWhxkHYfQKAdRGUHtwy0ECggQusgfMNsGg+E+p7slTuFE3JnSPkKmxYZHUW 7IhKzXGBHz243QXSwLkA1tUtMi1/S8Uucd/EAXG77ZrW0QHWjZ1WWpcFe+z933/hXIN3aYVgzR7r 7Lae6x24qtljgw1OPmy//+wrm7/8pN0cAKwLNAq+dpsAYF0MrQf3DDQQaODCaqAqABZPgGvyrTdO WHLRGvvnTsX2Ry1LLH7T8Qv7cMHdLgkNnAtg3dhWK2KTS63ZpHX22IBlNi59r+O/enqIXIIj1tgz w1Zbu5lbbcvBd63djG12fbvCqBas20Qwemv31bJ8hSym+17/yFbufsfJqj3vWukxCEvF4ffh5/aU qCJq9RYPVuAivNDjJABYF1rjwf0CDQQauPAaqCqAhasQyokTR/bLoiBXYZMi++WAtVo+XzFtxYXX QHDHqtZARUHu17fOsGtbZdovGqXapMx91nPBNvt5wwz7eaMM+2WTLLuyRY6NlXtwVMq+mCxYtZTM +abOq6zO+G22qwxMRT7f6fc/s55xB61mT9yDWwKAVdUD4Jv1BwDrwus8uGOggUADF1oDVQWweA7n Knz3bdsqSo9bBodchU3jdtlXX35xoR8zuN9F1MC5ANZtWkVYXWlybumQY79tnmEzcg/Yx59+YbPy D1mfRTtseNIeW7bztH36+Vc2cOluu7ZNdBdhbQGsGrJg3dRlld2tFDgjUg9bxsZTlrPlTcvYdNpm Fh2X5Wq7ymyQy5AA9wBgXYShEQCsi6D04JaBBgINXGANVCXA4lE+k6vwzZOvWVzeavt7LbX/01Yl lrL1xAV+yuB2F1MDsQCsm0TV8GDfYttx5N1vNHXV7jftrp7LrYZczdFWEd4q7rUHB5FrcJ3S5ayx G7SC8LqOyBq7jpWEnddZDcVh3d5nkz0xcrvd0TcAWBdhbAQA6yIoPbhloIFAAxdYA1UNsHAVfiiq jeOH9lqr2ctcMuirhqyzU++df/qNC6y64HYxaqAiF2E1uQjhwaopqoZqrbPtPrGpj0rZ66xYswrE XZWw22p1KXHWq1h5sMZoFSHs7dW7KuHzmSTPgKqNTgh077HkoKVvejOgaYixD89zsQBgVUahvETh CkJ89vHIfY6Hny9vPzxzebT6yqsr8v6R9X2XtkVre+T5c907Fj18Fz2eD71XVdujte3b9Pn5amu0 8Rit36p6PFb02wg/Fz7Gy9NN5O+6qgEW96Md7779pq3fuNmuGyBXYaMi65C8hzOVec0EZS9TDZwL YNXsmGtPDiqxG9oq1kouwqu0qvCKZhn20wbp9pP6afaTBhn6zLA7upXYE4PX2C0xWLAgGh2WctC+ /OoPduLtT8rkU31K3gkJaXRwOxZsf9tu7CprVxDkfqFH1qUDsCKJECNTXUSmb4kkn4RgMJYUL99F w7B4k/rkxIkTduzYMSN1Cd8R0ruQ6oTj/jwJlDnu9o8eM79PmfCynKcujh0/ftwJ+5QP3/d1cYxz iL833317KMd3ylXUtvC2cu8zbVX7fFvP1RbfNt9O35by2lZeW3xbY9WjbyvX+e/hevNtL09v4W0N f07fVq8nvx+ux3C9cl/2w/UWPgYin8X3c3jbItsevu/7tKI+D28rz1KZtka23fcx7eN7uG4q0qMf E5Hj0fezH8vRxmP4GPBt87+jSL36tvk+8PuR49O3KfL9cCEAFu+WT0XYe/rEUZuXvcr+um2x/UXb ZZa/K3rOyO/yXgquvTQ0cE4eLJGKZqx/zZbteMPS9Zm14YRlbQyX1y1VSZ7hxSLI/eoYaBoAWEOS QzkNP//yD+XKFzoOwMrZ8lYAsC7OEDn/AAsGa9KWkBcsJSXlDBBJVp470nvwQiS/G2lHSCgLMCLV BnnnVq1a5dieSXxLWg1espxPSEhwKTBI/QHLNKlISItCYle2FStWuHxrsSS/pTzXkYLj4MGDrn7y pPm6KuoHABY518hlx+ehQ4dcepOtSuVBMlte+qT42Lhxo/tkn5xu7HOvAwcPuDQw/lrKcO2OHdvt wIEDbpIj4S6yf/9+d/3mzZvdPQB2XIvuSG7MvTlG3ewfPHTQ3YN9ylGfbxttoC7fdt9WPsPbSj2b Nm1y5WjLzp073f2ol+vJ3Ud7aRtCee7jz3Mt19AuxO9ThrJcS9s4xzXokbaV11avR+5DW7weeW6O heuJ8zwrbfXluRdlfPnwttIGztNW2uHb5vXKNehlT5neaB9t9X3q9cg+90Mv3IvjlPVtC9cj/Ui9 XMN52su96YPQGAjt8ywV9Tlt5Dm9Hg8dPOTa5vd9W9EXeqZ9nPd68X1OOcSPR39vr0e/T1tpH22n bV6vXMs9wvXI81If11Le69HrHn1T3o9H3zbaxHc+kcg+9nr1bfW/lcg+p63ojrEa+WfrQgEs5ypU loAj+3db4xklzlV446gN9t5Hv784r/jgrhdMAxXxYOVtji0eb1D8nphWEQKwcBHOVVJngtwfHLTJ Hh6yWbLFHh661cnvBm+1BpN3WcLaU4rHCpjcL9hAOHuj8w+wyHl3zz33uMSuM2bMcMl0STPSunVr e+6551wKEV6U999/n5vY3njjDWvRorkNF8AieTD/QMk/N3/+PJefjRfuHOW8I7fbmDFjbJte0AsX LnT50gBavLSbNWsWU3JanpskxfHx8Q4A0lZe3t26d3MgLdoGwCL/Hu0iKS6gjnu/8sorLicbExoJ ljk/bNgwN0mTCJfca5Rngho2fJg7Tzt4pjp16li9enVdTj8AydChQ12OPJ5x5cqVrp6ePXu6enr3 6ePKo0t0l5ae5urq27evFRYWOkCLXsg/x/UtW7Rw5dln0pmp/qA8ZWgbIJYcgeTZY2IiKfTAgQNs 3Lhxri3ou4/uSRsAoaNGjXT34rnpJ3LckdcPcEq+Purt2rWrA7/k+OO+3I+2dOzU0empS5cubmIn dxz9TRnKk9SXtnIvJthp06a5a6mPxNW0FT1yzZQpU6xB/fquPsD3Luli5MiR7jzlyLsHYEdvPAtW j5YtW7p78p02cC3tB9R36dLZ7bdv396NN5Je8yydlNsuNyfHEnUP2kKuu5KSEvc87HNPxkOjRo1c 2+fMmW1JiYlWt25dt89zAajoZ/TGs5HomPMNGjRwfY6OKUtiaPqb5MyMAcbLpEnqc+UGpG0keeY8 baQ8+4xdnh+dMGYYw3FxcW4fXaA3+oc+Js8kiZbpO7+PntEPeuLPCcCNcez7HGBG2zlPMm3qo7+4 nnp5JtpCUmYP+hrUb2DkHeR37dtGe/ittm7dxpXnOu5NHb7tgC7aTj/RFn6jPDdCm3lv0Kc8J3Uz PsP7nPHJedpOn0SmKbpQAMu7Ct+Tq3Dthk12Zb+Qq7C3luZrvWG0V0xw/jLWQAhgvfuNXIQ3tMm2 qdn7rMc8AZ5xa2xG3gFbrYD2ZpM2WKupm6zppE02KH637X3tA2sbIw8WAItUOX3ixPzeboVWC651 RKM1e6wXLcMGu1VyXad11ks0DVmyYAW5CC/KwDr/AIt/ji+++KLV1wTISw9w9fkXnzsrFZMlGy+/ l156yU0+WKyYTJg4AFZsvEzHjB7jrqcsL9zhAiaAKfZ5OQMKmOSZoBo3buyATSxJikmUy/1oD9fz owAMFBcXR+0BJqiJEye69jCJMGkw8fCipz72mcQBM1u2bnFtwmqHJS45Odn9S2eCItEw/7Ypz7VM Ylj9mOy89YJ7MSF7awkTzjTVN0LlARhY+caOGxu6lyZG9mkb96KOLD3nGE3m1M99mLyY0AB5tA2L IBOgs5Jt2ewAHLrB+sD1PBcJf9Ep1j4mL4CLt2qV7iy1zgImABEAM23lWvqMe9Ev9BMWi6KiojN6 YrKkPu5HWwF6gF3Kez2iSwQXYI4ADsDP65HP+fPna3yMduXZB8wDLgBHgALaik7QMc+EpQNwRBuZ yLk316KvAvXjtGlT3b7vL46TjHjZsmU2W3qaMWO622ec8KcB4OTbDhgDlIwYOcIS4hPcs1EX45Pv AD7AL7pgDDDGKc/z0uc8C+1ln2cFgHnrHWOJNlGePgeQ8azUDwBFb16P6Jm2cNxbmgCC9Dltp26e CxCOXhMFBAG6o1RXu3btnK64l+9z/hjxTN46Rt20k3KMAYCg1+Po0aOcvgFgrVq1cm1gn3HN+KJt ubl52g/1MTrg/lixjx476oAjwBfdttCfAvqSfuN+COOJ3xz9Rz/Sn+iBtob3OaALayL3vlguQv8S 4b12Sq7Caekr7c9aFdnfdFxuqw+cjvqOCQpcvho4F8CCpuFm0TRc05K4qxQbl7bHus7dav9bL83x YP28sfixGmfZaLkHRyTvi4mmgVQ5I5TseeuR961md60i7Lzabu661qp306rCbuu1v85u77vJNhx8 3/KIwQqY3C/GwDr/AAsX3gMPPOBegHzPy89z/8iZsPnnygbQuPvuu92ExQuyiQBSggAEFgWS3lKe ly3uO6xG/CtdsniJA2P8ewWo8QImTotJikmJf/pMSNE2wAaTBZMB92BjAuRlHW2jDJMKoBFwhnCM CQVQyMTBBIbVg4kASwnAjfK0G9CE5YJ/8UuXxjn90AbKUBcTCJMDky3XYylgsjx16pSboA/KHcSk xcRIXeh067at1qNnD+soiwaTKZMMFq7FS5a4yYZ+oG08NyCNZ/VtQ//oD3CLhQNrDmU43717dwd+ uJbJz1uxADtYEShXr149B24Bm7QL0IFljuvY5/70Fe0EfHHMT/Y8N+WYUJlsaTe6pb95DvoSvb0l NzITPwCSc0zY1MGkmypdY4VkEkYfswTeaDtjASB1+s3TTnfU5a1EgEQm69ECLQCF1+SyBsT69tMX jCeeg/sD4Lg/ekC4b5x0C/hqJssNOsSqhdWEeo8LvDAGlqgM5bkPgIG66EPADc9OP/j4OPqIdqEj LDpYQhkv3s3GeADE0g88F21lvFAHYw89MtY6d+7snpX78R0gj27RG89DWdpGcml0iM7pvzovv+yu 4zzAyfc5fwYYj1zPb5bfJWAJffNbZmzSt/Qz9dN//HHCukbb0Btg3f954hn4E4HFk3YBVAFXgDLA J2OF63k+2khbAdp+TGEpxKLlgSRtBbBzP8YkrnZ0hcUtMqbzQlqweI8w2X6o3/ehvaX24mS5CmXF qj1+k73/8SfRXjPB+ctUAxUCrHZnebDmFhy04299bAPjSq3xhA3WXizucSuO2en3PrVhSXvtmhh4 sKp3WalEztvsvY8/tzX73rW2s3eLdHSHju100njqLive+bbT5OCUI1pFGOQivAjD6vwDLCYZJmus I2y8yJl8+CfPd1JLzNcEykuRiYyJwk3Qmoj4587EwgTJi9jHHvHCnKR/35xnUmTy5+XNRATI4t85 L2wAS7SNSYWJhMmASZIJm8moR48ebsKoaGMy51qsE0wsTMzUg3uHiY8JBACCVYeJkokOqwETEpMJ 92AiYdJq06aNmxhbtmzh/tXz3LjZKMvzAzKwWAwfMdzdDyC3atVK52bFuoAuFy1c5IAP9QI4mdQp yz4AknsyIaFH31ba1r9ff9c2rCLeTcdExzMB6rCYcD8mOupnQmOfdnJ+pFyF7du1d9Yq2kL/AEQ4 T/vRK5MjbWHS5Ll4FtpOPQAFrBe+7egBixquM1yfgG70yPVMoFhRJk5kf5gbS/Q7fYYl8nUBFtpO m5n0eSYsZt4yCLBkgkfnjBEmYsDY888/754LMIHunn32WTcOXzv2ms2dN9fdmzEI8OGetJW+3Ki2 AJAGC3z0UT8xHrkXri2AL8+GPgA3jG36gbZRHyCGfmjSpInTE32ORYg+4vcBGESPnDvb56uc3rCG EbPIedrKM1K/1yP3BOwxbgBGjCH6Af1RF21ev2G9TZwQGo9YziiDftA5Viz6cvz4cV/vc7V9mK4H 4FK/d70y1ug39Ejb6COAEiCRPkAnvAPQG2OAPmIf6za/QcrxGwa0MSb5E8X44zdIW3g+jgOYAe70 G/cEzHE+Q3oYr/7xfQ4wRs+MfcbSxbZg8R7h3fT2m6dsxZqN9rPechUqHmtI3kHgV7TXVHD+MtRA RQDLE43eoLQ5zwxdodV+34zJ23fiA3uw/yqr3jE6DxZM7tU6rrT5y86mZfroky/tA+Um/FCffsOC dUe/zbJmBalyLsKQOv8Ay8c+4CoMj4Pw3/kEZPkXkH/oyBfiZ1qN4wNVuQbr1bn2K6s4JjkmFepl 0mKSZB8rQ0UbAA6wwoTMJM0kwcTBZMBxJgL+4QP42Cegn0kIKxETPP+4uQ/WAKxFHMP6QR0+qJ1J kfoAEa8eedV9Z2I7cGC/swbwHWDDeZ4D8EJbmGwBeQAZJjsmKu6HJYFJnLYxOdF29mkb9bHP87NP vVxPPdTH9d7FBnAAlNGeXbt32aqVq2z/vlCgO8+CLjjH/XzgO4CFZ6MttIm2c08ftM690A8glzq4 ljbSVtqI3riOezMpZ2VlOv3y3OjNu7P8s6IL9Mj1nOP+1EPdPiifZ6IN3Iu6/UIB2ubbApCnD3le 6gY4oweudXosGwPUzfWUY4L3Qdj0Ie1Dj5QHZHk9cww9oRf0hO5pC3WjQ+qjrlCfH3Du2/A+93pE H7QNMIoe6Tv6kP6g7ZxnH32iR86jR+c+1j7nuacPrucZ0Gt4W2k77fRjgvuFj0/6grbRJp6Dsljd GNcAU+rjWr5zLXXzrFxH3VxDW9lH97SN52c80z7qQ4/olbZSHp3QVvqT+srrc+51MWOwwt8hWOHf eO2IjU5aYX/assj+qcsK23j4rcq+soLyl4EGYgFY8GD9tnmmPT5wuS0oPlK2mvB1m5l3SASkK+0G 5SGEB6uGOLFu6bzManVbbrd1XxGSHiutlghGnQhg1RST+z1919mU3KP2xruffU1DH3/6paVtPG1P i829Vu+Ayf0iDZ/zD7Au0oNckNvivsTq4FxXcolgrQOgsY/1gX3cH7hU+MTK5F1N7FMWKxh1YDnh O9fynWvD66PMGydD5byLkfLhdXNPzlEv10bu+3tznLbQBsr7tkXuU576uU95z8Z9fLv5fOPUG66s +172TP6715N/Nq8XytMW39ZwPXLv8LZ611Zk20++cfKcevP94PUW3j6++z6IrLsivXq9cy1t8f3G M6Gn8D7yevB9xvnwfvB6Ce8z7u33I6+P7PPI8eXb4q/3+9zT6+1cevS68M+A7jhW0RjwrlLaGd42 rg3va+4f+ayR4ytcj5zzYyF8jHk9Rv52uF+4Xv145VqOXwoWLF5KtOODD963/bt32tMT5CpUGp17 J2+xjz/59IK8s4KbXDgNxAKwqitdzu/6lNj1CnwnBsvzYP2sIdxYuW4F4W9b5lv1ziX28MA1VrPr snMCrFo9dZ74K7G4PzNqq7WetdvaztljrWfvsfqTSu1mpcm5psNaq6FchHf1D5jcL9xIOHOnAGBd BKUHtww0EGjgAmvgQsdghT+ecxWePmmFK9fZf/eQq7BpsU1YdlhF/nCBtRDcrio1EAvAuqpFhqxV Byxzw3GblnPwDJP7bLG5zy444mR63mHL3HjSZhe+ate2LaoQYNXqudaxuFfvtsZu7IKsFefVOqvW ea09P3aHLVp5UisJD2llYUDTUJV9f466A4B1vpWOWwS3B24m7wot7x6cw3WF29HzQFXUFn68uFpw uWBhiLZ5jiLK4W7BpRJtw+WFy4W2RyNtxV1D7A11R9u8m4xytIv7RNtwNeHmIxA8lg3d4HrjXpHu ofDrOYdLixV4uJpwRUfbcKPxrLG0G0sKfYRLkLZE29AHLjvaTmB3RRsTNW3GzYbrKZaNNqCbWDZc a1mZWZarMRCNFw4rEW2hTbiTcetVpHfGnx8rngurojZhfUOH6CZabCT1cG9+T7gULyUXoX9G+uvk 0UM2ZOly++PmRfafPVfZrhPvxNItQZnLRAOxACyY3OcWHorpiRYvPybSUbkMy3ER1u61WilyFK+l NDm3C2BFpsqBquHx4dvsyKlPbNWe9+yGgMk9Jp2f50IBwDqfCgUoERBNgDcBxEwS59oAWKygIwiZ QF4+K9r48VI3wdO4KqNtTNgEN3OfoUOGuhiWijYmPQKkCaJmhWBF4JB6CJommJrA42gTOHFBBDED 2ghsBqxUtDG5E1BOsLRf6VlReSZWgrU95UFF4JCJmNgeVs/RjmjPyX1ZyEDA/8wZM108UEUbQIMV feMVpI9uom0EqaNHArqj6REwg17guIoFGHJvwD7jLBYSXnQNp1Xjxo1cvFtFG+4/Asr5BKyyErIi gMX44znRN4HyjM+KNlyAlO+l4H1iyaJtgE70zcIFAG7kdjEtWLTFuQr1x2hv6XZ7aIysWA0K7alZ 22Maf9GePTh/aWggFoB1tSxYk7P22RytJOy3eKcNWrpLHFi7bLB4sAaLZPSMJOy1+uM3W/VOJeUC rJs6r7R2c3ZZoyk77LdtVyjgfZVdL1fh9SR67rLObpD8tv1aqzOh1FLWnw5yEV6cIRIArPOpd1ap MdmzYZmqaBIMB0yeTDNaW7AaAYC4NpoVC5ABUCLQOzklOVrVDrxhTSEQmskQNuqKNuoFOAGGWFkZ bWMSZhKE5iAaOEB3TJasrCPwuaKN52RyZ0JmI2YnMv6mvOtZYRnLqlOuZQUd5QFDBHBXtGExYjUd qyCjLZqgHnQC/QD9GkktUN59sL5hpQHMxNJ+D5oAWtE2z3kGQInFasRYB6TSp8RTRdtYQcu4YTVl NAspddH3BNVH2wBtnj7FZyO4WEzuFbWVdr596nXLWrbW/rVrkf2oRYnNXh3dyhnt+YPzl4YGYgFY NZSX8NZO+Qp0z7BfiAPrl+LA+mWTLPtVk2xJjou/uqpVvv2qWZ5d377YannrVUSQ+7XtRTSaddj2 Hv/IBiYcUNqcQzY0BVHiaNEyIEOSj9jk3NccwPo60WiR3VBXvIfLNgr5hxacBVuVaCAAWOdTrbhM +AeNywRrFisfz7VxDqsIK6EAE1i9om2s2MICxAToaTAquob2QAfBpBxtwxVDvYAyJnyAVkUbkyST KxYbnjnaxsTXtl1b5/aJtgFMADNwIGGVqmgDaDDBM9n7PHbRABYWEZjYAazRynJv2gC1wvIVy6MC A9yJWLDWqV9j2TzbeSzuRJ4VKgUIROmr8iw14fdkhWHv3r3OUIcQKB5tQ++Ms1g2QC2ULJ4gONo1 jEPGYyycc4BNdDNX3HIff/xxhVXTh4wV6of6BStv5G/vYluw/APgKjxx5ID1XbzcftSsyP6n92rb 9/q70VQXnL8MNBALwLquVaYsVyI+nrVZdA2r7IURa+yFkWvtqSGrNSZ2WZe5O6yGAtxfHL3B7u+7 6pxB7jC5D04K5SKMtuVveyvCRRgArGg6O0/nA4B1nhTpqsGFg7UDbh8sNhW5n3jRMhkQY8SEFg0w 8ePFioLrEXcSwCzaxooqANn770eP2aI9gCvaFEvaIKx1nhE/FksKVissXYCgaBv1ASKwvgBYom2e nBTXE3QEFW3oEUsKkzDAIBarEQAOdxXusGgbcVroJZb+oS6f3igWvXgd9u3T17UH0FrRRh8ByNiw 8ESzBgJs4UVD77FYmKgX12wscXiUJcaM8RiLZY8/KIBgXMsA4WgbFjTc7Fgzy9PLpQKwnPVZet61 Y5vdMUKuQq0qfHHeDvvqyy+iPWJw/hLXQCwA68pmGaJnYIFD+duAuN3WbuZ2d3JKzmEFuZcfg4UF a6xS5Rx/6xObWXjM5hQfd3kJ55acOCOzi09Y/Jo3LG1DYMG6SEMnAFjnW/E+2WtF8Sj+nkxi/Cj5 jDahef4w/pnHAgq+zXPRhmiuwfC2A8oAlVW1RXMlht+XdsQSm8Y16I+6+Yy1nygby7N6zraKrJfh 7XYv5UrUDWiPdQzQXm+h82Otor6iLHpBYtFLVfU79dJ2nhOJJU6Oa2j3uaxdlwrAop08z1tvHLek wjX2Dx2L7I9allj8xuh/PKpS30Hd310DsQAsXIMArMMnP7TNB9+xrYeRd22bZOuhd63F1C1Wd+xG 7b9nPRbushs6FJcbg3VDpxXWc9Fe6zB3t13Rerld12GVVVMMVrVOa9wKwuslV7ZbY8+N2WHJ6yOT PQcWrO/e2zHVEACsmNRUVogJHIuT56wq7xMrB3FJfFZUzvNWUQ5Xi+dvqugayvBP3XNpRauf87G0 w9dD/ZVpO+2Ipd2+/sq0xfMsxfKMXpex6iVcj7HU78vH0n7f7lj1Upm6w5/Tc5VFGy++HXzG0v5v 06ex1FvZMeD1GGufet34MXypEI2e6/3ye7k9Xzu8zzrPWybahiL7+YC1duzN6JkoKvO+CspeWA3E ArBuapdtr4xeY3f3KHR5CH/RWKIYrCub59j1bQvslk7FTq5vX1Qh0WhtEY3WENEoqwhZQfjNVYTr 7VGtItx34mNbsefdiFyEAcC6QCPj/AMs/kESLEswMK4D3D1M2qxSw9TPPmzNGRnp7l8qbgtWRiEE WbPhFsK14a0A1EO8if8X7peqs4/bAZfG3LlzBDxCgc7RNv7pwhztV1YRkxMtzoM6iWHh2VhyHkig g2AMXHpjgN8nmQEuFaLRc72LeHe9987btl2J12sMDbkKm8btsj98dTbNSbT3WHD+0tJALACrphI/ X9Ui0/jsPGerW0U4UNJ4wkYlhC504OpWsbjfCsEoLO4VMLlDNOp5sCIB1i091tsrE0utYMfbNjL9 VavRI5wHKwBYF2jknH+ABTXBo48+6mJ5yENGjAkvPAKnX1ZSWeIjyCM3T/neCO4GdBE3w/JwUoQA esg7Rl4yn7uNZelQDgC6SP3BCi1iUAiyhneqevWbtfJtVUyuBMAVYI18ZUyQpCchUDfaEnk6hJgm fw3XBRLoIBgDl9YY8KmSLnWAxfuEd9GbJ1+zpfmr5Sostj9rXWLp22PjfbtAE0Rwm0poIBaAVb19 jt3RrcByN3+zn2eIYBSAVVNB7t8VYN3RZ6NS5Gy0m7quL4fJPQBYlejW71L0/AMs4gtIRtu5cycH WjyHDYAG3hwsRWS8Zwk+5di4htVFp2SBgh+nbdu2jquIT4JoSWQLGGvdurULkGVSIwDW51urU6eO C26NJVCYFUwE8hKMTnA08S+sgovGyxMOsCDB9BMr3yu7Hz4ph1/L8fO5fym3LfJZL+W2Xspt+zZ6 vFDj79u0LfK3VNm2Xk4AiwmZsINjB/daq9lyFSoZ9DXD1iuvXMUUKd/ljR9cW3UaiAVgwYM1KiXk qYHHf/ex922echJmb3rd3vnwM2szY6td367oOwOs2wWw7ugrqxWiZM939gtPlRMArKobBV+r+fwD LADL40884Vb/YLliGT9LqFn+DaEmG8HR48aNcyu52HAJNmvWzAXW4krEwsUKKKxWcP4AsKZp9RH7 1M+KKAASGyAJq1nLli3d8WgbbWE1G7xDnggS0BWNiNMDLCYAKAz8i5/l9XAG+QTHkfuURQ+cR/y+ vx5QSJ2c45N9zoXvl3feJwamPl837Yjcpz2+Pr4jvq2UDW97eFu5hrbgzvXlfVv9xFlR27ku/FnQ QbjeuG94W8L3uZ9va3jbqcPrLda2RuoxvO2+btrq20b58Lay7/Ua3pZz9bnvY3/e73OP8D73eo3s c6/38D4P15tvW6x97vUarrfK9rlvu2/rucZrND3S9vA+Dx+PXs+07Vx6juxz9iPHp6/ncrBg8U7B Vfju22/ZBoVBVBsgV2GjIuuQvEezb+AqjPYuv9TOxwKwCHJfVHLYSMbccfZWu7N7sfIP5tpvmuUo bc5hG5O23+UjjMWCdWsPxWEpRU6tnt+MwQoA1iUxOs4/wALsPCfL1IIy/iJcglibcBcS98QG6SEg x1u3cBN6LiXisnArwhHFyxbrFqAItyCxXFit6tata1PF8s15gmHhKYK6AHdhtA1LFRQALL1nuT7X DxgwwFErRFuGD7iDyoCl5oAHAt6pi/vznechHowy7DMB0G4oG9ALE8zIkSOdtYzzTCTohSX9XAtL OK5PQCbn+eS5OM4+YJXz/EtnH5JK6qNe9gGdxLJxX/ahfmDpOt8RmNqheqAt3A+mdPTu2wropW/Y Z+KC9sCnq+Ge3BuuIc7TZ7QNly379Av7cC+xjwUSQMxkzL2gosBySZ9xHnevtzqyD9jFyklZZNas mTq22JVF15TlGvaZmKmLOr0eaStcWOzTBtpCm9injewzFqmbZwjXI8+IHnlmyqMDXNzch310RJ9z LbpDh+gyvM/RtdcjfUBflNfn6JGxRp9Tnr6lbeX1OfejzxkjAAfKM3Z8n1M/YyuyzxmDXBve516P PAfj3usxss/pM8g9qdv3OS586ovsc37P6LG8Pqd+3+fokfrC+5x9+pw/Xr7P+c4xzvk+548Q+5F9 zrhCL+F97scn5S8XgMX7Clfh6RNHbV72avubdsX2V+2WW17pyWivsuD8JaaBWADW1S31e83Ya2++ 96nd3rXQrhO4qtYmz9rP2mZvf/CZjUzZp/Q40QHWbQpyv6vPWrt/wAa7RSCLhM+3CWjd3nuDAa4C gHVJDI7zD7AASCz1x7LkV/LwAglf/k8sU/jS68gVP+yH51rjX56nJqAu6ma1kD9G8Hms1AVcD5s0 ExPX8CLHWsakEy0lBwH6WNQgy2QyBtgw4QF0+M4x4ruYoNhnEmCiXaX4MIAF+0wyTPCcZwIDTMKd xD4TFZM5QIB9PtnnOPtMwrST69inHuoDqFE/Vjjux304TztoD98RJjzaS1n2ARIsGPBtRSdM6OxT p881SHnAa1JykgMrnGdBQnhbsUKy74OMWbzAs3mLEJM0kyX1cj0TY7geib8jD6JvK9855vUKESrX +LZSF3WG65F7sk8baAtt8npEb7SZfZ6BfZ6JfYBYeFsBP9Tv9QgAQ1eURRfoEF36tkX2OW2lL7w1 Ji0t9Wt9zr3pS673fQ54oXx5fU7bwvucfqFtlEcnFfU5Y5P2+rai88g+53k5T19xL/Th+5y2+vGJ /tj34xM9ltfnvq2+z31b0Qm68b8d+pffou9zvvP7iuxz/9uJ1ue+rfzBuJwAlmflP3pgt9WfVuKs WDeO3GDvfhhbvslLYioJGuHG3Ccfvmv9F2+3tsm/t47JH9rTo3fabQpor94+y27pkGPVJTU65lmO XIJzCw/bje3y7MoWORa34ph98vmX9vKYDXZTh+guwmodV9igxAP29ocyQKw4YV0X7LUHBm6yG0TP UL2b4q4U5E4MVuAivKgD8/wDrIv6OFV8c4AdIAxLFy99xC8/D9/nH7Tfpyz/5v3kDDCkDu+6YRk6 IM/vc9677vhk37sdKUd5v089nPf34j7hbaMdtC+yrb4tlI1sq28b11D319qmGDnfNtpAWypqa3jb vk1by9Ojf5ZwPZbb1gg9huuNNofv84yRbY3Uo99Hd5dKn9OWWPs8fDxG06tnxI/s4+/S57G2Ndbf Tnl9Tp9ynLF2OQGss67C07Z6/Ub7bT+l0RHI6pGORf6rKn6rBdWfLw3EArBqdsqV1SrbqkmeHrJK aXMK7Mb2+XZv7+Vidl9jNwpc3dY1epD7zV1WKg/hdluz9x179+NQupvX3/3UCra/Ze3m7nOJnu/s t8kFudfqvcnuCovBur9XEIN1vvo8Sj0BwKqMovmn6UlBz/UZXl84iWhkeT8BhE8EsdZdmXaEE5jG Wj/PUG7bvwgRokaSosZa77dtS7T6Y2kPltXy2l5RH32XZ/XjoLy2n6st5+pXXz58rMTS7srouzyi W46FtzV831udY71HuD4q0s25SHejjYFIQBX5u76UiEbP9c755JNP7dTxV21a+kr7izZF9jcdFRt6 IHqOx8q8w4KyVaeBMwBr0bktWDe1z7YnBi23SUr4DEXDzQJX9/VepgTQB6zZ5M12M9arGGkabi3j wXp82GYbmHjQ4laftFPvfeYe8P3ff2HrD7zvKBpeHFdqtfoQ6L7R7um72gKAVXVjIKLmAGCdb1Wz yhEXFfxcFbFh82PEUuD4cMpcnhW1hbp8AHss7lBPROn+2ciS9dZbb0V9VKw0uM14hmhM3tS/q3SX qzvaxvP5FZ7E0Xn+sYqu4xqsEbE8K/VgtcD9GO5aPlf96JE+wlVVHrCIvA7rFrFS0WL0uA5XOC4y XH+xsOKjD8riRovGFE9bsQTxnLGym/tFINH6yL2UNWbpf+qPpndWA2PRYhzjOo+Wu5Lx58cK/R8t ObRvC+0hpCCWjfFCn5an98sBYDlXofrg0N5Se3FyyFV4x4RN9tHvP4nl8YMyF1kDsQCsq7SKcLLA ld9m5h+y0Sl73e57H31uzwxbazeLsiOWIHd4sG7rsdZqdl/rYrBu6LzGHhmyxZpO3630OKfs4Bsh F3POlrfsxq4bAoB14cdHALDOp86ZiAl+hsOrb9++FU7IxIK1atXKxc9AG0HQf0UbP15WSXJNLEl7 iVcZNWqUq5JgYGJxKtqYLAmOJiifYONoqV4o26ljJ3cNE3JFG7Fi5FBkozzUGxVtgALaQPtjSSQM oCF4m+BvgrYrAk1MYsQwsVCCoPpoz0k7WQzAyla/uKGithPDxupYAq5ZSBFt4zkZK+gnWlJuABhB 6F27do2JGJd7E8sGvQmAJdrG2K1fv741aNAg6ngBzNAOwDj3YJFBRaCc8cc4ZBs9epQjGq5oo374 6dq1a+cAaLSNODEWQvDbo38jt8sBYNFm+vidN0/ZirUb7We9tapQ1A1D8/l9sag/2C5lDcQEsLSK cEbeAfv8i69cDNaB1z+wabkHbVz6fptdcESko3vs2jaFMQOsSKLRGt3XWfXu6wWo1tkdfTZZ14UH rM2cfXZb78CCdRHGTgCwzqfSCRIncJeNQOCKLBhMRkwIcH3BAUYgdbSN4GM/aUezvGBVYLUbwdSs wowGJAA9sO9jWQAwRcsDSLCyD9aPBoKYNFgdRtA594kGELF2AH5of7SkybzU4FTDsoNVB71Hcxdh neGaWCxS9AkTNosJACAAqIo2dNdRAAvATNB4tI3geQAZqxBjsez5oHbqjTYGKANZb/v27d2qzmgb ZVgRSx8BWCraGL+AJMYtbY+2gpfxxzhkPNKvH3wQHfCt1AIM9BNtY3z5VZ5Y0i63IPfI52N8vvHa ERubvML+pGWR/VPXlbbl1egW6Gh6Cs5XrQZiAVg3ts22OkqVs2zHKRd/1WrqJkta85r9tGGWjUze a2PTDsRM01ARk3toJeEmB7Zq9txod/U/y4MVuAirdhyE1R4ArPOpalZosaLMJx6uaAIEDGDNwdI0 R1YMVqVF2yBuBWABVFhxFW3DsoBlhFVj0TaoJQAPACc4xbBoVbTRbiZ7XG0Aj2gbYAxutFStUou2 4X5iRRgTMe2qaOOlhhWIFW7oFOLGaO5NgG+sxLTcmza0bNHCrbCLllIJaxp8b+gxlg0LJpYggGEs G6vsqJvy6L+iDSALh1w7gXgsk9FANnWh91iyGlCWMQIFC+M3lo1x2KdPb/cbiWVj9SPjLFp/8nuD jgQ3K0ALQuNIF+flYsFCL4zpDwVA9+/ZaU+Ol6tQaXTun7JFrsJPY1FbUOYiaSAcYLU5xyrCaq2z rMWUDfbGO5/Y0dMfuSTP78o1yOdXX/3BBifssWvaRKdpqCWahmgA61xEowHAumADJABY51PVxIrA i4UbJ16Wg4riWJioe/Xq5eKMmLgBCRVtgDWsIli7mEA80WpF1xD3RNlYLCNYc7Aa0XYsGNFicDxx LCAxFgZ9XFQ8L7FM0TYsWLj74HeK5tr0Ez1uPK4BgFQ0IXMOEIEbjLbHAjrQO6ApGo0HbcHihhsX ioJYtrlz57o+ikWHAEj44WgLwCmaVYqxOHtOaFyRbipam+ijLl26ODdbNCsgdTImGS+x/DmgPOMw 1mcllgoXIda3WMYMbkRAM25I/lhc6smeo40NQOPbp09a4cp19uMechU2KbKxxYd0WeAqjKa7i3U+ FoAF0eicQvrxm9vB1z+0xwevUQxWdJqG2r1Wi/+KhM9r7PZykj17HizchLf2El1DsIrwYgyLAGCd b60DnJgc3peLrqKNHyMBzrjicOcRd1TRxoRBeU/KGM2F5+uKJdDal6UNuNpiqZuyWDCiufvCn4m2 xDJxex40JuRYynMPQBltjwaYqBs3KHqk/ljcbD5IP5YAes+tFqteADW4tKJZxnhGdOGpM2h/tKB4 AP/7Za449IN1r6INAEcgOveIZjXy9dDuaO2IHAOx/OZo62tlpLP8PmLZvG7Ka/vlZMHiWf1v4I2j h7TabIX9cfMi+88eq6z0eGwB/7HoKyhzfjUQC8C6oW2WNZqw3uYVHbLnhq22F0assRdGrrWXRq6z B/qssBuU8DkWmoaa3VfZk8M32X39N9jNXQBaCnbvsU6CS3CDk1vlGoQH66XxpXZ738BFeH57O6ba AoAVk5qCQoEGAg1c1hq43ACWB9Tvv/eu7S7dbg+OCbkKnxTj96efh5biB9ulpQFA8Wcfv2f9RdNw LhdhzY65dlM7pcZpmm6/bJwZkiZZ9ovGWWJ0L3CJnmso4XO0VYTXdlhuE7KOWPK6k3ZPv/X24KBN 9vCQzZIt9vDQrU7uG7DZRqS9annb3lYsFlasgKbhAo+YAGBdYIUHtws0EGjgImjgcgRYqAmr4ltv vG6ZJWvt37vKVdi82GaufvUiaDC4ZTQNALA+//37FQKsGgJYN7bNsbbTNzkeLCfxu6zv4lJbtOyo LV52zK5rWyhLVrHd1m15SLqvCEmPlVZLVkzkOgGsIcmhRTRffKn7Sj7TysTffybuurJ9Viqy5W8L aBqi9V0VnQ8AVhUpNqg20ECggUtIA5crwHKuwo9/bydfPWD9l6ywHzUrsp/0WW0H3qg4pOASUv0P qilffvqhDVi845wWrGtbZVqP+dtcQPu5trV737bGk7bYLZ2XVQiwhqUctC9Vz4m3P7HjEkhGAViv vfWJnXjnUx3/1E6K3T17y5tidP8mD1bu8k3Asx9U/1zghw0A1gVWeHC7QAOBBi6CBi5XgIWqiO3B VVi6Y5vdNUJWrAZFVmfBTvvDV8Hk+F2H0ufKToGV8Ksvv/jO8uUXn9unH74tC9Y2a5vyabm5CK9s lqG8gyELZMKqYzZdHFizCg7blOyDtnznadt88F2bXXhEVq09Z92E57Bgjck4bHOKX7PqXUMxWM+P 2WZLxeZ+sziwCHK/TcHtL4zdaQlrTyk34aYIF+Ekyyxaa199/nv7Su2m7V9+WfZZts/xmES6+1Ly 6WehlD3BdkYDAcAKBkOggUAD338NXM4Ai975zLkKT1hS4Rr7e60y+1GrEovb+Nr3v+Oq+AnXbt1r 9zUcYrfX6W93vtzb7pDcWaev3fVKv5DU7R+SesgAJ3c7GVgmg+zu+shgu0fCtbc1mW5d0j+2zmm/ /0ay5+tE09Bplig3PvnCmk3aYD9rmGFXtcxxMVh1lei5zYxt9vPGOXZ9e+UkrMBFeKvchA8OklWq jwLbBa6qd1tjTwzfYuv3v6ekz5sd0ei1ndbZoKQjlisX4c0RMVg1msy22o3G2e9aTbYHW02RTLUH WyPTKpY20+3BcGk7wx5oPcNqNxxjU5bCARmscg0bsgHAquLfb1B9oIFAA5eABi53gIUKf68Vm8cP 77Mu85c52oZfDFhrx96MbYXlJdAFl1wTsAx+/NGHNnFhrv3ymdH2m5dn2pUvTbH/e2KU/eTxEfbT x0fZT58cbT9DnhoTkqfHSsbZz59Bxksm2M+fnajPSfaLZ5HJ9psXJttD/Uqsddzb9uy4XXZbpzyr 3j7LbumQYzUkNbXfeMI6lVluv2mWZVe3yrWrWyo2q12h1e62zKorVc41YnOvroD3WueIwaotHqwa ykVYUzQNtUXTAMj63cBNziW4eNVJEYtusudlvTp06hPLUqqcm7qFgtzvVS7Cu3sUWY32OXZdS927 RaaTa5CWSJYk28nVTnK+LrRVcg3SOs9d+3/PTbeGA5ba0WMn7LNPP4l55fclNyDOf4MCgHX+dRrU GGgg0MClpoHvA8CCUuTdd962bVsVnzNErkKtKmy8RAS1f/jyUlP3ZdEe9Pnhhx/Ya0cP24hp8XZD w1l2l8DH3d0EdpoutmvrzbJrJNfVm23XNZhTJnPtuobzrFrD+VatEbJAstCqNV5k1zdebNc3Wazv i+3/Z+884OwojvyPz+dwPp99Pt/ZPp//Pvsc7s44YB82BhNNzjknEYQCSCjnLJQQEgKBhEA555zj rnLOOeechXKo/+/bu7UeHm/fvJVWIIk3+5nPvpnp6a6u7un6dVV19e9e7mq3Kq+Hmy2w6yuPzgNY v83di5DNnmt0XmAN5eCOk3vtbout18SNVq/nUru15kQFHF1uTzabKT+sCUmd3BMDjV5XY7rCMky3 vtO3B97j8O5Hte6rg4nwZgGsm2tPDpqxa6tOtGurTTI0YZzXVZ+Sc7K/YY1p4bw2nDn55p01Cf8w Q2mn2jWVxtuvX+hkL9TsaDNmzrAtm3PCzaQbWuei6CTnRmQGYBWEfzic0nk4+R137WnT+e/5Rf+n ei9attNztukT65Isn8S6RtMkoyXxXn7pk5V9PusWV9dUdCfjc1y7pfM82qfi+HoufExs11T9N64P JMsr3TY/Gz4WhPZLIQ5WfuMSMep2b9tk3UdOsW+XH2dfKZ1lA+ZtKcgwlkmbywH6CXHziIu3bPF8 e+PdLnblS+3s1hoT7K462XZjhaH251J97UqBrb+dPezKEj3tjyV62R9LcvbW2cf++Gpf+9Or/exP r3H2tz/qvFL3rq80SlvijJL2anjQYF2uQKMd8wk0Cll1ui+xKh0XBQo7jFsfNFnJVhEmi+QOCLpF IGrI7J3ByX2jnN0b9V9n/1d5Rgg0SmT3G2vN0DlTPlqc2k6HezpvqjPHbqrLqXR154XzxnDOj5zz 7Aa9QwT5ayqNC+DquWofheDOK1csC5uy48+Wbgy9L0BHvHQAlguy89loHhSSYIxE3ubcsmVLOJNd ezBLAlp6gFB++zXv+TVBRImmzsfu/3lGWZy87+mj5ZMmWr5fk550fk0wS6eH//nRnh+tpHc6/F2n L9k19/KjjWdOn/PNafO6JKM1P9qoW5RPibQmu07Gp2R8TeSj5+W8pb0IcBltP8+bduQ+aRKfR3l5 LnxN5GOqNk/sj8n6QLL+5nyP1r2g/dHbPNonorx1Pu7YsTP0G669fyX7dpyWaN+Hdv9GLvZI7vmN Y9TrsIKwbli9zEq1V2wsmQp/3Wi67diXOojs+RwXL+a84SfBgXfs2G4L58+xei06BZB1S40su7vu RPtrFQGksoPtqtcAUH0Envrqdz+7qlR/nQN0DrSrSnMOsj+XHmx/fp1ziP25jMBZ7nl1MA/mAKzf SIPVVps9D5252dqMkIP76DXByb19ONfZM81m2EOK5t5+7Hp7+b05dlXF9DRYmAlvEni6VoFGr1WQ UcDT1dVnBlBVRps931D7b+Dp5npaLFGfc4Hd/MbCcN7yxmK7pQHnktxzqd3cwM9l9tf6i8LehgC7 vwRw1dGeFbgaPWa0rVq5PASczoCrT30JhQ+wiLo8a/assI1HVlZWiLDNwMc+ZOxxxsDJ/nXsMQZg YUbG3mRsi7Jo0aIQWZt32RiWd4kSzb57bChLemYcw7R/G5vvemTqBQsWhP3w0tm8l/zYhNcjbUMb W30QBZyDaN0rRF+yyNq8A+1EaicPNrhl7zne5Zrf/Oc5v9n4l2tOfnN6Gr9evXqN7q0I25PUr1/P mjZtas2aNQt7trEXG3nzjpfp+fI+99hGhD3Y+M1/rnnGby/by+cee/Y5fVFaPT1bjnheUdqpq5fp NCTWJVpnp413qAPXXjZlkR/3nA9OG/85uU96fxda/P3AxwhfPT9vm0RaufZ8+U2e1DORr1E+wUfo S8Z30pEHm2M3btw4bM/SoEEDtdtb1qhhQ5ulfRc3CPTRj+vXrx+es6VMo0aNrPnbzUMbOe+dtmif cT56myTyFT4435yP0bbOe199y/kKvfzOabOV4TfvRvsANHAv2ge8jT0dz6Jtl4w20nqfhNbE/ult 4TSwryK84aTvw1P2OGRrH+8/gRe53xf3EtsY2ml/ygN8JUbovxRMhD58U7e9e3ZpnJ1jf2iQYyqs MGC5TIV/MwtdzKDns6Yd7ShyZfv2bQFk1X9HmqyXO9htNbPsLoGsmwWyris3RGAK7VTBANbVZQWu IgDrzwJZd9WeYP/3+nD7yYuDdQ6yn7w0xH5WdJi0WyOD/9XVCjT629JjAri6vlryOFip9iK8TmY8 nNwJNDpw5k4bt3hvjg8WGz7Xmyf/rESAtSgBYC0VyEoCrmRCzAFXnezZqh/aKMnlZUuX2L59+4Kc zmiuPgOAxazzjjvuCJvLvvPOO9avX78wEy1evLg99vhjAQTNnq0Q/7ffHgZDAE6JEiXCHmvsl8bg CNjyffFIQ17sM8deYwg19p1DoPXSfn8MvOzPB8hKZ9sTBuJq1aoF0MZH9eGHH1qPHj1Cmcx+58+f bxW11xvlJB7MdEaMGBH2mlu8ZHGoC/sIsjccQoVr9n8jf7Qaffv2tVdeecWKFi1qAwcODJsGv/Ty S4EX5NOhQ4dQ92effdZefPHFUAf2yPtAe9/17t0rCJkWLd6xunXrBhqp88svv2yVKlUKwoTZQ916 dcO+dIBE8iQtAp2yoIuy4S1agM6dO1udOnWCIINeaK2hffB4hsCCzzxn7z34D+3FRCubCwOM2ayZ vfOoG4CBvMtoI2E2iaZMaGfvOIBydnZ2oJ+953h//PjxgTZo5Rl79r2qDZRJS/nsf0jZDQVQ5s2b FzZ65po+wTX0UH6rVq0CDcXFN+gDaCNwc0BpnbC/IH2oZq2aAXRDK3WFF7QHmqSsXNqgjz4EXS+r LtXVbuTFpt3wtZ4AL0Affr/00ouhPzNReLVkSStdunTod5TbokWLUJcqVSoHYEx60r7wwgv2zDPP 2FNPPWUPP/xwoJvnNarXCG1Jnag7mz3TvtBK/eFj+fLlw4QEGuFzXpur30IvvIGPpKFsvhMACX2T PvL222/b5i2bAx/hG+3FbzbyfuWVoqHvMWGgzaGFbxTgx3vkzV6TfGfwmPypN/2TvkObwBfanLLK lf1bmwMoKY/+yD6S0EofwIxA/yRvB09MmgBT8Klu3ZwyX3zxhbCRNXwtW7ZMeE7/hXd8K9DDXpJM vqAb+mnTOXPmhDqyuTn9+lLVYPmYdEwT011bN1jH4ZPtm2XG2z+WybKxS3L8bzJHwTkQorCLp4xz SxfNk7mwq/1RIOvWXJB1S9XRdl15gazS/YMZ8CqZANPRYCUCrL9UxKF9aHCCbztqjQ2btcWG6nx/ 2Cq7vdZE+6PMvtdVnhAbyT3sRVhlsl2j1YM31poeHN3RYLFVztXVZtjrHZbbiq2HAyNGL9gjwKUV hwUGWEukuVpoN9SSWVDg6pqKY+03L+aAq7Fjx9iKZUvDGJKO3C14i1wSbxS+BgtmP/nkk2EwZMB3 TRGDe2UJIA5mDE8//XQQCnRqBmQGfgAA7zN4IqAYpHnO4M9gPmXKlHDNBskIIgcFCCSEabob5qIZ YrCHDt+XjsEdsIeaE3ACaEg8eIZQQOAAmEDuLrTYYJY963xDZkAkAh1hxIkgRyghgOq/UT+UQZkI LAAZQAWAh4AARIwcOcKefOKJwCPAHgAFkIlQ4T8gAB4BHgYPGZwnELmG7wAP0nICIgG6lAeAQLOI Wa31Bx+EcskfoQRYBLghtNu2bRtorSvaEWhbBASgjXukQeNG3rTDsGFD864RiPC2pZ7TPg4kEYSU Tb1pR/hFH6EeCF+EOc+hvWfPnqEvUBeAB/yAfvKDNoQtQhpaaA9AFYAZsMZztCoAOfhOPRHYFStW DIIa2tESLly4MAhlQIBrl5qJr0NVF8A2wB0eAoKaNMnRqHwgfg0ZMsTeULkAgKpVq6gvlAz32JcR PlEGdaRc2gfwAa8oA61ti7dbhDIpH1qhh02N6QfQDcChLK7Jlzz4TZsDVLnmHbRjpOce/ZG8J0+e HOoMX2g/6Gnfvl3gK3ykHzTK1Q7xG0Dnm0fDI96hXfgNAKa+5EUbQwt8oX0AWgAueMCzRo0bhXZ8 t+W7ob/S9/l2qQttyLcCH8mPa+rdv38/+1BAnj4PzTwbOHCQQFXZMMkBcPNt0eZdu3bRd/VhKAt6 qAvfKr8Bb/ABHlN/2nTWrFmXPMACEHysFXAbVi2zoh/JVFh0nF3VfKbtO5gjVDNHwTmQ45N1PMdc uGBujk9WUTRZ2XZ3PWmyqglk4ZdVWqbBswRYfyo73O6vn2Vrth36FIGzV+21W1QWGqy4rXKurjrJ nn1nnj3QeLb9ocJk7Uc41f6v4hS7q8EcGzlvt3kc09Oq0+gFuZHcCwiw/ioT4o0RcPXrIh2Cz9X4 8eOCz5WbBQvO6S/MG4UPsDCt3XvvvUGIMbNEeKJ5QoAyGHIwa7/zzjvDgMjgWKxYsSAM0AigJWKw bSuhCaAhPwZywElYRSNQg2BnQOcAxDCQ16xZMwy86RwICQQyBxotwMX6XBMh94bKBMlAnXg4GHzs scfC4A4tCEeuEXwAQwDL448/HoQZz6kXIACBCwCERgARJhvuASRyBGH7INwAngjM1h+0tiJFng/0 IVwRhAhKhBw8cwFHGZhOeRdwh/CDzwh5gBP3aAfKgVe8x3Pqj1bnCYE4hBkaDYAXwhDARz49e/YQ n4eFevHec889F7RtpAOY0k4IYgAvghMQBchBwAKIfYNhNC20IQDUfW0QlvCNdAhv+EK7wFd4Shtg AqZuACzopc0rV65ss9U2AwcOCAAIQUseCFUEMkCG/IoUKRLopR68ixYJzSG001YAAd5zftJHaROA Ac8pF75Rt2nTp4X+y3OAFH2aPkPd4R8gElpx8oTfWVkTgtn7yaeetCECPtA5ZOiQACboq7QL/OYb ARg9//zzgV6AB/WBFvqfm5ijbQ6P0TShCaKNyQ8aqgtQ8i550C7e5nw3fEM8o78ByKCdSQttxbfH +4BrgCptQH8AoGIOpN8A5mhfwDPvQB+0Q1+r1q3CvZkyi0ILtNFf+R6hm/4JbygXAIc2EkBVReCU Nueb5l2e0e8ee/TRAMYA2fCQd7dIEwftTFLon/QheJ+jIXw6tC98ma+2pp2gk3EkelxKJkKvVxgP ZSqcOmOWXV5XpsJXxln1wSuYwqYzDGbSJOFAHsiSNWLJwnlWt0Vn++MrHaVdAmRNUoiDMXa9g6w0 fLASNVj4YLGCcN32jxWZf7EVf39WOJv2X64I7IetTo8ldoUc2+MA1hXlsu294ets/KLd9kTzufZ4 s3nWdOBahe34W78fNGunle+0wj4at8WuqaFAo2kDrCXyz1oYnOHZlgfNVfC5qtImgKs1cjHImAXT +nwKH2AhRIoXKx4AEQeaAAQWZhSAAbZawASDI8IQAIGgADQxuDPwM4tlkEY4MrBjjuF9Bvx58+cF AMIgz7v4TAEc0Gow8MYd5M8Az2DO7BjtAHlBE+8jNDBzcT8xPwcl0IGAgw6ENMIaUFBSpiPqCt3Q PHXa1FAvTECAK4Q1ph9ABAKPumHSadiwgWbg74R02VnZQWA88sjDwUSCsEH7gkBGEKEdBGiQH88Q LAAQABBp4BP8A0ggpOAz9KIxQeAhGKk7ApB3EXikpw3IB+CDpgotSblytEPTUBYmKsAAYAE60TJg 1oTvzGQQ7IAYBCB1477TBi0Iajf9IsjhF3QhyBGu0A6IpBwAEiCBdkEzCUDjd462T+8tz3mvrtoA syzgknqj+cEkBY8RztCLlgweA+YBYDynrmg8AJjwiGdPia+UQxsBjimPE20OaQBr8ArgAp9oX9oB fkLjR20/Em8GhneoG3VnogG/4Cn9+cCBg6F81wrRD6EBjVYv0QTfKQPABY2UBbiBr8MF4mgH+il1 raYyXIOzTP0PfgDkea/IC0VCnwT4eBvAY74X+ivtzXfq2k3ACvf4jqAfGhs0eCP0Afo0oAVtFxMB yqZ+tCF94Jmnn8lrc/hA/6dOgDiAGm3O+9QD2gFhPKefkIdrSu+9597Q5iuWrwjfJ/2TfspEi74D uKVc6gzt/KauAGK+j/7ScFIW79CPLmUfrOgYh5vDjs3rrfXgyfa10uPs2xUmWvaK+HEwbpz8Ij93 x3d8shbMm2313ulsfyrWyW6rPdHurj/Zbqk2ViBruJzZ5dwOyErh5J4IsAjT0GHMaiumOFg/lQ/W z4vK/0obPv/ni0OsWudF9s7gVYovNSYWYLEXYcPcvQgT22rW6gNWrfuqsOLvz1VZQTgnrCKMB1g5 Du44v9/EasFqkxWzC3DVyZ6p8qG+tdF5qwWR45kjlgOFD7AY2Jg9MvN0PwhMcT6jDNs+SDvANf89 ZsahQzkqU64BTSBk0vg12gEGE/JnRs41GiUO7qVrB0ZoIUg5mRUjRNBIABDoNNwDEABYKCN64HfF gI6gIw1CZMrUKeGa+127dQ0gCC0HAh7NB0IYYeIOuGgKABCAKwQgz7gGTL0kwPJW07eCELzvvnuD YEH4AhQQMNDILB7aKQNtAde8z3Py4xraeA5NCF20IdDI+4AFaPQ6kw4aeZc68z5gDHoRqGhnKAcN BP8R3COGjwhgGIHsCwS4RuBRNiBlmd6nbOrnDuqulaAc6gVNmD4R8AhrNBqAHQAaJlr4S36k4x3e J91KzaAC38QX6KQOgFLMiDyHZsAbJzTBc8AFz2gXgDX3qDe0YrKk3lNUtpsUKYvnTBAwKZMPfCQf 8oDn8AQzIUIdrSXgEPAAkIOeTgKZaGXxUypW7JVgauR5v359g4bOaYUe+A/dtBF8hS9Beybe9JI/ Xrbq723eR7RM0POZ4rn3x2zxiX5Bu3qboymmXeAjz2gHyqXutCX1QJtGnbjPPerK+/AOcAktpPMF DtQb3vMOWkP4NiG3zWkLTw8fyQ8+wif6Z45WtGeghTZ2Mzr3Hn7kkQAa33uvpcBrqTAxgG7alL5A 3pTrdJIn9DFp4x4LU+Af6WmzxONS1GD5eMnCojXLF9tTrWQqlMP79e/Mto+PfFKDFysKMgk+wYG8 1YWawC2YNytHk1Wss91eZ5I0WTnBOq+vCMgaVCCAlVyDNdsa91lmG3YettoK0/D7NDRYAKymg1Yr Ivwpm7fuQDgXbjho89cdtOJtltrlZeWQrtWE18vEd00Nxb9KC2AtzgVXM+wGaa7+UnGMfK462nM4 tGsSu2rF8rxQDJnukhYHCh9gpVXsRZooZznvjiCE0W4BAv0a4MY1GhWeYx5DW8Z/NDy+1Jzf3PNl 64A4rhEWCHAEKueCBfMlYDeEd3nuS+yjZSCkos/9GtrIn//k7+YhaOM6GlaAdL7Sk/s892X5/KZe lE0aD0nh6XlOGR4mIcoP0uZHm5fPex6+gDJJ7/yM0gqNibRF8+Y5+XDPee60QiP3PWwE6XhGHRL5 ui237ZyPpHU+Ujfno/OVfGizmQqyB1gCuAIaoBVzKHzjHiBm7tx5ATwCXr1PRGklb+drlI+kSdbm zjf+e3+kXM4orYl8jPZH3iV/7wPUh7rBr61bc0KLeB/w/urvkxaaE9uc595nEvmYeE3Z3ocAY/AR sAtP50tT7bTzn/Kjbe688rbkP+VywoPEYIeXKsBiKGViuH/3DsuaOtN+XivHVNho1Go9yWxbci6i hj7EJD74ZEmTVV+O71eV6GJ31Jls97wxVfGyxgtkjVA4BoVxCGEadCaEaUjUYKXywZq7On0frD9U yLY3B66xtwattd+WlXN8pSnag3CaNeq31mau2q/9B7fb480X2v2N51nNnqsFtKTFijER3lxfca9q A64m2XWVxtrl0lzdU7a9FlONE7haFsa0dBUZ58L3S+jdDMAqSGMmCxoZvZeYV6r06ZbrQRk9fXR1 VDr5p5s+cdVVYdY12fLddPOPS3cueUd5ml850XaKpjmXaMWF1WcKypu49GfTf9PtX6nyTudbKCjt XxQNlteTyd+2jWutRb+J9uXXxtm/VJ5kc9fvToe1mTQpOOCrCzEXzp87y+rJ8f1PxbvaHXWnyFw4 VZosgaxKCq8gkJUOwIquImyXsIrw1hrZ9ocyY+y6KvGrCIm6fkud6YpLNU1nzirCG2rOCBs939d4 rn00drPNXnPAFm04ZKPk5B4XpuGvCt1wk/Y1vKG6IrxXGiNw1dHueL2D9R0qh3a5ZDARyoCrAn8q GYBVYJaleMFDNYD0mZGn6pCo9TEBdunSOfiM4FOCOSe/gw6OGYkPnhk9JpxUhzuekwYTFNqIuAMz Dpo0aIs7qCuaNjQ2mHTjDsrHDwcTYzoH2g7MP+kcLIZAgwRN6QAfT4/m54R2jE91UDdMYemGAUHL Al/QwqQzIGH2w/yJCSydA80N+dPH0jnQ5uDXhaYpnQOe07fi2hTzPto46rhr187Qb1IdmPdpI7R4 6dBCGr4HTKbUOe6gLelf+fHxUtZgwRvGhYMH9tuqpYvs0ZY5sbFubzXXjorvmePcOODmQrSkC+dL k9WymzRZOSDrHu0HeWtNxasSyLq6jAKMxmiw8ouD9dOXhtrV2sT7rrpyKtcWNHFO7sTBujZsbzMt F1xNz4vSTqBR4mA9qm16MBlOXbE/ZZgGYmPdCECrBrgaHRza7yzT0QYMn6BQDIvz4lGeGxe/kG9n AFZhNjtOtqzQwySEE7z7iCUrY6NMHsQLw3/n+9//vl122WXBQTi/A78SQBgzVXxoWK2W6sAfBQds BgdWVeHLlOpA0OOMjDM2fjVxB4KPmEQ4Jrv/XKp38LPBcdlXksXlj3M4juSJfnDJ3oPfDz/0UPDd AZjFHfgT4GCNU3wyf53o+9SNNsI5Ox3whr8Qfla+KjSOFtLRZ3AQTxZ7Lfo+wBAH/Jtuuik4kCfT 3kXTA5RZCIFTflx/4T2AFX0YH0B4lOoAMNMfAT/4qjFJSEXP3n17wwpQ+M4CiGSBfKPlDZD/H+FX OPFpizvIE+d88mciknhc6gCL+p44cdL27txm4ybPsB/LR+iy4uPtvax1epIxFcb1n7jn7ke8bdvW 4JOFufDPJbvb7XWn2T0NtEWNIr/foG1xri6rMA6RSO7JVhEmi+T+gaK6j5uv+IL9lqfl5J4q0GjY Akfnn6rMsCLvLbYaMhFeVytxFaGiuGulIGbDG2sJpBHQVD5XgKvbSre1PoPHSnO1JBOKIa5jpH6e AVjnxr9Pvg2IYZUTDriAlFQCBy3UFVdcYQ8++KB96Utfsq985SuxQhBBhoMwecetmERjgNM4Pi04 aMet+vBViazmS1fLFMJbyBE7nQO6AQXQ7iEyUr0HMGD1H+/FHdDwvkAEgjgdsIfGyONEpZOe9vRF EKlAM3QC2ABkrFJMh3ba1P22AKuptF70JxYHEPICbU3cQd26de8WwBv0xx3QDoCDj76zQap3xmoR BW3pcb9SpYV2AH9TrRymH8RpyNCO4bBOf4kDnpSLsz98B0yisf0iAix4DF+3bVhjDXtl22Ulx9l/ 1JxsSzd/crFOXD/IPE/OAV9wFUKcsK3OO/hk9bA76k+3u9+YLp+sbIGs0Tkgy7fJSYjkHrcXIQDr t6XiVxGmA7D+qm1yrpOD+zXV5eQe/K+ikdwXhJWFgKsQLb5ijubqttLtrM+QsbZ8ycLgz5jZ/uac voYMwDon9iW8zGo/BCbhJ9B4pDr4SK+88soQ9+rHP/5xiAuGgE11sJILIULgxXQOVoSxsi1Z0NTE 96EHkyUCFu1R3IEmjRAACL84TQp5IYiJSM7KRN/iKL8yAExodQhbAJiIE8bkRxo0NnFAkjLhB3VF YxgHJBhUCTmCRocVdLNlLkx1AE4JnItGJx2gGl2pCbCJ4yWmQcBzOiZCeAL4AWhT3zgNHFrMLkqH Vo1VjHGHB8YlfdwBMAVgoR3jG0nHfBpWhmoVYzoHKwnpL2hhk00+vggaLPhEGx9UH1m2eIHd/XaO qfChtvNlKsxZcZ05zo0DfJ8hNIYmyAulyar3bje7+tWedmf9GXbvGzNkLpxoN1QeE7bHAWQlarB+ pyjubw9cZh+MWGl1uy8KsbCaD1yh+FWHbf7affZYk2l2laK5p2MiZNNlfLBy/K/+ZiJ0DRb7EAKy koVp4N4NvF81O2xG/Rt8rgSu+gpcrV6RE6EdcJU5zokDGYB1TuxLeBntD0va0WShNUh1YGJ5WjGE aslsVr58BXtIJi5iEKU6+Lgx4aDxSOfwLW3S8WFBuAI4AHnJTCyJ5aExwIQHkEzHpwbwiYkoziRH OQANtBccmCzT0WCkww9P41HGMVvG+ZtRN7SSIe6WTFD4eaU6AG/w0LcmigN8aGgAwYAUBu3CPDDD YTIDdKDJjDvwXyLOFbQQhiHuoD9SV/yq4g5mw4ArAC3tG+cTCN8AqUTNj2sj7zN8e/ibAYQTjy8K wKLemAp3b99qw7Km2Q+qyFRYYrx9NDk9TXNcO2ae5/i7AbKYlOL4Xl8g68+v9bY7682QuXBmDsiq AsjSBs8JGqwrywy34u/NsIcbTAx7Ef5CcbDYi7Bk6zm2c/8xKysw/H9l4wONpqPByg9gAbpurAm4 ygrgigjttwtc9R82XqsFl2ZCMRReJ88ArMLjpQX/qDgTkpfHDH7RosXBdINQmDx5SqzZj3fjNByJ 9YnTWkTTkzYdkxnvkA5H53SX7jIbcu1LHM/RvPjsKfo77r2CPCffdNqKdqKuAK10eAPdrnFjEI5r L2jAzyzOJ6kgdUtMmw5AifbLOA1jNP+4+nla+hZ15P9JAYA4DVZw2pZGkjOdPgyvvT35/UUGWPDu 8GGZCtevslrdZCosPs5+XHuKrdqW3sKIc+lrX5R3HWTh8zl/jnageLe7NFm9pMmaKZA1y26tPcmu rzzWrtHmzgFklRfY0u9flxxiXcavtd0HjtkchWVAazVb/1dtzYkD2bT/irDR8/nSYN1UZ5Y0V1ME rrRSscLIXHDV1voNHRsc2n21YLrf9Relvc+ynhmAVRDGITg9hpPH3In+95hLHisoWRq/RxoEjp/Q 4UFUuUdZvrVMNB+PBZQq78T0BUkLkEgnPXWFPtJ77KNU70E36fkfl7/zkXTR33HvpfscetPNl7TU 0euayFvaKdqOgGxvN8BB4nPSJuZBeo83lW4d0k0Hv9NtI48lVhBa0u2Pzkf/NqJ9hjyiPHSTLwA+ Xdqj7Qk/EwXEF0mDxVgSAjrv32eLFE/v5qYyFb40zp7pxKrPjNmnIGN+qrTuk8VWTvPnzLQ3Wgpk vdZHIGuW3dtodgBZN1YdlwOycgHW5SWGWGcBrGTHyi2H7NHG589EmAeuqmiVIuDq+fZ2eymBq2GK c6VAte5zVVj8yeRjhQ+wgn1aS8MxMWAOYlbJQIkJCrOAB+vE0ZgDswTO0phK3GEaMwLPfZbrm/x6 g+EA62YyBmbMT5iUfGPpuIZFE+GR5RGA5A+NfvA7mWmH/FlpxVL2wjgp1/Oh/u3bdwj+Mt3lmIxp Z4rMTfAxmq4wys3kcW7tR3vgD0doAsxpnLQZ5jJ+0z/pywQZpR0xF9PHWemGPxfvY2rMtMPKPD7C G0zs8Al/MfhIaAzGkIL0f75Pxo8vUqDR/Ma749Km7tq22fqNnWrfrShT4WsTrOesTXHDY+Z5ATiQ t7Bga04Ihzfe6xlA1l0NZts9AWRNzgFZFQBZI+z3pYZa/Z6LrGL7ufZYY23R1XSqPfXWNHv6rel2 l6LE/0n+V+nEwSqoifCm2orqXmOy8h5v14mOywFXr30Y4lytXpkT5yrj0F6Ahk8vaeEDLBxf2S8P /wn2OvNtYdhol+0viA/ly6lxdkUIEVKA7URwagXEEFYA3xtWb7G6jb3c2IcOx1vfTJZr0iOkrr32 2vD7yJH4neTJD58aB3AM5pTVTnu10clwTMZZlnISD55THsK1sE4EMT5PNWrWCHvoPfDAA2HjX/yV EMzY+RHGhVVeJp9zbzvag34+Wo7vderUDv2VkBX0Y5zz8QVC8wKYou/SluxlWLVqtfAbnzLiNmXa YnXedkmENWFPThZ9VFSYiwoVcvaThM8F6f98n0zmMgArx50AbeDmtSusSheZCouNs/9WcMxNe3LM UZmjcDjgcbKI+L54wZxgLrymdD+BrDlBk3WbIr/fWG28QNbIALT+VHaE/eH14fZ/r4/MOcuMsivL jLarysn3qrJMd5xVsuw6OaCHU/GpwqkI62y+HE7MfGk6ud+k6OzXE529spznBa5+U6S93SZw1W/I mODQjsY3zle0cDj1hcul8AEWGqxHtK8YAyYBEREiHMzu2SQY7RAAhxkqgykHHRRwwWCKgzibLbPE 3TfjrSkHY4QV9wlvwIwW8OZ77hHqAMfZdJy5GXDQdgHuQOzMklGN4jzObBntFiECkjkFnw+AhTCA hndbvhtWWeFMXbt2HWv+dnPtCde7wAImI7TPHUDF8dABFoCqV6+eiks2MPRVNCf0U+4zUWDPQQdc TA4I3cBJ4NIMwMppJyY8hJzwzZvRTGdpP8WOHTuECVYGYJ2bUMIKsH/vnuDn+ZfGMhUWHWfFtHLN zpw6t4wzb3+CAw6yiPg+b/YMqyvH92te7293NZxr9zaekwOy5Pf0FzmVA7T4z15/4dS2NNdWEvgh wGghA6ybamnrG8CZwNVfZKa8/Pl2AldtrPcgKScU5wqZmQFX560zFz7AwiT46KOPhh3umU3yYTNQ oo0BRHEAYhA0xDniQGtUrFixMOtEo8W7aL4AYsxiAR2Annr16gWzIWCK5e0cbn587bXXYsMcOBsZ xFlJxoGJEaG4YOGCPL8NwBeRuBMPhOZaCVFMnQgHBC2CkpPfnAgMQJNfk9ajqvMOAgNB7LNyzKkL Fy1UOIK3gmkpmAa14osNdwnHsFeaEC8LcyHv+zX5uAAiPzfD+nOuocdpSaQV2pxW3omjlbKggfwA ozh48p/r/GhzWuBBlG/JaIvSyu/8+JofrU4bz6HtXGiN8tn56nzkGlA+avSoYM6iXzKp6NOnbzB1 A6bolwD5J598Imgow1Ym0kai2eUaXiTjI/yk7E/wVXWJ8jFpm6/K6Y+p2tz5dr7aPLEPpNPmhFRg 5eVTTz2pb3Js+P4xFzZq1DBMoHbu3JGnNU7WP6Nt7m1GuRkN1t9GL0yFu2Uq7DV6in2r3Dj7+9ez bNC8LedNqnxRM3bHd3yy5sycphAO3e3aMgPs7ka5IKvuVLupOiBr9GcCsEJ0djRgAnB/KT8sD1z1 GTzalinOFfKMvpFxaD9vPbbwARaD3L333hsEDwcDJrGbiJpNXCYOn837thaAMPwvOBBEACiWdAO8 cpaat5UZr2kQuJhXMEESrwkhjCBluT0gbM7cT4OiRNZhuiEcAvkzYBPLiQF99KjRwUSIhgwTJpGv E1df4a9FjCjAIrTwPkCIWEPQwokPCWkcvAAMAYlcA4hYMo92zsEE1wSPbNPmg1A2JiQEy7RpUwNt H6me8IH0bB3CPQQp+ZEP75Mv18RqojwXsvimQY9v1Ivwh17aiHvUAyDrtALuoIVrBBdBGwF7DgYo G3DKu/gfEdbBwQLtwjU+MKRHewmfAQqkp07w1IUuIJY2dz4CmAlA6XzkN/fIizSk5R0XsuRFnqQH OEArZfKcfgUt0MQ1NHINzaSnDgB85yN1hI/UmfTwgP7lwAoewSvehXe0N208ffq0YBps3vztMImg j7dq9b76YnW11UzxdrD6Up0QeZ++j6aGctHu0ufJj7aFNrSYlB20mUoTbXO0q67tibY5tNC3vM15 H7q8zckfWmlz5yP1IGaUTwQS25w28zZnggQt8Is2iLY57zMJ4Tn8TtbmE6SJ8jaHVjR7aK69zQGg nPTrWrVqCpz2DuMGEzEmHHzT5JGszelX8CXa5t4/KSsDsP428rmpcOPqZVaqfVbYDPrXjWfYjv0f nzfJ8kXOGDmxceMGgaypVq2Z9i58rZ/d3Xi+3dtkriK/C2RVU3gE7feXA7TOkwZL4Op6NFeUo5hc lz/X1m599QPrNWhUiJHGxCajuTrvvbTwARYmQhdEjowBLsze/eB51Kmcho42NlowNAR+ALLcgR0T n8/A0YRRBtfpmAfJj8GdKN4IUPysACUIb7RYlLNk6ZI8Z+XEbVcoe8TIEUFoARQoF+ELkOE39xAY CD2uAT49evYIgJJyEQpdOncJcYO8DoBJBC9+X2/LLEg8LOIi4WOGAAEUIWxJj6CDVtdUIAgRSORL /pSDkzzlkh46oIffnAhf6CUt1whefNecVkANApxr8iRvwkiQHmFL2YAWnsM7hCXghWsHyQhbrhGa CHOAAdfUGcEPiOF67Lix1qtnzsIGrgEoACq/5jeAyvkKHwApXJMHecE35yNlAea5hob2HdoHmriG RmiFZq6pA3Vxfx3qSF2dVo8673yER/CKd+HF4MGDAt+mTpUfxPXXB03roEEDDT/DIkWel6n3zbDv Xt++fayutFuYD9FwAcAA0A6oyI+2jfIRLSbX3uazZs8KEwCnlTanz8ADb3MmGIlt7nz0Nnc+0ne9 zckj2ubU36O+kzem+IK0Ofznfe+ftA/5Qxv50X6+mMXbnDambwBK69Wra48//rh82hqFSQ58RbsV 7Z+p2txpZXzJAKxPCg80//v27LaZs+fY7+rL4V0BSMv2Yz/TjKmwsMWshyTZvHmTzZwxzco16mhX lR4ggDXf7msyL2yvc5Oip197vkyEbAAdNFcK91BuaABXt8ss2Fc+V8uX5qwWRMZmNFeF3fKfyq/w AdZ5J/lzLACguEGCwk1jgBBm127ScbMZ9/jt1wz4fg3QdACDgMNEiPBBq9CtW9cAgABFAIgFWmIN cPQVmQhNtFx+TT7k53m7Rs+vE2mDzjjaHAhSRiKtlA0N5I/Q5Jr/XCejLUor+Z5PWikryteC0gpt ztd0aCU92jqAIaAFIIGmasCAHJBI+WijAD+0J0CH34Bxnm3ckAO4E/mYjK9R2tJp82j/LEibQ89n 3eaUB5CDR4BY+AQwdSDmZj+nLdo/k7W5g7kMwPr0QHlMQnX31g3WYdhk+0aZcfb1Mlk2dunfJr6f 49B6yRUdYpGxbZFWF86RT1ZZgaw/vz5QIGuBQNZ8bRQ93f5aXZsrV5T5rjB9sHB8l4P8tWjHtGXP r5/7yG4t2To4tBNEFHmSidD+mXW3DMAqCKuZBYL8OemknNFrPirSuDYu8Xn02tOkmkUgJNAI8p6n pzzK4L1UtPAup89U/Hd+tFMGaciXslLR7mmdd8nSJ9LmITfIPy5vnnsdk/E52fvQfkpnNH3iu9G6 QwfvxNESbafE/PILlul559e3orxxIJDIF6c1kY/Qk24bRfkIrXF1jesDTgv/C9ofo4N6Ii35mSqi bRRHe5SPyfL7osXBStb3gqnw0EFbv3Kpvfxhjqnwj81m2t5D8auvCzJOZtLmcMBDOGwVyJolTVaZ hh3sakDWmwvt/jcX2B31BLJkxsPB/S/n7OQ+w250cFVhtF1Tdohd/izgqlWOQ/uyzMbNn0O/zACs wmQ6Zk8XjGi7UoEn0uFfgrkG596+2nNt3br8t7PwiN/Qi59a3PY0+I+5GZb/6UTn9ojl6aiOKR8N Amc6tnzMr2gj4uj29sCPIZ3I6Z4eE3I6dfT0qMk9FlqqPkDd8Fdg5pcOX8gLOuLa38skLXxJZ29B H7Sj5va4/gtAp67pREMnL/pK1HyfCiTCc189RX1THYAqeEhd46K4R3mTbpvG8TEDsHK4elLtsHe3 FhbMnG2/rpezqrD6YDbHPh3XlTLPz4IDfHeMM9u3bbXZcnxHk3VNmUF235uLckHWDDm+E0JBKwjP ZRVh9Sk58bMqaJVimSH2q2c/DJorHNpZLeh7C6Y7hp1FVTOvfJoDGYBVmL0CR2v3r8HfJtVWLJh6 XnmlmJUoUcLKlCljP//5z0M8rvwOzCg1tW8hAh+/lbh9CzFFtZQDMgf7BfqqyfzyB0Tg68NG1bwb d5AfKz/ZjDkdcNC/X38rV7Zc8G+j7nEHdWTpftxGz+SDvxLO5jiPR3338iuDMAk4tRMWA5NTqoO6 EV6EtkkHSDKQOR+T7YmXWBa+X2XLlg2rRzHxpjrQ4mBmxJ8LU1ocaGJgx+xG++O3FXcAfvBNZAEI fmipDkxxOKED5PH9gz+pBm/4QsgK+gu0p7NNEWZC/LDi6gmdmGjpL/hXJmvTDMD6W2seFejeuXm9 fTh4kv1D6XH27QrZNmXVzrjukXl+lhzIC+EAyJo13co36SwQNNjua7pYIGuhNFkz7a8EAQ0hGnJD NRQkDpbiYgWARpwt5ZsDrloFn6tVKzLg6iybrTBeywCswuCi5wEoIMSEb/acSjAAMp555pngAI1j 7/e+970AzvI7EEg44uOojdDE/yfVAWDC6RdghsCP00rgmAz4oQwASNwBPeluDE1eADJ8lfrL1wa/ pbgD4QpvcFSPO3AAx3kcwJQO2KN8gA1gJZ3o/9DtK2DjaAF4ALRZbIDTd9wxcODAkDf8p53iTMb4 Kr366qsBZMfNRtEWAtzoL+nQj4M9wBPaWTGY6gBs0kYsZoCmZGFNou8DDgFuXcR3QFycdpJvp4N2 NgA00YfjDtoUkMcCgWSboWcA1t84SL85JGC8ZsVie6b1hODwfmPL2XZYgDxznB8OOMjCJwtzYfkm XYIZ7/6mS3QuEsiaFQFZBQg0mguu/lJe4Or1QfarZ9rYLcXfk1lwlPYWBFzlxLmKGyvOT62/8Llm AFZhdgGW9zM7J9YRQiTVwSybcBNouohEf9lll8XG8WI1HEIKcJDOrB4hTHo0DHEHwAQzJQI5nfTk 5yvG4vLmORqR119/PdAeZ+JCK0JoD6L7Q09cXaEdx240QOk4cMJHFhGQN1qbuANNFOEAWH0YB2yh nRWQCPp0+AgwIG/op8/E1RV6McvG8ZA6AYLpA6xcBcjFDbKAckATWqB0wCGO54AaD7GSio/UC+0V wYLHjs2JQZfqQBNJuAb6AAA3jnYAJHH1KCOZ6TcDsD7J7bCqcPcOy5oy0/6rpkyFxcZbo1EEhT4T 1zSZ5+fAATTywfFdmqwKTbqGEAr3N11qDwhk3Vl/tt1cc6pMfXJST0eDVW2SzIrEuBoRwNXlz0hz VaKV9Rk0Uj5XizNBRM+hnQrp1QzAKiRGhmzQXGBeQyAw0Kc6WGn20ksvBxPhd77znQCwiOOT6uDj xCwTZ+7zPBCAmJ/izGCkR0uAOQbTIxq4uAPAhPBD6xanjSAveIIZLw6gkBYQBvghX8yi6Wix4uiN PgdINpUpFA1cHFABMMFzzFtoU+JoYSUiuwygCcLHLu4AiKGpa9uubVq8icsv+hytJSbfD1p/EIB/ 3EFoCQA/fEmmBUp8HzBLkNV0TKEAJkKRoBkjNlYcsG2tb4k+w3uYaNFSpjroL7QrfXfI0CGfSpoB WJ/mXvAN2rTO3uk/0f7+1XH23coTbdba3XHdJPP8HDjgG0Rv04QqOL436mRXA7LeWmoPvrXE7sgD WQrj4CDrU1vlKDxMcI4fa9eUGx4c53/1dBu7uZjC+gwcacuXLMqsFjyHNirEVzMAqxCZGYQGAgEg FOfMjdO3R/5GY4DWCxNN3JGuczb5MOsnDETc7J+0zGhJCyhLJz3hHjBXAsxwpI47oBtfqXRMeGii 3JcKU2ocL+PKTnyOYAEIobGJO6gb5juAAf/j/LDgI/kSUypOG0XZIZK/2j0dEBxHa+Jz2tG3d0rH 54m6oUnzTdfTKQ8Tazp+cvARnvtm7/T/VAft7n2F9xKD/ia+C93+baDhSzwyAOvT3KZ/HDiw31Yt XWQPt8wxFd76/lzDRytznD8OOMgiTtb0qZOsXOMuYRubB95apnOJ3fnGXPtrTWJZKVBosr0IdY9A pYCrPyu+1q+e+UDgqqX1GjDClizKCSKa2bj5/LVfAXLOAKwCMCuTNMOBDAcuUg5kAFbyhjtx4qTt 3bnNRk2aYT+qpgCkxbVn5oS1TM8u0pa+OMgG3DLJ2Lxpo0DWZGmyOgcn9QeaLRfIWmp3ALJqCWSh vQogSysNWW0YwJXCMEjr9efSA+1/n84BV937DVMQ0UVhwpYJInrB9IEMwLpgmiJDSIYDGQ6cNw5k AFZy1rrz9db1q61R72y7TKbC78txeunmfeetLTIZ53DANVnsXThz+hQ5vncNYRYeaJ4Dsu5sMNdu rp275U0AWmyxA7gaaldLc/W/T+WAq94yCy7LNQtmwNUF1bsyAOuCao4MMRkOZDhwXjhwrgALIHIp ni7oD2jF6fLF8+2et+XwLlPhQ23n54XSuBTrfaHUKWdbnSO2RebCGdJklW/sIGuFPdhsqd3VYJ7d AsgSuPqLNFxXlxsicNVPZsFWdvMr71jP/sNsqfYW3BXMgn9bLXih1O8LTkcGYJ2X0TyTaYYDGQ5c UBzIAKzUADHs/7ptsw2dMNW+X1mmwhLjrf0UAh/n7O6QOc8fD/DbZEHPxg3rc3yygiZrtN0vTRYg C03W9VXH2dUKUPrn0n2luXpfmqt35HM13JbK54qFOvg2+k4cmbY6f21VQN5mANYFJQUyxGQ4kOHA eeFAQQFWAQfSINwu5hMhH6Lhr11htbtpG50S4+zHtabYqq1E6L+463YxtAsLTOD/po0btLpwqsyF 3ey6irnmwuZL7YYqY+1PJXvb/zz5nt1ctIX1wSyY63MFuKL9LoZ6Xuo0JowbGYB1XkbzTKYZDmQ4 cEFxIF2AlR+wutQFg+/LuU+BKRfOk4N105xtdJ7ptECmwqPSYGVA1vnuA4AsNFlbg0/WVK0u7CqQ NcYebLHSbqo6xv77yXftpqLNglmQvQVZLcjq3Ay4umD7ZgZgXVBSIENMhgMZDpwXDqQCWMlAVZww RailcyI0L6YzBMLctMF6j5ps36kwzr70WpZ1nY6pUBvAX2R1uZj47rQSXoGQJBtkLpwyMUvmQmmy FJLhile6200vvWVdew+yRQvmhWDDtBXpL8Z6Xsw0p/Pd54LeDMA6L6N5JtMMBzIcuKA4kB/ASgRX yYCVD6hRoYBgS+fEt+liOakPtBJ3bv3KxVa+Q06E95/XnWJrtyoA6amc55nz/PGANkArRQy49evW 2tTJ2gGjUVe7/bU2AVwtFrgi5hshHmgHb7NMm5y/NknkbTrffS7wzQCsgkgB1LfRrUro6DgYEnuE /4nX/iz6nJmHX+f33LdC4bn/9rwLep1IG+9H6cyPNtJEafXraPn8LgitlJUqfX58jJZdENoLk7Zk fIeWRNry41u6bc77UT4lXqfTJ9LlY360R/tyqv6WSJv3F38n1XWy/uz9KcrXgn470I7pJDFY7tkA rOhMFXAVHVjTFWgIy4vtRDOyc/s2mz59hl3TaKxMhePtpa4L7fSxw3byxPGLrj4XG/+hF78qgO5a BX6ePGmSjRo9xubOmW0EeEYOXYx1ulRoTvfb13hR+ACLj5No4IsUnZoI1Tju7d69O0TCZruLMDvS NjGTJ08OHYVBbMqUKWHvNu4zMLJlB1t78C4zyunTp4c91dzezDYt7Pvn+85RHhv3MhjHHeTHQO7b u5zRNRHJPfozeTLAJ4t8TT2IXE7UberCSZRpInwTeZro3Vzzn2t+s/kv9YJG0vGfk3s85z8n73Dy zO8vX748713KDWVv2BjS8ZvyocWvyZ9r/jttPPN7/px3nQang2dR2p0WT5dIG/e9vuQBrdSZ+8lo i+ZNGqc9kdZEPjqveYdn5B3lWzK+RmnlHecj7+XxUXxyWp02bwdvY2jjd5SvXHv7UgfyJh/o9LSJ +eXX5uQbpZW+4nzlt+dDGn/mtEXbnDrG8ZE00Bul3XnpfKUu3l+dT/CEe9Fr6CJtoG9NDm2ejt+c TrPf59r7uufnfRO6Qp+kr+a2cbQ/ertQXty3Q55MghKj6CcDWPlprxiTUgEqFxQIQT8Z95KdaBou tpN6oEHZuHaldRoywb5Vbpz9Xeks6z1dAUhPXHz1udj47/Qio5A5mAvXrl0T+vU+tQvPaaOLtV4X O935fevc9/Egd4wofIAFOLn//vvtnRYtwj5oAwYMCMKnWLFiYXNjEPjUqVPtnnvuCYM0M85XX33V 3n777bAPGs/ZNob90N59992Qhn392LS4rfYbA3yRlv3eBvQfYFu0cWblypUDCEtnOxAGd/aWGz16 dMBigDX232N/NGa+gEL2PluwYMGnsBodA2DHvnTQRYdn/zP28Guh+gIiewno+X5uffr0sYoVK4b9 AAGMbAHDHnU879KlS9hzj2ekmThxYhAy1JXnbLqLYKlTp46NGjUqAEA2KaZs0nLNfnHQOmvWrMBH QCubJC9avChcs8EvedEOvDtixAirW7dueJc82UyX8tnzDb6z2bDTTv2cVuhkD0Hag7r26NEjgFI2 +q1f/43AA2j1fRLJH/5BK+AZ4AvfaLNGjRqF9p8xY0agle1z4GO/fv1C2bQ9fIQmyuIaYdu9e/dQ HtuhsJkydLNxMHWi7Pfeey+8zybO0Ep7cM17AAj4yMbK0EaZ0Ma+dbQ5/GzYqKE1btw4/Ga/QWij DvCRTZtJT77076FDh4b8EPbQTjs3bNgwtC+0MFmgbPgJH52vn2rzSTlt/laztwJvqBft1LRpU+XX INRtzuw54lnjwDc2NIY37IkYbXOuuQ9t0TbnW+H7Y79A9owEyEAr3xLfJLSzTRPtym/6wLst37V2 7dqFelMX+g485Jr61lde9GX4xobQ5AVt9AH6bhlt6A0f2RgbHrDBN2XPmTMn7EVYpkyZcA2to0aP CntN0r5c91cfaCg+0F6U3bFjx7z+CJ+glTzpj7QzfaB8hfLhGwZYMS5QVyZbcRqsKLiKmgWj4Mpn qomAygdYJoDRE4GYeOJPw5ns2YV8D5r5VpYtmGMl2owOpsJfNZhq67coUvjhQ6rTp+t6IdfnYqSN NmA/Uba74kQ5cTH2pYuR9wX9lhPHgtwxovABFhqgxx57LIAGQI9vpovQqVipUgAtpHniiSeCUGAQ q127dtj0GAHEYMZgz8bJCAM6FIKLgRwtFh2OmWx9DbSzBDAQXs8//3wQ0OyLFndQcQQtJwd5kgcC mnJgFIM3ICDxgNYBA/pb8eLFgrBjYIdOQBnXgIIOHToE4cJ9BAmgAxBE3Rj4EUQIG9IDAhDcPEe4 IkC4z+a58Gv58mUBRCAAEWgI1ddeey2kY2ZD+fCtW7du4eNDIHNNneA9m0cDElzAwU+ALgACOiqp PQASCFQAHfTxHoATgMvG1QhRNi0GgALKAKbUjTTcR9h26tQpgBaEKXyENvgHrfCSdgYozVe55EMd OaGFjasBhrwHrYAZaKP+0AmoAszRRghnykHwwjNOhD+8hQ6nFdrHjB0T2pj3ABaASWigP5JvqVKl Qr0BQJQBWKV+lEW94CP8gq/kDa3wlWvqVLJkyZCOa9qjdOnStkCAhn4IPfQBnlMP7nmb0xa+cbS3 OeATIErdabNJMglwjhs3NrQdbQK/yJ90xYsXD/VGywBNXNP2pKOvwEf4DF2UzzW8ALiwKTLtBK8A q/CEzaYBdoAcgB591jWpACCALoAHkEOf4R2ev938bZs2bVpoL+jmXUAU6ek7gFDqyrcLKOU3+QGC AHj9+vcLfBw9ZnTgI+1Kn4FXoV917hTaCr4Aqvro+4KvXFNP+i6TK/jId0df8jbPT4M1fiVhB3L2 6eR0cJXfuOFpok7IjANuxjkiLVY62oTEAfhiuD6gsXertnKZrD53ZQPtVVhsgpXqPt+OHdpnRzTZ vBjqkKHxk5OADD/Onh/paN4YFxgPwCkCaYUPsCjgoYceCqAJwMKgj8aDgZ7BmQM0/sADD4TBEo0S gyxCCDDBQMaA/ZEEo88mEeCACI4jR48EAT9EAzYHAy8zfgZ2AEI6B8IUocaBIGCARvAgNDgQVtCW eEBPgwZv2MMPPxwEH0IAUEV+Ljh5lwEYrQ0zc/ImDaCRGT78AEChGUDDQL2gBRDA7BxBRuMgPEkH EH355ZfzZviPPvpo0PgBJgEIjzzySBCQIG5ogDY0CCNHjgxCh/YA8CA8EXC0DQCEe9SdtnHaEOqo OMkb+hB00I9mAGG2evWq8Jw2QxOGwIZWhCPt9/gTjwcgQt1pC2hFAKIVQiC6uZiyATXQirBGKJIe niOoEcLcoyzSAqgBMAB36AUYAAjhPzS4xsRpBSBAo9MGCIGPL774YkgPXx9//PEA2Jw22sppgT/w lTrzUQEQoBVNDdfkz3NAJhMAJhPUlTp0Vl8FWAFEHQRQL3j9ZtPcNu/6tzYnz+XLlod+DE8AKWhj +F4olz4DbfBlkDSS3KdsyqTNAelckxaASJvDNz5yAArtgrawqdqT9qU9SA9AQ0MBOIN2ABA8g0do mgHITByeffZZe+aZZwIA495TTz0V+iN5UR+AP32VdwFyfJv8R9vnEw1AK3UAjMFbQC39kT4ELfQv 6sL4AJ8BsJwAJoDlO+/kTEQAhfQLvnfypi/wvfHdOt+ghXrxrUYPNxFGAZaDK0AU2kxAKXnyTXI6 HV0FmAHNroGkrWhnxiVOgOGlejIutmz+pj1fob59ueRI+1r5iVbrg17WvWO7S7bOl2pbZup1fr9T xgVkAmMS46/kYuEDLIQ1wozBiIOBmcEPIQgQAUB1kJB46MEHg8Bi4OUjZrBFQDDwvvLKK/amBAbv AjwY9BmEGZgR+kWKFAkDOYKXAZWB8H1pQBCecQcCmwEaAAitwzVgI2wwhwFumFkjWBFcAMHogcYI EIigIA3CDJADLWhEGJwZpBmcyROhQx0Bfzt37gjaBtJyDwFJ3cmPshFUvI/GhfcBCwgc3iFPBGMF aWEQ3tCGWaiynqP9gbdcQxNCEICC9gK+khdghDLgMc8BKwgrhDb5uskQLRK8xMwECEEYAvoQbuTR tu1HoV3pQIAJzx8hTn1Gq/0ohzyhHX4B1AAa8IoOSB35TxpoIW94yEl50AbvnA9okWj7ZjKjobkA FNEv0JLAR/gGvZRLP6Pu0Eb9o3wEQFBG4KMAKYIbQAWAoU6kh2b6BbyENurObwAVwJj/8Jj7PHct GnWkrvAA2uELYIlyANdcR9sc0xZ1DW3eM6fPkDdmRvjjtEAbdYAXgbY6tUOZtDn5eZvTH6NtThtC x1hpwCiHdi4rvtEPqbPTCi/oj4BBNHyUwSA8eNBgK1e+XKgP7c7Jb/oqQBE+wmvK6dCxQ2hbABdA roi0yW56BSChXeY+3x3mSr5lACS/qYt/S9SFOpEPfKPe8A16oY1+wDVAkueMC9BE33LADR+hn8lF OhqsqPaKd6apTbfITIofWL6nxodNX6Az+MRp3J0xOcuef39M0GL9ouYYW7BY5nJNoL9IvMjU9YvV 9wva3luFJ2ZqrEMegUs0LhU+wEJ7gwaEAdX9IHxFBGCFmSVmGteqALhI5w7qXPMM7RfaAcyJDKBu vjt+7HgQTFyjTeDwGXscuOI5ZQMeYAIACHoBDMzWOQA9PEMgU070ACAiYAAkPEf7geBFIAJ83F8H oeZaKQQmggjTFjRTNgKJWT4ze34DUNwkAzhgVowQRDhDI2YSAATP8JNBYIGUEVKUiVACHEETtFEf wAj0InQAacz8ARU8B7yRP/8pCxMe+TqY4xnXaIgQWNAK7X369A11naPVLIBR6sb7CFQEIPdcawHt gGV4RNmAIt6FZgQ6fHA+8j7mTzeRUic3S5J24MBBAjRTcmnoEwAGvKB8d/qmzaCFcgDJvXr3CrRH +Ugb0za8R30ASdSRduBd6g8vyQvaoAFwgvClf/Kfa+7znHfhO/QA1qmzmwIBIdQJHtBnnI/wOrHN ATAAIl984KDYnckBpOSBeZA2+1Sb7/hkm1NH9/mjPtDCu95noQla6VPQu1FmIMqkr0Af5QKcaA93 buc3daCfonlFy4yWivegj/5NWYBB+h5twDfANfzhGv4CkigT8OV8hS74yPtbt221Pn37BN6RDxo7 +js004/gHeVTNvTQ79yh3sEszxOPRA2WgyvXdE0RjTvVppkjCQe0EOjg7l1hVeGv6mgbneJZVnvY aiU8k2FXhgMZDkQ4wJ6QKBqQFxqzCh9gXcrcRu3HQA/oQcC6YzBAzJ2CeQ4g5D+Ag2ec7rjLe1wD YLhHWu6RJ9c0DCd58588AAOATt4jHe8CYnnONWm59nygJZE2X3rvtJOH0+K0kQZ6eJdyE2mlvCjt Tqsv14/S6rT5cnwELO+Sp4cHSMZH5xv/Se9pN2/eEupKvtDufKVM6Hda4VWUj04b95Lxkfe4nxgO gLJ4F77CF675z3W0D3ANv5w28nLaoTMZH5O1OfWBR1Haueb0sA1el3TbnLKhjbw9vIjTTp4+kSE/ 0nDtNECjX3OP39xzPvK+0+a/qS/pnB/855r7zk/P0+nxPpDIR95xPnp/9BAM0W/H+1mUb7RpnAaL 5+6CwJg1SROBLWq7cGjSlTk/yYOjmuzuXLfKWvebYF8tNd7+qXy2TVm2RbvonMjwKtNfMn2APqBj e65VjDFK42MGYBUEEPqgnCqSq+eXTrRX0kbNFHH5R2lF65eqjEQBky49lBGXN3lFV2nF0Z3oD1MQ WtJJG80/HdrPJx8LwpfENoKuuPpGaY9LWxBaEtu0oLTE9YFoXePoPpv+Fc0/GV9dgzVuRY7ZnzQe iiEALGlttwhI6oHJcTFzJvDgjCaXh6TFWr1grj3VUlqsV8bZ9S1m2qF9+xXkXcIlw7MMD77ofYAQ UAJYQ2RtyA23kwFYBQFY6aTF9sosPe5ggEfbgckTMyW/Pa5XsncRlq5hwoSDA3eqg/w9/lWiL1l+ 77n2CsETd6DNW50bCysuLc/RQuA3k2h2ze/dXBt2OlmHNOQPX9IJ1YGGg7q6D1+qQsjPNSl8NHH5 Y7b2eGdxxJ86dTJPC0RbxbUTbUo9Mcf56txUZWA699hfyUBH4rvwHI0QfZFy4g54SF2ZrSWGRUh8 l77tWtp0aCkIH70s19YloyURYAHiPAo2hq6JMlMHgEXfV9/OnJ/mwUmFZtijbXQmZk2yX9QSyFLo hibDl0l7IVeNDM8yPPii9wGNHQCsgXLjYIyW60kGYMUJkYI+x1cG52FW78UJP5axL1mas8IKJ+VU oAnQg8MvvjA4K/uKx/zKwJeGUAMvFy0aHLnjhBogAn8ZHLbxCYs78MvCcRo/HnxlUh2AB5zTWbxQ Q/XEty7uwEernJzB00mLnxC04wzPAoBEjVm0LPiAHxV8hOeAvlSHhy4gf5yw44AtTts4ZZMe/7NU B4AKR218vmhT/KviwB4LFWhP/gNwUh3UDYdw6oqfUxwIguesRKWe/E51AIBqi2ZWFLLAgz6c6mCV IHVkgUmq9vE88MGCN/iP4fMWd9Af8ePC+Z53E4+UAEuTlwCwWCQjICjnzsyZDw+O4pqwYqm902uc fUWmwn+rMtHmLhcYPy5AluFbhgdf5D6gsWMHsTHl3zpPfqDync4ArLiBu6DPcfhFwOKYHnewkm/E yBHB2RcH37gDB98XXnghOHLHHTj+4giOIzCO4nFaKbQLODlD/8KF8fnj30P6WaoDjsupDjQcgDYc yQGgaEriDlb2lc9dsZkqLcIaMOPaK4BlHJjEofy5555LGkw2sSzyB4gh7OMADe8CagASgBraNdUB CId3vloOZ+64g8UNAHOc1uNAPOEziDlFv8EBPO6gzxKSAcfxuAOgiSqcvElP/4k7WHyBw7ubcVOl B5RTT5zcPWZdqvR8S4B9FjAAivMFWLlxsPgePJAo/SVbIG6r+nTwvVIsvMyZnAenBZQPyhdx1ZyZ 9kgLrSrUNjp3vDfLDu9VDMIjAqYZ3mV48EXtA4RnkqzrpTGIxW86MwArTigU5DkDe5UqlYO2BvAR B2qY1bPMnCX96ZgVETZomBBoccIVugFZAKx0DsADwokVaKz2ijswxxAUsqXoj9NekBfC/gMJwHTo xoxIOAT4iFYiFR8Rjmg5WFWG4IancZoaVnWiBWL1Hma0OBCERod2InhpXN4ALEJPEMohTsuIiQqt G6EpXnvt1RA6I+5A+0aoArQ6xBVLdaAhI5wFoSdYURp3MCg4OATgxB20JWEe0jEnkhdaMQAWqzeT 7ZQQLW/D+g0hdAV8jNMy8h59sJvaFbCaahXhuASARR1OCkRna4XtVpmY1SFMatPMmYIHJ/fus71r V9vY0RPsR1W1V2GJCfbuSJkKj8htQd9fhn+Z/vOF7AMaO3bKvaK7lAOsXpcFIwOw4oRIQZ4j6NGO ILQRaskG+sT80BjxXpzgBmQQ74ol7mgj0hHGAAiCuKJBijsAA+SPhiQdTQohDwgqilYinYNQDMRA ihOs5AUo9Kj+aGCSBX2Nlon2BO0FQBXgkYqXPGumdNQRPmLSS3UAHjDHoSEDfMaBCQ9cCj8BxKnA IbRgugPY0gfwfYoDewAmQDZ8idu5AD8AYmsBlgD8cZpDApmiZYTfgNC4A03qSy+9mFYfwNQL7QBn ACihMVId06ZOC6AWPsKbOGDuscHQHCbTpiWaCN3/im/1hL6tbIWU2EqgYfxI8G/MnCl5cJRl6Ivn W+Mu2kbn1fH2g2qTbMkK9d/DGd5l+s4XtA9o7NilsbaLtPqjFYZGYWoyACtOiBTkOVoo30QaLYzH 6UqVh5sp0ikHLZNvKBmnvSA/0iNc47Q0XjZ5JjOvJKMNgQcgSMdsxvtosFhKn45PFXz0dOSfbl3R YsQ5oTtfaBvq4O2VH/8RxDh+A5SgKU7Qk6/zhDrHAWd/HpcO+khDv0IzmY7GE1pJj5YPcBWnUaV+ aL0oJw6MQQ+8o03jnPNJS9keIiIOpJLe+Qjt8DHO7AvN0JFff3SANXZFznZatKtva3Fcv7MAWOJr 8CPChJ05U/LgtHh9QGPL8mmT7c4mAlkyFT7Qepad2KXYgQcy/Mv0ny9gH5D83KXxsFOuz6uUDxmA lQ6w8TS+jYxvvpn43zfnRCAgfBBS+aX1+6RJJ51v9Onp03kHegAn6aQl/9z9k4JAS4du8nahHJee vEkf3bw0jo88J/906E+3rs5H344oLu9oW/o7qepKftDi/IzjJelJE0eHb/ZKv0qX7+RJ+nRpoX5R 2uPalPzTbVPnI+mdpsLkY7RdqUciYE0FsI7JdyIPYGF2VXtkzngenNDkZ8/KZdLCjrXvVZKpsKT2 3hy9VCZCgdgMDzM8+KL1AY21uwWw2sta0F8BteVvXPgAi5kqgygzSaKaMvNkNspgysDHcwZmN/vg LI1vBo7YvvScZfRR8xqaEpyX/cBsgM8NB7NQHMTZZiedWbfPpqOzebQBUS0PWpBkM2ZMMpSLT0jm zPAg0wcuvD7AdlqYCPMLNJqjwToTNJ2MHYxNR/V/gsafrawoxfeITeMzZywPzohHR2RC3zJ/ltVp P0oAa7z9qMYkW71cqzEPKN5YhocZHnyR+oDwzW7hmY/kl9pT7jla2FX4AAv1P8vxcd5lyTTAiWX0 OPKySTEABV8ZfGYmT5ocnF7xW2J1HKuumEG3eLtF8AfKys4KJg7S42iM3xFCjaXeOPqykgpzyV// +tew1D0d8xNmCvLjXQ6AG74ebPnB++RP2ckcawGJ3KfMzJnhQaYPXHh9gO8Ts2W6AIvJ4BH5YU3Q BG2bwFnQvBD+InPG80AT09Myn+/XJvCLNFb/taFA1isT7LmPZtnJ7dsELhQPMMPHDA++KH1AY8du VuNrIVLXnD2ACx9g4SP0wAMPBBCEJ73v8ddCgIvwBWiL2FQW5+6XXnopbyBkGTwzTwAXm8qybx6b wbK8n9VEON1yTRryxHmX5ds4H992221h77V0fJ4wJVC2x/kBmOFQzWo18kZLxW9WOiUeGYB14QnU DMjJtEm0DxQEYKG1zgNYmtxlANbZAcsTmrTuXrJQcdxG2r9WGGtfKpVlvcfLVLhP/lhfFOGaqWem rYUt9giPtFYswU7CGFIcFT7AwvT25JNPhtVraIfQXrFSCw0RAMudjN99590AsDhwTkbrRcwhNEuk Q/MFsAI48Z/VTVWrVg3pAUfkx4HWiXIIGcCqrXQO32yWtJSDNo3Vc+58y8q4ZMvaAV+AMFblQTMn 5ktOv87dg+gT18yo/bnvq8Y1ggGNGiDRo39zjQk02TXpeM57PPe95jxvyonShoN7HK1OG3kmo436 pkNrIm2+91wirX6djNYoH/ntkeg9WngqWn3/u7OllffTpfVSaXN4dTG3uTvNR9ucNuS7yFeDtZxd FnJMhA6wDmtSOEHf/DatupQvg2lVQ+YsAA/OyKXjMPtezppqlT8YrrAN4+2XdSbbpuXrzHZneJnp T1+QPiB8sEfjTyspk9oJi0iRU/gACz+qW2+9NWiJOFi2TjRplpV7pGq0Q82avZUHYgAzxPfhwAG2 jZbDu0kQjRPPMNux7BzfrMceeyws5WeARUAAwtCAoTGLO8if4IhE/MYnrI+W6gOoAFn4b6ClQvsG gEvUiHGNGZM4VL7pLcvsAXy+MS91xB+M6/Ub1odYS4QOQCgDQtCWUX+uEQYAR+pPesyn0Mbyd67R 1HG9bPmycE066u3AjnzIj3zJj3IoDwFDeugYIGc7p40gn9Dr4IV6ADADrXqHcAHwkGtAHnkTzsCB DmUTjJJr2gJAC7jlmnbp2LFD4CHXmHOpG3XkGuAMT31DaDSUhElwPhJ7C22i0wrd3PPNm0nLO1yT B3mRJ+kpg/5GBG+uoQG+QRPX0Mg1oQG4pg7OR6eVulJnrumz8ML5CI/69u0bnlE+PISX0TaP8pE2 yMpK3ua0HWXHtrn6grc5fIy2OdrcxDaHj97m9MFkbU4a6jFGS4h5DgimntTX2xw+0uYOdhPbHD5+ ss075rU5/O/U+W9tjjY6sc3hTX5tTvtH25y0iW1Onvm1OXyibbdoY/CzAliEjmCbKwGGzFkwHpzW WLxf3908xYq7uq5MhcUmWPEOs+z0NoWIAaxleJrhwaXeBzR27NH4/p5iLLZRPD6NnYUPsAAhAISo DxODdfQarRaO7H4wk4yCmUPSSkVj2QB6GFQ5+I3gRAvFb7RelIcwTOcgHduBAKIACWiliAQOGEH7 Rpwm4gwRQDMxfhTmT8AcA7kLW0AKwt9BC8KPNAEICGABQkaOGhnyQigC5AAxzhPMkS7QoAcwCQ08 p574h3Gfa9KRHl5yTT7kR77kTx0oz0EMIAAB5xoXBBa0kpZ71ANw6KCFII2K3ZEHBskbEJNHq2ib JZDniw7gIyCQa9oDWgGJXAP+0Ao6MAD8EYvJNYCAWmh1TRagAF+8wMdNG61b927Wv1//QCtpEOy8 w7VHkXfgShkEvERTyvsALGiBJq7hJ7QCDLh2QO98pI7UFYDFc3gAL5yP8Ahe8Yzy4SG8jLY5vHY+ Ui8AV7ptDm3RNqcPJLa585E2Jx5XYps7aKHv0Qe9f0InfdRpdfO400rfj7Y5bQaIgXb4Ay0AJ9ID UOFrtM3pj/Cb5/Cf9wG8Dvhpc/hIft7mTpu3uYNB2p97Tit8zK/NKYOyom0OLbRtPMA6/SkNVhYa LBbSYOrRJDFzFpwHxzVG71owRw6+w+2fy421vy+dZQPGi6e7C55Xhv8Znl10fUBjx14AFj7mGvc0 fhU+wEoH5HyeaaLLt5PFHkr13E2EPrtH6LlwiJoMoyZBBwhRE2HU7OabFLtJkOuoiTBcr84xGSJU o6Ys8uE6PxOhC11/ng6tCEM3uSSa3dKh1c1syWiNmitd6EZpi/LVhWzU9Oq0uckwPz66ufNTfMw1 vSbS5mAlaiKM0no2fEw0Zxa0zdPlY6Kp9WxovZTaPD0TYQ7AYsKEDxYmwgCw2IJKi2qkGs+cZ8GD MwLRh9j8e9pEK9VymF1WfLz9pv4k27Fc8cW2Z3ia6VeXeB/Q2LFXk9L3pLx5XxN2BUj+4gGscwF3 aLgYlFOdLP32wTsurfuBoMHz36ne8aXl6aT1PKMBFePocdp5Ny6t558OLeRFOo+eHZc3zwvCR8+/ ILSkW1evZ0HSR6OEp6prYt4e+DKuD6TLx4K2EeV7PQtKS1yfidKSTvuHCOsKAJpum3of8Dokfud5 cbCCD9bfAFaIKyat+wSZo7dJGxvMWZq0ZM6z48EpabH2LVlkM4aPsN/XyjEVlu+sbZq2yAKx9ezy zLRFhm8XRR/Q2LFX1rmWsoC9J+26dpXIAKxzAVzJ3sX3I52o3LwbjTqeTgRyAB4mUYQP/+MOF05x UbA9H/KMi/btaaljomk3FT0nJSyPCjilQzf5QHO6dDsv041Yj+B2PsbVl3qSnnTkH9e2PHcAEdc+ TreD4HR4Q1pAQRzd5A0tAI50IuGT3tvfgXwc/c5DaIo7vL/ERcKP9q+C8NF5mV+fSQtgySQfzBJs WZQ5z5oHx9astZ2zplunrkPsG6+Ps6+VzbLR2TIVbs3wNdOvLuE+oLFjr1xk3lUIqQzAipMIZ/kc PyhidMUJS4QHoSbcsZrfOPTndyDE8BPC/4cNeT3Qan7pMXtVrlw5xB9LZ69DgrTi8Ny8efPgBB13 4I9D2AwWC3gojvzeIZZZnTp1rHSpUmGT5XSAEH5BbPSbjvAm9Ac+U/jO4X+UCpjRLvgdOR/j9sRj IQV1xJcNelK1EfXHXwm+4BOGH1WqAx9C+EK4ERZx8D/VATghhhtp8SGMC6xL32IFLn5U6ewvyQIO fN1oI8KjpDoAYb5RNf0xbvsbVvuy0IX+lU6b4qzOqmH8zfCxjDswKdMHyD9Zm6YEWKwiRIN1IQEs fE4Be2zZg+M9gI97FwHwOyM6DxHwNXucvdJiqEyFE+yPDSfb/hWrpMmKEbDUkb1TWc3JeIg2Ea0i fMBv9yLhwVm1E3XDNOttDh/wCeSa+94fuHcp8oE6eX1pa/o9fYC6R/vFhdoPcgFWywzAihuuz/45 gps4X/gJpTp8o1+clolEj0CLA2UAg7Jly4ZVX3EaL0APAhAHalbIxWk8cFTGaRggAT1xB/V7L9cB GrpSHYA9hDwO0gjMuE2KyYvVbqwMjUbwT1YGYIr64dDuuwLE8RGH9ddffz3UM06jAhgEQLB5N6A2 ToMFGABI0A+oQ6qDhR0e5BZQE7cKlrIBezhzs8oyDmCxhyIbLOOAD3CK0wjiMF6iRImw2CAub4Am Duz0L+pA/4nr7zjcswIznQMHeyYd1JP34g42E6dvAbCTBQmOA1hZAljbtcl1EOhaVPG5n5qUDNWK zue0YrpmmTK2F7COoLkQaEuDhlP65vfPn2vThgyzy2uMDCCrVreZEpRrU9dB9V6p77JkkSJW7Nln bb4Wi7TXt/G8+NBGE6iTgA5AZho0XHRpVPeR+vaKPP641dXK+/VafMP/Ik88YRMkHwZq9fFzjz5q DTVx/ph9My+UvloYbaF2Pa4+01CT0+dU/46SXQ01wXr5qadsBmOGQCb9ovhzz1l/7fUXfCUBXYVR dmHlofbYK8UDAKulxmhN+DImwriBuyDPEZjVqlWzZzUw9OoZLxTQYABO0Haks8kyQIIYYSxdjzsA GTj8IuQBY3HAAA0DaRFSyYKsJpbHKlA0DICyuPTQgrDvJuGXbJ+4xLwBPTVr1gx89HAf+dWXvNHs RTUocXVFYMPHdDR15M+OBGia0tGkAPLIG+0hWpU4LRBgiTAmvDNLoS3iDvoKAJ4VpnEgG1Ni7Tq1 A5hklWLcQZ4eTy4uaC88pi19xWIcqKVs+i1AGId/tGupDsK9ALCpKwA97mBRAt+H/B5Cv0880gJY oi1oT1iR/HmfGqzXqj1+d/nl1kKa01M+a/+86SpA+cdWrrId0ydbmw6D7Culx9s3y2fblEnyc9sE fwVik+Wlb+Zjnc8rluI9d9xh+wUqxwtk//aXv7QpWs2bBzILQMfn3pbp0qo236iVrH/8/e+tmSZ0 J7TC/W2NO3+84oqwjdNyjQ+/+sUvrIsmq6fpDwCDdPO+0NOpLsRT6ywt9M9/+lNbIktAc/Hgyt/+ 1rbmLj7ZpTGsnGJnLpR144LsBxo79qr9HGBJtmcAVtzAXZDngAEABwIE8BFnfkJIodlBexEnoHjO jB4tA8vXMaHEHWguEJjsCxl3oIHABAZYYWl83AHYAAARuyidAxPVy/o4CNERd2CqRCsCQAGwxgEb luZjBoX/bK+UCmDxDFMi2iveQeCnOgC+aLBoS7Q1AMVUB1oo8sdUiMBP1a5olIgzRfvD+zgtEIAK TRq8qVu3bthGKtVBfqQDXGE+i/PFIkQCmi60QbRBHFAFyBAsmHAZcQcmcYAq9aQO8CfVQT/HDOqx 3+I0sIA3TKdMEJKByViAJfPsdvWjoB3R9/u5nwhEmUgevvtuG9+zZ47JDKB5IdCWJg2nRe+hxYts zdiR9vSbQ6TFyrIbmky2A8uk7dyQD4+poyZ7TfXNldfWarIn20ZpFu+58UbbQxgNtDZpln/RpaPN 1c5PaCeUoRoX9AHacGnbH7///sCTkxqL7r75ZpsjbWswpV1k/SFle1AXjWfzNPbcrram76+TBu+W a6+1rcg61XeDZEgXabYCuLoQ+4DGjr2Si+9qHHpXcj0DsOKkQgGfewBGXgMARWN95ZeVB0uNKwpB jYYBoZruO/gAISzRlMUdaI0APwCOdHxkMPMBUuJMoV4uWojx48enpakDzBBugIM6+ybgqeoACEPI xgEgQA3mU/LkjPMdQguEkAecACjiTGe0DbQAhjApnjx1MiXryQ/tIfyMM+HRLmySDqABRMSlJ0/S Y+YEbAFyUh1o3+gDpMPMFgew4B9tmkxjlFgONACyoR3wFOeHR960E7TAx7g+CQ9Jn59JOS2ABejD 7MBg/3mfaotTAhP3axuwUQhbF6ifN10FLP+k+tGe2TNtYv9B9rOqWlUokNWohzS16+VCkV9eGq8w g5XW7h4KkGhrFFPvjuuus20AYDSMBaThokkPwFK/f0SgegBuF/reB2liBMim/Y8IVNx+ww02TROh 4Jd2qfFBGqyZmtzfLFB1RHU7KX7cq32Gh9H/1Q+y5HYxEL4AsC7EurOCVmNQS+2b/K4sExmAFYc6 Ms8zHMhw4JLgQNoAC2CP+fLzPiVM8wCWtBjB5+Tzpuksyz+iid72yVnW/MOB9velxtt3K2bbrMky Wa/Ph8+aGASAVbSoaWZjawTI8wAWGsazpOOCfw+tjAMs+TdqlmaDBCg+BbBkMg0O/5caH1R3B1jE U0ObV+Hll62u9ibW0mnrJgvCXPyxAFgXYt01duzTxDcDsC4JkZGpRIYDGQ6ky4EMwPr8QONpCcuD C+bbypHD7dHGOabC25pNtsM47q9NQlcGYNmALzjAOogrifpBN5naHr3zTjsmjVUrLdjZxkIUtMwX KMDaK4CVMRGmOypn0mU4kOHAJcGBtACWTJjBt4PZ8+d9SoCckrYmmAjlFxc0FqloWiO616F9k3nz 86Y9SfknZaLeM32qje3Vz/5fZZkKS2Zby97i91oJ0sT0Moc11OKG0tJe4Hu0Rr44d8hstI1FIGgY L8D6FQpNgAaZhYOJUL6wsqPbIPkUPnzXXcEkeETPb7/+eptGCBW0OJcaH1T3mfIvu/kvf7GDcgtA m7dYDu23yzw8Q3XuohA1JzENwqcLse4aO/bJNSijwbokREamEhkOZDiQLgcuRoB1WgDrgdtvt9Ep AdZKgZT1dnrFcju5eJ6d0bZaOSBL9y8kISRfrCPyTdyWNcYatepvf/fqePth1WxbMlXBXdcmAFoB rEYCWK9jIhTAWpsLsLYDsPBTupDqVZi05AKsRwWwBgpYAbAGS5P1SC7AOqrnd8gHa/olDLBmCWDh 2H4IgKW2PiFN1iNaTVqjZEkbrUVDwQdPfemC7AMZgJXucJxJl+FAhgOXEgfSAljTp+c4zzKAf96n BDfL1u8XwBqFYMGpGbNJIl1rN9iJ2ZNsZ5sytrnxY7btnZfsxNxpAXR97nVIoPW0tFgH586x5cMH 2z1vyFRYLMseeWeynVi65G+05pqGiIH0Ok7uWuSwXsDqTmkxdrGaDICVjA+fd3sVRvmANfnaocEa LOd2nNyHKOxIAFjyRzom0xgarJna0D1osC41PqhOsxTk+q/SYB1yE6C0WDW0Ev6XP/mJrdUK7WAe LAxen488NHZkNFiXktTI1CXDgQwH0uLARQewJEiGK+zIT/7f/7Niigl1iBAFieBv1Wo7I83Vnk41 7ePR3e3U4gW2u3MtOzJeJqR1CKIkgOx8CJZ08xQgOCG/qz3TJtuw7v3sexXG2GWlsqx9f2mmVit0 A/kIQK2fPNluuvrqEP9pqVadvi/fm5/+6Ef2vgL4EsA0aC/SLfNiSqc2H6PwKL9UHKjiCrCJxq7E 008HcDFJju0DFVbmxz/8oVUqVsyOAq4AIRdT/VLRqhXaJ/S8kjRVP/je96wz4RgwB2uS0V+hj669 8ko7muwbuJDqnwFYaY3FmUQZDmQ4cIlxIA5gZWt10naFA1DMCVNMi8//FB1rFXYEc9BsCdcjbESN MInStnqdHZs62vb1elPgS8JoNQE8twTQdUHUIR8+HlHolS3jRlqdlv3tslcn2I+rZduKqXJeXiWz kEDjHgGL6Qp6jN/NdpkHl2npPnxYrFhlpwEWnBdCGxU2DWrz9Qp7Qt3nSku1V3zgP3XfKO3NGvkj 8Zt7xxXK5lP9obDp+SzzU5ueVJ3mKq4idVxOLMZc8+thOY5vFui+4Ntc7bdPYY4yPliXmPDIVCfD gQwHUnPgogNY+KCgrcHnxM0iiQJvzXo7OmGgHRjwXgBWp+ZMs+3vFrNjk0dJuyGwtVx5fJZCMs2y TkuLtX/mDFsyaIDdVJe9CrPt6ZaT7fRS7TkJzQhW33MRwMvCA4+wn2YZF2K9Y2lKbHP44Hvwoa2K 9odLFWR6fWlz+MEJH7i+0Ns+F2C9l4mDdXbiiO1DCGRJZPTMmeFBpg9ceH2AQLwEWE0MkpoWwJK2 JAzmPrBf6P+lwTqaNdj2920h4bvRzqxcbbs71rJDQ+S/o2tbpjAIF2gdTixcZLsnTbB+nfrYd8qN sS+Vyrbeg7SqcKU0MxcozRm6cgFPpn2S91GNHfsUDPc97bhy3gKNEsGaAY5tTjYKjbLFBVGWt23d Zjt37QwRsRkEiTJONGcGQiJ3sw/ebnbP1kFkaCI++/YYPJ+iwc8HTaJ7z4zs20Z+bCLr76eCT+TJ VjaJEbl9SxPKIHp3sijZ5E+Ea6J/85+o1+RF1HHqyz0ilrMvGpGz/TfX7L0WveY37/KM/KgzUdHJ C74RVZvfPCdvnnnZ5EX+/Pey+e3XvE/evMf7/CZ/fvs1aaPX5E2ZvMtJ3cibk7J45ukTafX8nXbq FqWVvKDf60l+5ME195Px0enjmZdPffzay+JZlG/cJw1podnL8rp5e1G285X6cs1/b0Pnq9eV5+Tr fOTa8/d25bnz0emDtihfo9dRWqELWhPbPNrGUb56f/A25j1o82uPyu71/VSfWJ9THul4x/notJJf tM29z5HWaaWu3rf9fW9jnjkt3p+8D/AssT+uTuiPif0T3uZHG3lBk7chtCduUZQWwMIMgRmO+EwX w7lilZ2cPdV2t6tsp+dry6ftH9uhEZ0FsBTtGg0WgpBZvwvEC6xORxTTaNOoYVbp7X4K2zDBfl4z 2zZOk6lwxUXC/wuMnxdFn72UeaaxY592gzivAItB7ik56LVo0SLsnTdEG3QyWJYoUcKKaId0BsmJ Eyfaww8/HAQj28mwGW3z5s3DXmJsNfKW4l2wRx97xTF4NtHu1DxjfzS2wmCPMvJmzzy2gWG/NQBZ 3Aa1bLfRW+H235YDHZss+xYsgLc2BHbTwXYbvvdcIlAj/2ztdUf5DiCGDRsa9p5jrzeEwHAtM2U/ QurFZsLQxt5rbCkyWjvD87t+/Xo2WYM5ewVyzf5s07WCCT7xLrwbJn8D9taDFsoDZJI/v0lL/myy DK/YMJi93ciT59BCWexxx/tsbsx2L+wFx/Ug2fCpc305j1I+bQQv2DuP/NjAFyHFvnS8i6aG/7zb QLSSF+1CufCSsgDM0M1+fWxZg8CFFuiiTdmCh3ZkGxmuob2p+EaduIZvpKdd2Bpl5MiRIX/6C32q T58+oV4IdAQ2tHJCN3xjk1/qC1CHdjZFBnTDJ/oM/Qn66DPs5UhdoBV6SMvm0qShPHgDH2gL6Ibf tDFCnLrT9+BbT+0RR/7wjzx8UkE/pS7wET45X+l70Eo9oLUfvhWqC3sLjho1KtSFPg8tvA8P2RIH HkMrWxPRD+AjdYJP0EldOinaN9sz8YxryoY2eADt0EDdczaurm2DBg8KE53u3buH/RBpAwAcvIG2 AfL7gedsck19mdBAKzykvaEV+iif79m3CIJu6KDe0A0tfFu8O10Rud8UfZQDX8mX5/AFHnv/hJ/0 Zb4dyqdvkD/fA+XRxtDHM/owW/BwD77xLSXbpzMtgCX+Bv8e/FsuilNAZMVqO9j/PZkGX7G9XerZ jneL2pkpw2RSy4307eYVTCy+d53HEXKfrs+prqc01u6fNtUW9Otr19TKMRUWbz3JzshZ31hZ+DnR dUmUSz8GzGR4+NnxQDzfp3HyvAIs9rR76KGHggBCiCKUONiEtRwh73Wwv9ijjz4awAxarBo1atir 2tiTARQNFwMwgpbBHq0RQgkhwUCMUEAoM7CysS6ChU2HEchxm9miXaPMAwcOBEEGKNil/BBeCEi0 V2jfENbQnnjwPgM7G9xSNmkQwgg+hAGaNQQZdUH4ILhKv17aSpcuHX5TJr/LlHk9pEOwwhPuISCo P+AHAYaQQYCUL19e6csEgYNQLV68eHgXHiDAoKPle2FjySDIAAfky7PK2m6ifPlyecCDcsqWLRue AwL8mg2eKRdeIizZ9BewgMCjbWhD+A+t0AIPqM+QIYMDMID3tC+/AY3QgACFVupEG0LnywocSN6A YoQmmz8DjBGQ0EQd62mlEPvnIfhLlCgengHwAFsAcdoP4AA91I++AZgAAFIH7tN/2CQaUI5gp20p D8ALfdSpfIUKVkmxdgAgXFfQdZUqVWycHElbKz1tClgBLPLeiy++GOpFHdlAu7x4gTDHZAwQ5R7t Q7txPVb5UH4H9WH6LeWTH30AYMVzQDS8pezmAjXQDUiAz7QTZdGu0EA/Ix/4Sv+jHoAe2pD3aSva hXc54QNl0LYTsycGwMYkpmLFiqEN6R+0C/foY0x26BOcTAaG5QJe6IDv8BZekjfvALAAf9Sbticv 2qq4VjgBzObNnRfSkjd8Jf8x6tf+7cDTUqVKhTQAOsAqdHFS127duuV+K2UCDyiffk9fa/Jmk8BL 3iUPvh2AH7RCD22aeKQFsNT3g8aH1UoXy7lEWiqNY4eHdbJ93RrYmcmDbaWAdK0SJe3hW2+1exQ3 6bn77rMG6icD9I0tYTKlb3GfwO4xwh6g3WK1FuM0Avkzrvdx0bBrwljr1a6XfafsWPvK61k2eIjC TCyTP9ZnTEsoD0CSWK47lPszvz4b+uhfAFsA0Nm8n847rNbUtxn6crL6pJNHJk3B20f83qcx8LwC LEAI4ImBlVksAhHhgvDmHgeaoEceeSQIJDQSDJIMsAg8QI4LBt/glcEVgc4zVP8IXwQ1B6DCNQoM 7HEHgA5hjLDkQMhBF2DGNWDM9BFkiQdmQwQXtCMEoAtaMDsiaNG0VFX8lscee8x66D51Y/CnPMAc GgfSIwjRRHAPviA04EUjOcehGUMAA0ygAbAHOCEv3nviiSeCwJo8ZXIQKh8f/tgOHjoYtBPQBP8B JJSFYG4vgU5ZnJQDH/nN84FasQE9CHYELjzJ1ubQpEGjAFB85plnwobRAAHujx031hYsXJBHK3kg xAETaH+gG1oAA9CKEMRETD0ff/zxACAA2GiL4CPAyrV1tDd8RHgDeuhHnTt3sv0CxAAa3ofnpIG2 p7WEmb4CQKafAbAR9NQDbSnCHBACIEDA0z8AY3PFV/oNmw7TBmjZAAnkAS2AOfoJYJ78AADQyn9o o36AKPhIuwDmaHP6JDwCoPA+YJ02JX8mHmhhAEJozQABvdTnAZgvvPBCoHX+/AWBHqcNwAlf9+3b F/LipFz4Ur169QCC6RukB+yQL2XTZ2hT10CeOH4igFLyhn+AF9ofcApAo50A9bQjfY76AQTR1tGe 9Bu0goDO5557LtDKNe88qRACJbW0Gj7R12kjQBzlw/vWH7QO+VA+bf7YY48GcLRVLgOALMqBj/T/ 0A+6dM77VuAn4wJ5wXsmNPCVelNXABeAlrqQBxMyaOUbSjTxxwGsiWg7L0aA5aBgpRzit+22rO69 7Rf/+RO77LLLPnV++e/+zr7zrW/ZzxX64drf/94eEQB7Xd/3u+q/Wfo+T5MXGq/PULieVjt+jHZU sbFKNdWqwpJZ9ru62bZ9ujZ2XvI5AF0AZ0L9T2pcmK8xOYAWPT+kb2SpJjiBX+kCGNWTdzfpe1+u Prtak6cAbrlfmPzWNz1b3+FDN99sPaTtDaEcCjP/TF758/OzAFiAjHvvvTcIVI4ZEtRVq1UNmgkE PgCJQfRWfdyAFQZHZtc8Z/aMEHr++efznjFYYnJEiALY0G4wqCNUGOS379geBmnyQICkOhh0EaQM xG7mQGih4UBDgeBHqKKZIE98saIHgpJZMoM6QpU6MrtGIAEi3fSEYAAQUDcABEISwUzd0LwhwBE4 CArAEvkAihCICL9aAiEAEUAB4BMhDB8AgoAEhDTCkLIHS4uE0ERYAbCgA0FH2QhxNAIIUuoFuEDr A9+4Jj3AEuFIHghmhCDgBY0cdEITZhzeATzSRgAc+EN+0AkY6tCxQ3hG/qTjHnyAVsw63KMMNJsA HgACWhj4CChxPiJkuaZMwFvVqlXC+wAV6lWterUgoMmD8skPEMBJ3UeNHGX169UPZrjWrVuFtPAX IAlttC18LSZNC8DRNS9cY1pCUNPX4B0nQJE24nc5aQMR8gBgtEbwAQBAXblHXaAJ3kALwh5wDQ8D bRpUoQN6qA99Cfrh3bvvviOQ2zy0FW0OcASw0gYAa/oc/GISAl8oC34CsAA4tDf08Iw2p2+hjaQ9 6Z9ujqT/0+b0e/oQkxPajXaEdvgIz9AEQQvl9FQd6LvUk7ahT/Me124OpY/zndPm1Il6870UK14s 0AZYBGxTD3gHWKM+8ADwDu18P7QvtHNNO9B/oBUe0KbwkT4CsIVm+izfDiCM7wN6uC4wwBJd2wlk 6EIPwXcxnerTazQG/I9iKAGuvvcv/2I3/vGPdoeCNv7ul7+0Hyq20Fe/8pWkwIv03/zGN+yFBx+0 XWjuAVmfYd1PaWKxb/Ikm9mrt/2hxnC7rES2lf9Q5tpF0rAtLuR28FhKmEsBR65JknA8KvkxWv3p lC90AJxo3ANg9dQYdJR98CTfdur/++r7J3gf7R95ka/zzMvgfe5RBhpCYpupD3+o76ObJgyBz4Tf KCxeq+8SzuN2tTlt+hPFzFov2RE0ZoVVRiaf/Hkp/u8T3jmvGixACgMzwsEHud17dgfzAgfaHndy ZeBlZs+sFJMXB9cAKWaoDJTkh0DkGtMSoIf3mfG6ozr3GYTjDugBWCFEmP36O8zaEd7QhoBF2CME ESrRA4EFAKI8BnIEJkIaoIgAQ0AhVAEvCFkAJf8RktSPvBFOgEN4hNaBmTkCGAFBPREYPAcsokVC ECOU0AZwH6BGvghqwKb7k/Eu6QGaCEGuAQdNJPgw3QCQqBNgBVNm8AVSPd0PCYHVu0/vIJCpE8IO vpCOcqk7ZcE72pY2cLOka+cAbPAVLQr1RkiSFwKdsuE3AtL9wuAjghgAgMCFj7QDdSMd4Ac6eJ/n gFI0IoBUhDd1AjBQH94BdJEXdGGiXbRoYaCdvsM9v09e7h9IG9OOCHL3g4KPtAvtSbvCR2gFTNEW 0Awf0XhxD1ppcwAA75IGkMJ9+Nq9R/fQLrSbt4PzlHfgJeCuXbscbaX3J96lj9AmpCNf2ha+ADKg i3v0EeoEMIEe3ocO+gp1ghaAD98V+dDm9EX6HcCH9+Aj/Yn3KW+22p76UU94y28mIvQHfgNU6dfw b7r6F4D8w48+DHzgG+P7oC3gMxpF7vm3A/8AV7Q1tKLhok9BD21InaEVHkELtEIj75EePtLn6I/t 2rfL842Dx/Q/0p4NwNpxMQMsCfDqmiQgWG+75hpbIKBNYMZjOonNs1T9BBNhU2kXK0kD+ZLA1H0y H/7+f//Xvv3Nb+YBr+fuvz8AjWAu/AyF6XH1vZ3jRlmnD3vZN8uMs38om2WjhspUuLQQAYj6ERqz Lvoe2qv/HtPvecQY07cHjwapvxEx/i1NKg5qTBmo8Qx+bdB4tkjpAFp91efraFLwngDWcSwQyqur +t2ZiPmQMjpr3KUczHQL1RaN9M4mfWtZGlM6SJnQS9aHQgdY+jan6xv5+te+Zl/60pdCm/YEyAHu PsO2/MKWlQuw3j+fqwjjQM7F/BwTIkKPwR/BwkDOiSDjvt/jOfcQpvznBEBxAhLcMdtn7ryH4OKa 35wIHE4Elq+I413ScY2mMJo/7wJiXVPmK9sAOTzjPfKNXpOWPJ02L9vrRP68SzpoIS3l5kerl+3v kw6aqAN5+8oxrn21Gfd9pWSUj1E+k558yA8auIY25ye/yY/3KZs00B2lPcpX1+CRFpqcRi+D/15X 8o3S6ivjnI88c1opn3e59rpAY5S2aBs7n7gHf53P3ubQ5m3sfIry0VdCkp734Q/3oM2vnRbuQwvv e5vzO8pX56Pf9/7Ju/x2vnq/9P7o/PR+7f3T+eorMp12/06gLb/+Ca3R/ul1c82v0xP9duCDL4I4 K4ClyUAAFmgVLqZTNB8RKP0/gSVMgEsF7EPcKAdKaOXQYqBRYasZBK4AwceapGwUeJgjTejb0tJ+ X1qvr3/1qzZV4Dik/Qx5cEb0H9SkYMOQAfZiI5kKpcX6Y335is2YJXBQSO0hHkzURK++fAobScs7 UpPAjwR2dmvyukgT42bSgJaX9WSo0hDss4E0rn0ESqcIFHUTWJoi8A7gqiEgW1uLtqaLT83Ft3cE yGbAM3isie04TQrryfTeR5OFddIqvqs0H6icbpocjNezLprMBYBFesyOhcVnte2bqgOm4JIy+6OV fF3+yUHDBsAqrHIy+STnpb43fBszAOssUR7mTfyE8jvRgDGw+/9UaXlGfu5XFpc2mqeXEfcOeZM2 Lp0/Jy3vpJOetJ4+Xb54falLXBlnkxba4/KO8pEy4viT2Kbp5A8d6dAS7QNxdETbKEpTOnxMt7+Q l7drXL6e1nkY1weivE6HHup4tnz08C7RzzzWB0sanh0XK8CSoF4uUPWtf/xHe4J969zvJj9BiLBF 4+LACwEssN1GIACtx1sCEQGIfcaC9BSapInZNqV7T/t11RxTYfW2MhUulGmuMECW+NRZ2oXV0qZu lsa3ozThnaTJInYRAKuzfveSNuq06r5YoLOC3EaWSgt7SHR1k0aqs9KvULqtMqO2F6/elqn7Vfmw FZf/5YfS4AbgKp621+8NMvHDU6LwP3nnnVZdZvwySjtUGtkeAmuFDrAwS6p+j2pj5O9++9s2X64k P5Ov3R3aOPmML9z4jNvzs+4/n3t5GYB1lsgqzdcQOqxQxOTJ/8Rgh4nZYO5kBh8XXoL3cF53k6iX kYosBBomVkxb6R7ki0N13IGAJF+c1/lPfVMd8IG0OKFDE3WJOzAVozlJ54Dv5JsswGTi+6T1OlJG Yjy0xPTwEb5gqiZtYnylZOkx4XHGpeVd8kULE0cHaeGj08L/ZEAiWX3TMZ/7e7RTou9hfm1AOm/T uD7Mc88X/sfxhj7ims906kn+aLzoB8mOtAAW/ioAD7QKF9MpTedI+dN9SeComYR+0FikS79MYbJP h3fmyWz7dzIt4fge8kAgp5tPIaU7Kq3ajtHDrU3rnva118fZN8tl2ZQR8gtbJDrPtQy5aQCwtqqd d0lb1lEgqb3cD/BbWi5A1A5XBmmXjgJABUrGy2RdWQtQRsqs3k8aJ9JvlHl6D4s/lK6VNFfdZG7P lrZrGzHUckMiALB2sWBCY/tUmfHRmI3V/8V6d7S0ZgC13uy1h1sM/D/XevE+Wkzx7vf/8z/2B2ky DwkE/kV7OXJ9WPeDNrMwysnkkT8f1f77iCyQMRGmI7YLnsZ9qvCXwu8FAZ7qwFepaNGiwYco7sCH C98lABkOxfggpToQ2Dhn48MSJ8zIB7MPDsc4ImPSSXUgxHAYx/8H3xt8jVIdCFZ8mvCPoQ5xwAmh 7c7T+CSlErCADvItoZAQOGbjU5TqwLQEDbQNPkL4xKUCwtCKfxb+gvgTxdGOzxMx33Cax88o7sDP C+dsfO8wraU6AGP4W+Erhb8RvmWpDuqInxM+V/g/xR3UDTrwc8LnLu7ASR7e4+yOT2SqA6d9eA3w JD2mvlQH/n8sjOA7Smd1MH5itCuLZZKtAI4DWJPQYF2sAEtgCIGP9gnfn6BJKYggZPwRSJsjXyEA Vmmtzs0zERYkn0JIe0a0HJSQWjOwrz3dMMdUeFOjbK00xFR4jsBXGp7B8qFqr2+ou3wL8UlDgzVG JsFm6mvNNPa1UR+aS9w19f8Z+nZ6yszXlph3+iaG6d0u+u46aByoSogZgSXMjAul1VrCt57rNN9P 73RQGXNYLa77HVTGUvV/TLGUT35dlF+hAiwBwi2SJ/8sf7qHtICM9rz3+uvtp//xH7bTV8cWQvsU qF990cpT++/PAKw4sXH2zwEmDPDunBunwQIs4RgepwGCIjQvrCbE6Rshns47OCzj/JzOgXBl9RcO 5XEgAu0JDs44XONoHAf24AMAi3hKy3MXM8QJY8APgALHanyR8jvQpgH0PpSDKg7cyeKXRd8FrMEX wHAvzSpx2E51wGdADYCP/3F8x6mf9gd8ACriDlbH4bSNoztO3sl2EIjmAVhyx3/8jVIdaIpw7Mc5 PB1a3JEdMIZjedwBuGL1bXRXhfzeQTMG4GTFJOEx4uoJ4GelKTxJZwJCf/FVrsmAaizA0irRixlg tRKvAFj9BBpSarAAU4knGiyBsjHiNXnUkTmrQFqwQhakJ+fMtb1Z421i1x72s8ojFLoh2xp3yjUV nktZ6tMHtSCD+lXXxPaANFGr1G/Kyk8J36vJWsAzTOMxiwU26JtspPGqqtKt03g7XkBqPwGHNRkq oVAkvTWeHRUf39J1Ka1qXypwGkyuLL5Sulqa8DXR+yc0CZokAFdUgbV7CVQt1mKTcfoms1VWoWqV NH4sUN6032toIDU2PCFz4fe+8x3byDjEuHsuvMu8G8+/DMCKExnn9hyBB0BBu8CqrLgD8xoCBEHI Kqs4TRPP0QKka/Jhyf6cuXMC6EADk+pAy4SpCnCVjrkHzQLhAMqWKxs0KnEHmrT6Ap/pCHo0Ymj3 OABxrAhMdQDgBmhwYbVkHKglnxCBXG3USXnHCXqALcAKIIzmMM68SfmALMJmpEML4R9oH/gOGIqj B2BL/DPAcJwWCA0WvKSPsYowjh5McgBJgCq8jDsAYmij6GfpmPHQHkJ/HB2Uy7eEZg8wnM5Bv0KD mR/AjgVYaLDoc2jikoGQC/mefK5wpEa4DhR/g/YpGb2AZiYrPOc/TtacrPiWc3ZRBYgmj0GANJ5/ jnU+KivA9pFDrUXLnvblUuPtuxWzbO4oTIUCg+dClwDPSZ0AH1/tdlTg4VSuee+M7h8hf028Tug8 xgRMfeJMrv8S7x53Hzbd45oFBiEvgCrv5pZx3EGJ3j+s3+T9iRV251KPxHfVfqM0ftB+DQTsZC8P YTe++Q//YKuwMLg5sjDLzOT1yb4IuNaK6VbScL6j71Dj+d7LNHjFOun44DRh1b50xrovbBqW2iOE EU5osuKEMeYvTEm8w/L0OMGDSYiglLwXd6BlIoYRghhzXpymJi6/6HNAACYZBDHAKc6kiMkPOtCK oN1ZuTInJEd+ByZITFWYK9PR8AFQia2E8E7noF0wJwGC4g7X7AFQAc+JoTsS3ydv2hPTaZyJmHfR RkE79Y0DwWj0yJd+RpiEuDZFa0SYhQ9afxBiZsULT3qDAAD/9ElEQVT1LzRFmENpI0InxB2YEtGQ Ei4izjRLXmiwiObPisC4A60o8cDSAXrkRRgQNFgeDiYx/1iAhQbrYgVY7Hyh/oxwDb49UYDlQl9A 6oA0K5OldRyuyd8k/Z8vE9giAe8s/UaLw+qznyp20hZ39v8cBehp0X1IwZRX9u9jD9cfELbRuaNJ VghKaguSaOEKQquv3PN33Pnb/aG4TvY7eo88EtNEaXBwFS0j+k5B6E0nrdq8uyaN9AEc8DX7shcF mL+hkA0rFdIlACzvC+nkl0lTcCCfAVhxw/q5PUcLxCwdzRT/4wQaGghAEwIzP+fcKEX4r2Da8j0U U1GLoEdTg9DE/BRHS0FrTv5o1NIBEWg3MPOhGUP7BviLO/ABAiAilOO0OpjtAG+pTImJ5cHLOADM O9SPkAG0Kf/j6gtPfEPqdLQ69AE0gJjE4g7ydlroX3FbQ5Ef4HPZ8mXBxBx3kL+HPYhLy3NoJn+P oB/3DlopQGE6Dv2AQ/p6foApsSzM7fT1/BZ1xAGsyQ6wXBOBMLpYTn1brIDL88ECYDntCEppN8YL wN969dVhhdlX//7vw////Pd/t/+Sjw5aDo/8/r5MjUGrdQHU/aRA/p7xY21sx272o4oj7bJXs61F Z/kGLhT4vwDou6BoIF6hJoC0Y39N1gFYLwhg/YMDLKwAWBoyfDt/PNDYsV8+wBkNVpwkyOc5AtlX WQGmEk8ABAIYTQP/k6WJ3iOdL4cHJKSbnvfi0iL0oJf8+c913DsFeU5d/Yx7z2khPbT7irJU77kQ RujH0e75p8NzLxN+p0MHeUfbNF1a0uU5dNBG6dCeSEs69MNvaEknLflDD7TE1RM+Ol8oI50+6XVN hxbSwJd0vgtoiebNu4kTiksaYLENlDSVCFectIMGywWpnmXLFP7v3/1uvlHcQ+R3+ergc8QGzHnm rs9ZGJ9R+UfY2H7YQGvQoqf93WsT7IeVs2zxGJkKF2TAQl4bA5w0+SO8Bm05VhpoTIRFZCL8x69/ 3VZjIswArPMHrPw7+SwAlsdGYsBzh2AHER7biPuubdixc0eI9Mws3pfPo+Fgpu4Hs9LoTNYDCvIc LQGmFUwJh7QnXzoHA3CcViRZPtCBVgiNUOY8vzzAjEQfISJ9htfnl9eXEn/5PqO7SPh3HAuw8MGS Y3MITYDAuphOjUejtRiE6N04VgcNFPRraf42LYz53S9+EQTvNb/9rX0gn7lBMiN+JCDWRMEwG+vs KrPwApkLwyq4C6z+p7Wa9IBiYy3t3dPurjswmAoffivLjs2SqXBePu0U9Ym6mNrxXGjVeInzPqE6 puFAr4DHxN/6V2kqN8i/NzjUn0v+l9K7aHV9S6zCrBfaeblMnFcNFiYGNntltRO+KPgLYTIhZAAn v3HmZXUYKv0JWRPCNauRfHUcPiA4FuMH4ivWcKrGDIS/DyvSOHkfIHbPPfcEn6C4mE+AKlZskRfO vG6qQpD7knryw+8HE0ziQf6+zQ/vZM4MDzJ94MLqA3yfjBEFjeQeTIQXK8ASqESoYvqrrE3Og7aC WbUmJ2/I8R9wdbu2z9lBCBPAF/440U2N/Zp3ClPgFFJeJ+R3tXvMKBvarpv9oMIou6xUtrXtLlPh fIVuiJYhMAZAxH/rMIs0WLBwgdap0Pmstq6u0BF/Lz+6OZKFaDEfuOkm+3/f/75tw7cQ8FxI7XFR 58NiA/WJGfpedhY2XwBY59tEiLr+7rvvDqvdWBnHnmgcACacVvEfYrk+gKjkqyXz/GBwxGZwJD2r hwBbrFAC+PAfJ1YckwFoaKvIz/dXu17xPgBOcT4vmDRGjRoZtGFt5OiJjwf3AFQ4A3PwjN8sJc8A rAtLeGbATKY94vrAFxJgCSwt1J6Z+FK9LLNQ0FZIoO6RZeAXP/6x/ZO2TJmrUB15psNkvjgXsPA9 I+B0ROPxNm2jU695T/liTbCfVJ1gq8bLVDhfoMppl4ADWL0i36M/Xn65TVRohQAkL+C6FQptgEjJ zooKNfE1bei9QFHcAdG3/fnP9ku1/x4WRQE24QPaG35fYJrKQuFDXDvDJ00+3pGi57v//M92pzbF 3s2kw3kT937c888CYGEGfOqpp8JqNzRMzCbZmBWNEZotd45lqfkzxOvQgbaI1UX4iqDxYvUYgAnQ RaBE4uEQcwfgxcEyeDYT9sjWrGBiiTagLZ2DJd3DNGOlPFaS4UzNKj43abK0PVlsJxy0oRVnXUxX nMTcAZTld01aeODPucaEwTXCwveI49r3W+N/smvf185NZ+Tj++SRnnKitPkecF42dEJvlFanzWlJ pI365kerO0Tz3Glz2nkvSlscrcloi/I1ysf8aPUNs52PiddOWyIfC0prsjZPbOM4vkZpg4/p0gof E9u4IG2eDh9TtbnvRRltc++PBe2fhdnm3if4f1YmQo0HOy9WDZbG17WakP6L9iF88Oabc7QVGkOG auKI9uo5afiDVgvhGickLtDnp7FmZMv/qlcPu7nWIJkKJ9pz72TbmdnSVDnNGoc+ynX0pt5XyyS6 n4kyCxcu0HoVCl0ABwGq1yV38blaprApZwQa/iSQ+QdFcsePzbeRQbu3SYFRP4YvXzSzoerLisp/ /9d/zfNHfE8rj8Om24XRP3IBVuvzGaaB1Tx//etfQ/wiwBYABmBUX9sDcI+DlUQs8R47JicQI4EK 0UhxAGIIXol5kVhIrLIirhRRtNFuYSZ8QhtZAthYCYZwIgAnMZmGsRw1xYHZgOXqgDW0VzjyAv4o +yWpV/HN4h4xrNCcJa4yQzsHAES7xiCOEKVs6PTNmdHasQLON0oGrKEN4xoBT76YPrlGGBBDCCDK +2jnCDzpplD+c819nkMz6R1MkQ/5IdjIj3IozzcPZgk9/F+vZzwHtEIvv8lvpD400jit8A8e+0bB 5I1vnIMFymbVI9f4ukAb/OOaSN5cuwaBlZHw2gUegJWYT9BGeuIVERzS+QhfA625m1wDggHSTitp ecdpJS/yJD1lUBZl8hwaoAWaHOBzja8e6alDlI9z5ctBXWkf0qMhhRdOKzxKbHN46bRCN2m45h1o 9Tanbcib6OJRPtKW0TZ3PiZrc+cj76dqc55DB33QaaNvRtucekRppZ7UN9o/k7U5+UXbPMpH+ifv F7TNPV5YlI9n2+bQQJsytgCAz8ZEeNECLPXzHWr3H0pw3HLVVXaaGbn6chlFZAdoDCaula8M9BhO vql1YQiWzyiP4+qnu0ePsH4fdrN/LjfGLiudbT37KAAppkJ9Tyc1jt4qrc3XtXLuZz/6UQg7MUah ZELdMR9+RnR+5uUAsDS2lXjkkaCtXCV/wiOSDf+lkBt//dOf7DTAWrKErXRKSXb+x/e+Zzf+3//Z bBQSmIcvVb4k1kv9oEXuQoDb9J18W1Hvb7zySjtJOvz2zpUPuT5Y5xVg4deEcPQ4OoAsBFo0CCTP EIJ+sDIPsOQHII3B2g8GzEWLc7YFAVAhQCiDdDjQIzDSifYMLcQdAsBxesRyBBAaLPKiXEySALzE iNBouIj5Q5RunvF+Z9lyMV/ym3seOZtrZuiYSok0Dt0IX8AitPMcoNS4UeMAHNAsIFwBktDAc/4T lwjhyzXpAIPwjmvyIT/yJX/KIS4V5fIcWolVRd5cA3Chl9/cox5oCLlGQKJVBKC5Vg0QjMDjmjKh DTDMu7QptMF3ngN2fEsZrmkTfN0AP6QHhMBj12QhDIlb5XxE+4hWkrScxIUikKXzlbS8wzV5kBf9 gLSUAa1oMnnu29pAE9ce3wmaKY86UBfnI+AOProGBh7QP+AJ78Oj0OYqCz7DQ3jpfKTN2c7F2/w9 tUFimwPIonz04KK0OXxLbHPuUzfS0RfpK1yn0+bQ43ylb3qbc4969OuX0+bwkXoCCFO2uQRb+AYT 2tz5CL95H/57m3NN+9BO8BG+ARRTtTntTz+Ia3PXjFLWZPWzaJszznBdYIClb+eiBVgM7JoY/UKb +/5ZWhsCZJ7U2PHn3/wmgK6taOZyN/zdrbFulrZnmqcJ6sfqW3m+ORcDAMFUKLPn5sH9rHLTXjIV ZtkvamTZxglTVL8ltmbkqLBVzIOa4OPID7isp22r8pz+z1WAXqjv5wKs4ooWD8BarcnnbrXtd/7p n+zBW27JaXvGby1o8HAc/P/VT39qy/RNBk3WxdD+58J/ASi+izvki/hN8YjNvB/RlkLfQOPHNkeF wQOVgZP7eQVY6ZjoPs80mBU9PILTAbBy/y0Pa+BxnqK0ol1D0AFofOUVQjl6zW/u+XPXBvm1awqi 1wAErl0z5SvnuO9aD3eudw1NsmvKpbxUtBWUVqfNNVP50Zof7U4L2qEobYnXyfgYpTWRj8n4ei60 RflaUNrSafPC5GOU1nTafG2kv36K1lzNarL+GNfmcf0zrs2hJbE/nmubQzN5FBhgYSJkSxFmsgib i+kUzUc1af3Tr35lv/7Zz+yoaN+sCQ3movtuvDEIj9MCx+/LHPKbn//cviNTIubEG6TFmCZtfvBT ukjqe0qTpn0Txtv87t3s6uqDw16Fr7SUj9GyxZbdrm1OJPNXX7UdAhj/LIDxkBy9g/AEhFwkdSww nQAPgahXtYUPAGsN2ndNbr4uf6wX7r8/ROrfpYkyMc/oE5XkvnP9738fePXYbbfZCQ+Yeqnyh3qx QE4WG8KR3CStFWEtmsoVCR4M0IK8oMkjuPK58MABlpQgmUjuZ4HyAF2YCaMxgvgdvXYzo99LjCeU +K6n9/hMcekTy0uVPjFOVbJ3o+8nxqiKo+Vc6hpHC8+j8ZJS1dvTJqaPxtlK1mbRPOP4mJg2rg8U hJbC7APJ+JQuH+FXQWlJN73T9VnwsaBxsA4pjtcUNFgXK8ASeGCT5Ds1O//JD35gBwQuiNiO8Kih PfE0S7MmWmAU1V74b5zgl6vuQZN1rgLmXIRTAd49Lm3d7pHDrPsH3ezbZcfYV16Xe8GoedbrjZxA mz0k4NBWoNG76te/tuPkfTEC53R5kguwSmtPRADUGk0W5kmjzsbdOL6zL+FwWQDgTTGZEaWOtg3q 6//zk5/Y33/5y5bFYoDCABjp0vtZp6Nfa+I1UpELwjeh/SWlUrdR8lEktMkb7L3pccLOhTb1sQNy D/pCa7DOAldlXvmcOFDY0ec/p2pkij0HDhRWH0gVBysArItZg4WAFUB6+q677LvSTLFpdVeZTxEm fRXOZo387jCdcf3E7beHuFdsrXOVTIjcq4+AcT+lcxEwn9G7ZyQwD8scvWFgHyvVpE+I8H5Vk5lW 6ZWS9neqz8iP2gaB+X//+792uTR6AM7g5B2l7yIBk2lpVHIBVhk5uRO5fZ368ji5htC2zcqWDWCi rrR6XI8QyAhO3dLyEpSWe1UUIuliav9YnqCRS9RYqn83ky94AOD6NgCdbLwNIH3+3nsLR8upcg/I RPjB+XRyP4ex9KJ/FSdg/Ejwp8EPJm4rFpzhiQ2Gw3PcgQkOHyn81cg7boNlfOHw3YGeuPAVlI0P HLHL0tlMmnhg+L/gD0R6/LRSHWhGoANnb2jClyjVAb044BPrDP+zuIO0+M2xTx9+QqkOTIvUkzLw GWIj5FRBZ1lk0Up+S/gZ4b8Ut8EyfkmEE4GedPfnIz2+R2h3Uh1oGIkRt3DhguBbh2N3qgOfQ/wL oRt/qLiDdsJvj0UecfscAnyg2ds0ju/Z6iNdpVWhjrRrHB/Jz/foTGeD8KHSwnj6qH+n1zkWYMms EjRYDM7nAyigIWKWzImwjxPwOKrTvpzppFe61+TA/PWvftU2yKcu+Ntodr5Y/oPt9V0gWMpq1fZJ z1cCdoF8Gr/1j/9od197bc5GxOfTjFbI9cdUuHf8OPmTdbM/VB9ql1WYbd+7u4J940uX2UT5mAEY CKyKlmYfS/HhIeOsb3BdGBqLgvQT6o8p9ny0fy7AqirT31dlFlyjcdYj+3eXsA9BR++4w76ttl4r 8BW0lZjMBLwxF98iR/gz8Oazan/KStX/eQaNBen/3hbqx6fhB/3Zy8nlz0syl35FseIWaIzDRLhF Y+P3ZTLEL+sU6c/123eAlTERxomas3uOwMNhGQdnYmnFRYvHR4VNofHtijvYOobVjzh642BNNPtU B2UTzBVa0jkAHsVlTighp1B8WFIdACyc7Xsptg7O5QDFOMBEOjZ8RuDH7efHSkYEPYAVMOmLEZKV QT3hB07rrFSNAxIAVBytqSNlxKUHqJIvjvBssBy3jyKAgzbl7KfYRHEHq2EBKjiz40yfSmNDXeHj SMVyg6a4TZPpVyx6oJ6ccQeLAogJBz+hJ+4A5BF6ZfCQwQH4pzpwkidf+mPPnj2DH2SqA0AL8MRB n5WPcQe85ttjEcviJCD7cwVYmiQs1XdL1PTWCjmzm+8FoJOfgJZwWadJQ3NtAt5GQH0XcYxSmfAQ SJqAlZU56Csy+SxTPyIWFPsNbhJoLPHooyEI6QLN2LUiJGe1lHh0VP9/qyjvv/vlL3MCcyZqeQoC IFKlVV0XaxUv9SeSfKh/qvoo/VoBXurfmvo7vxKE8jGNE7tGDLGOrbrZN8tl2WUvD7Fv/fxPNr1L hwBk/izz4P8CsOQYz/VB9ekO+m7QZGRpYhVoiBP2hcEDlcOm2o1lpqU993rspfzyVn9ZISCEj1Cb mjVtT1x/oT0lewgyC4BYpzGotUIPAapHa/zk2bVXXBF4sZe+lAs+8NtjUQS+WXuleTlv7a/6s7F4 I9W/rWTAQdojpv+vQIaq/h8qfaCN9HGTEviscl6QRgpeU78AmgQcT+n8y+9+Zz9S4NWdKATUH/Zp 1T1m5Gt0n1WX51z/DMCKG6bP7TmzcjQXNWvUDMAg7kAoIWDRdKExiANkABO0L+lsDE3ZrA4jVAGO 0HFaI4ADmjRW3KHJSHXg44I2raqcZolRls4KTkBNGQWYjdOMUC4ghVWIHKwmTKUdAZBAL2EbAGZx gps8qSf5IrzjNkGmTQCTAJrGjZvEthHlA8YIj5AOLYAHNJ4AaDRNaJ1SHYBmgCr9LLryNtk71A3t Hn0ReuLMbQAy+iPACYATdwCUiF8Xp8H0fAC1AL50DlYIl5ZApr7pHPCc2Hv0+WTH5waw9P1tlMM5 gS/d7+kRrewKQh9Blyg0dA9A8dc//jEv/X033JBaKJOHgFN5CViA1Fytvr1NGzvj8L5D5dyhgIrE /tmuyU0oM9cnCd+kq2UmzAMh5wNgSeitVx+/QiAuWv8DHpspEWQQckJ0Xv+HP+Slf0irAve6UI7w iwCkHxNmZkBvK9q4r11WdoZ9/enWltWth51eOD849FMugva46l1Mq+ycBkypaPlOAbDS0RCeLdBS /deqTwJkveyntIUNqz7za/8tWvWJ0Pf0j2u12z4mPMn6i9MlzVw1mfoINLpaYL6uJsv4YM3SJPi4 xnQCjv5FIItQDaG+AA/9f0CLIFjwgFN8StBzDvUHLNIWXp8iist2yOlI0v6bNSn4oxZs5NVfjvj5 9hd/X+14WHmijfL33sQ8igVEfYq+/x//9m92vRZ2HKPs3LAVlMNWUgfoX+fa/zMAK52h+uzTILiZ RQMOEMhxpjk0BggRZt2Y3OIEIBoLNEzEVIo7CClRR0H3WIZfU7MgTFeFdSC4AUxvvNEgL7p+HCDD fEd4DgQsq+BSHZh40Nah2QEIxWlHADLUEXNfOgdgkths/dPQMAGayZuwCbVr1wqhQVIdtCFmUzSY ce1JPrQ9mjG0gQ4q88sfIO58REMGeE51UE/oAEh2ldkkjh6AHuEq4DmaxriDvNEAwvdoWJX83sPU 95p8QVJpJP1dTODs+BBnCvf01JF2IpTGBQOwck0TONUy6LOCiWjr/C4nc90ZNChRswzp1fffkmAg DcvsWVLOb7RQrATM14yBBuu558Ky8ynqU2ilWC21X2MFvlb//Z//maOlcmdv/QdgfcqMdraCNNl7 EdOV159VbvyuIFo/ESIiAhQa5DrkswoQEybpceD+FL/0zimNa/vGj7XJAlW/rKhVha9Osmodpkhb NVGamR/adVoth3ZvoCaE5PM1mVB/pDhQLoTrqz/mBdwszLp7XtKUVBTwTWz/ypoM5EWZ97S5miho Ij3Ah/bkdxn6S36rIXPfqyQNJj5Yy6QtKy1zMf5FgJv9anfCdQC6T9L+7qOk/ofp8J/UJ1cQQ5L+ WJg8oG+L5rK58di+/y//Yt8QfdSn1iuvfNrvKbe/1NYzrz91CP0FZ33f7icZjdLSTVK/x0T6k3// 91B34n2t1wQTc+BCgU6ePatdZkJ7C0yh1WIiA/gkfMk5A8wMwIoTGef2nG2AEJLM1DGbxQEs/IvY 7oczHc0OmihMPQj7uAOtDrN58kYIxvn3xOWX+BygwUnMrbh6AvaIA4XmDdqJiRR3YAq9V6pe/IHi tDpof9B6ZSvScxyI8HIBBOloAskbsEE9+c91qgMQBL/hfZwplHwA5bRpOiY58kNTgzmX/hXnx0S7 oP2DnnTrCh304Tj/QWjHx8wDxSbze0rkEzz3eGFx7Y/GFZNpnG+X5wMfMRPmp6n9XDRYGsQxSzF7 R2OSpZhkw9Sfv6dtOv5JwCFsaRINkUC4BU26MOcAxIZIozlKYPffv/vd4Fs1lU188eFJZiqRgCmp ZfqYBVkd9VOZfRAmh8TzX2uG/vv//u8gUPIAGjN+gRMiff9a9B0ksve5zuATBR/xuVR/4i39q+qc pUnTEGkkAQ4AR7b3CfX3+uRqIa6UczrAaoT8DYfr/De9C9CYLe1qspASx6ZNtx0KQFr0NTltvzDQ vl93rnXuMNB+/C/fCvvxIWBfuO++IKhbC4QvkkaxsrQ9mNMQusHxG74WJrggL317mLf+WwL8ewIX UzVh7C8LBAsO8Ici4npe/KVcreIRgSGc87+jNKPltwq/4B3AdD5m/mR05gITgogSPJN8n1Hbw+ct 0lzvlHYGHoaQHciOCMBCm0ZbrFDsv0IHWJoAEh6CoK8/UB+eovbrK6BL2+L7tdxjcHn7q7+gqfJQ ImM1cRuoiTz1oP6LEvtLtL2kwcX8TBt3krKiUu6khkUemtHZBH1HPKshjXvw7YIHOu+SdvenCsi6 Hf/LVGbLdPpGBmDFDeuZ5xcKB9C+AMzQTsWZTi8UmjN0XLgciANYUwvbyR2hIfAwV0LxyzLVvPDA A2HlFiETGuQGfGyi3Sc+sXoL3xv5KgEm7kcYstpLvmvNcuP1hOXlCIfEwR4Bq7JeUhnM2ntrIQkC vQa7UwhU/UwCHlNg0F65xkzCDLMbmq3zFspANBEt/O8UUf3lSP3rSAsfVrjJxyqx/gtVf8xcD7Pl T2798d0ifQga6pHHIzxgVeEJXVd//hm77A+KXl9prv2sTB/7ljRgrz7ycIjz9Ftp9AB6xAgDcJ0R UPF2uOu660IU+HN2ck5sF5UxVZpjTHWYJ4lHxVlNQp76EFX8E+2p9l+oSQUbNj+lFaHQiYP6G7n1 byyNbtL2z9UUsQ/lv0lLulSTTczKmMTYKmijJmWAuocJOupaMNUXx3bSAco3nA8ToeqfLZBIXV8V +KPv8w1UytXovS8/sdD+DrD4XqTJB/g+z/ZOufWvm9tf3mKrPPpEMrCjfOrlav7mqf5TBeZCCAY0 lJrQd8xd6NFBVp3AQ3im+t+jBR7/qdAmW6n/uWrwMgDrwhUAGcoyHMhw4PxxIC2ARcTzc11JFB38 NZD3y40o3kL7qgbhgAO7tAVoMO5Du8KsmcEeIaP0Hq+ovvZW9fSbpHFBi8H2JklXe/G+8nlCviqY O9pKS4OpCAF2TEAKbRb78n0CYOEbpvoCxO4RwAjCpbBXkUno9RDYQ8DirB2EqYToKupPxHXq7xoV +CaBPEQaHtK/6WBCgAAfNrQYt8rEdcJNXIlCVuneKv2a/d1X/8G+8WJnu6z8TLvsNw9Y4+Iv2x5p UdCAEMYiTwOo+mMixS8J7eCntCnpaCzi0qg9u8j8T30+ov4IdtV/mRy4MWEBeD5h9tTz/rmmTBz8 Q3p82GTmwlx6z/XX52gZE9spdwPnx9X+/09O3Ms0WbhB5uGfS3MEcFwlHzjMgME8hsaQ95UP/lj4 euHovb8wfJCi/MhdePGB/EWpf0e5zIT2VxsvlibqH0XP09KefaLf6fvopUU8pP9Avr3OLxY8oPHC X4w9Fj/1jeZq8Ag3AZhdJM3YUp3E+Krw7LNBg8Uz8h0vM2LoA+IB+zLerBWU1H9XYZoI1eczgUbP 31ieyTnDgQwHLjAOfC4ASwKlea72CeAQBAZbdkiwsRHvFTLbhY14fSWbzBzv55o5usiX000ZxyVA cPpmpr2HxR+JQTMlRN2fBG3U+wJzCJNe2qbomMxUSQGWBC1xgNi3D3+dZJqhczaZqT4NBZSgZaRM o17/jyV8fyuzJOZJTKJ59ZGAfbdSpZC+D6adXFMO2/7gK0ZMq7zFAUm0Rayc+4reveeZsvaPNebY Zc/3tmYN3lG8rH72ZQlbwlTkaYAAAPJpfSeXV4PYrzGZdjAOROX3HKGv+uBsTn1Gy9QZBDtmYJlm f6O6/ElaRdo2DzCIX3n0CJh7/U+JVvzoWLRwDD+6xEmArvGtwucOLd1qmQX/T/3rN//1XwFQLZbJ EN+n4gQZzQUXmC9ZTYc/GiAjONAXJsDO5W/N3PoTlysALKKdS6v231rRiCmYALnR+qOlgl9DMdvm pj8iHv1efSWsdk222i9Xg1tefn1fkfZvmQD8eK1YJp9G0v6hCbtbk4h/1qRmlfuaqdwjarvfK0/y PpTfoouCtL9rsDIA6wIb/TPkZDiQ4cB55cBnDrAQVhLYBPbEz4dZe9AeSMCc0qDN6iVWlh12gMVA LgH7ioQggmGa+1shPHWy+glhGEI2JPpK6fqQBO//yNx3p3xK3ssFDaMk1I7qGT4wn9Jgqay+WqQQ tCvSMhR6oEnqv3yZoVXB5LdEpj93Lj4sgQhYYIUffmChPrmO2phS0UJM1wrVAAYAj+IZ9BPTai8h C3wlZFT4CSy9La1P0H7UrGZPNlZsLDm83/f2VJsoM9VXv/x3Vt39b3iP8mSua6mV0LwTgk8WJsAC OEj7hNYJbeIS/I1CWIiFYRXbrwR+rlQfCFHm3SdK5WMa+4r4tVCmMu8vxHUCkLPa8wi+cokAG18/ 5QkAxX9vi3h6uQAs71An+hLhO4iTlefDJfAySSAEXpdHy1OYdfc6Sat4l0xw35K2cpX7W0Gr+uov 1FfxCwwAi76S21/QsrESlrAOXv9jSkNafAWTrj7MBViYYdHU4Xf2Vu6mzgO1qGqPtHMsGLlWCx5O QluuSXW9zIL/ovv4poUN0s9Ve50BWOd1DM9knuFAhgMXKAc+M4DFYL9AAmPNCpvbp1cw7QAkAEC2 VIO47s/q0T2YSO7G5ANYWCTfqNXLtGXNoODQHkwWWcS+EsBYsc6W9BsYTCRocU5EHdWDsFB5q5fb SsWD+tY/fsPww2EV4pcAaQrXAMDCbAigC4J5AYJfgGbFEntJaUnHtjqFtlVKqL/KEE0zenQLvj9X StAfnqn6L8mp/7TuXUL98f8JJrLFokfplw7oF3yIAFLBZLWYwJxaAdZ3QHCMvlEamuO5vjN52jXq v3SRnVyywB4VmANITOzUwd6rL9PkEx/a31dfYEWqtrZ/VADSmviwoRVZLD4sX6RFA53s5+I1pqQ5 ALrC2JOR+itEhK1dYZM7dwwO5IToODpHGjPquWa5TezcIZglH5SfWag/7a/7C/v3DYshcPI+IMd9 W6LVbmr/Bb37hkURt8tE+gkz79xcsLBmpa0cNkh95J9CDKh9s+cEAHODtJ5o0YYJZNDOAFBbpfqL V7ZqmZV5Vj5raDpllvuEL1RBtDbJ/AGpv9p5ktrhH7729bCSM/i+0f/XrbQJ7T4KqzkB3zmgm/6C v2KvYApGUxU0Sotz6j+7Z+/Q/oC1Ux5iwsudD5BfrDhWM0Lcs5+pPVlYgtkbnm0jwHHurgbVaP9g plc7qP5vlS0T6h/8tJL49hVYg5sBWBfo6J8hK8OBDAfOKwfiANY0mRV24YMFCEFIFvSco3cQ/otm KzDkBFvQfZjd8afrwgBet6ScsyVw903KsoU9h9ntV+Xcb1ZBTrvrdH9yli3tPdIeuv72cD9oFJat tYPZU23eqJ72wB056YOTe96WNgQLnacYT1Ns82gFwX0lZ+NaNDI1tcz9a9ICsJrsqOrzPzIb/f6X /x0E/KkFM23b2Ak27K12mu1/M4CvYHZ0rVBB6+3pqT/CbuFsrZzLUv2H2l//kBOTqAH+ZGuXS/uk +vcYLr5cH+6/W0V+abn1X9ZnjOp/Z7hfVc75tny9Hciaovr3sHtv/0sOH93JHT4HIDNPfkSTbeuo LPuwUgP70t9dFjQdB6TBaV+jil32Xyq/zGT7aolB9qV/+oE1fO0VO71ikVaMjbfRLTrbL/7jJyFf 4kwF4Hq2bQ8t3v6q/261/9yuQ+y63/0p5N9Egpx6wpf53YbYDVdcFe63qlY18GWP+LK450i7/9pb cttZIQxWbLADav85I3vYXbdcHe7nOLkLIDnP1f7Uf4vav97LOe3/bpWqhkntPxWqIAAyOZV3zvUD 69akoZ1Ztdi2jRlvw5u2s29/41uKj/ZdW0fsOICOa/bOpg/ktf8s26PV3LM7DbRrf50Ty6x5RQG7 UM8JNqfLYLv2t1eG+20U9gbAtVf36Re35faLOsW0f6baf3/WZJs1vKvdflMOvwg8mufkDo3Uf+Zk 2zh8vL1ZUu2tNI9KY7xTWr7/lC/azVddZXs1sfmTgNdXvvz3NqN7Vzu9fIHqP8EGNm6jlZrfFtD9 ik0j8r9H9j+buvs76j8HtbK6jQBdxgfrvA7nmcwzHMhw4ELiQBzAYhXhLjlT5zmc4+tRkHPeHAGi KTbz7bE2u85Cm1N+hT3562L2k//4N1vRf5At+mCy7i8I95/5TXH7+Y9/aCsHDLLFbSbZ7LrzbW6F Vfbi78tr5dd3tRy/h42b3Mw+mlvU3lp1v91Q6cf2w+/8qy1XPrZUM3DRdWbuLFvRdaxNrz/V5ldb bV0eH2Y/+Zef2ph2be1VxYz6ljQnm+TcfJQwDTId/f5/fmEbB2bZzCZTbG71FTbmFWm2vnOFtBiP /01zU5D6JqZV/Q9R/+bUn3quUv1L2H/96Pu2asAQW9hqou7Pt3mqZ5Hfvy6/sH+T2Wio7k+yWbXn 24JKivH3x8r2X//+H7agb08bM/ktazuvqDVbfb9dV+lHqr/SD9Y2L4vlx0bZ1L/LWJtG/auvtn7P Tbbvfv17AjOlwsq7Pk0a29cEuP7tETmZV1lgl91WxeoUed2WtJhl82qusOwSy+wP37/OfvWz/xcW HYTFBviDnS0PVH8AIfWfVWuhzS67wp76TTH7n//6kVaGDrEF76udxZeZ3L/8VWmYfqgtbbifbbNr LxBfVlvRKyvJDPxvtmhAHxs95U37aH5O+19X8f8JMPzA1gwREFqSs+qO9l/WmfafpvZfY12fGGk/ +c5PbLy0Qx/PmhkAFpt/A7AAZsEUXLmJLW05z+bWWJ7T/v98hVb3aXWjg6uzrTvvqf77J0y2GW+N U32kHXx9ud39i6dU/x/aOtG9oKXaWXyZrvsP/W+RwPdVg4bbglaTbY7qP7PcKnvud+oXonupAseO nNRY9X/Zmqy8x64q9UP70Xe+ZxuGK6bV4pwwJWfmzLKlnaj/dJtTZbW9fU9X++ZXv2k932xomzRR wvT3iDSEhGWg7g/edL1tHKA+2FiTlhorbVTRefbf3/mdvXD/XTlaMUDSudQ/8GCeHdRkpU1mq5wL aejP0JLhQIYD55sDqQDWQe2POFczz72YaxTLjo1gC3zu3GrrxktQltlmuzQx36NFU7VubW4d3m1h ++eutfnldtjOGmZ7db/ObS2snVaL7Z+/xuaV32K7tMCM9LVvaWGt3mhmm9fMsqZb77OWdre1tUft sVa/tbfr17XTu7fa4m0CgVu32/FN62xWk0W2rtxpOyh/+PHFFtlrD5WywxvW2TPyRfkXrTrcIa3U MYV5+P2vf2OX//pnNr/NfFtf8YztrSdMVXGflby1vC3IktZO+5AWuL6JPNq5xTZlL1T9t9pu1X9n vTNW/Zam1r7lu7Zn7hqb+7rqmcuX2re3sA7vUP+1Nrfs1sCXPaIJvnwkp/Sd62dZk013Wyu719rZ Y/Zgi1/Z22/UtVN7ttiyreO1KmyXndi8VvVfaOvLn7EDb5hNeXW1vXp/aduxTEBJO2RMwrH7K1+2 +x5+yn4mIXxZqbFW8rWhtrvqyVD/1VUPWLk7a9j0UQqwSWy7s2nz6Dtq/w0TFtmc17faLtVnt+pf +/bm1qNNazs4f12oP3zZpbLr3vaOtZdT/V7Vf/brm0L771b7c/+jxu/aVtW/8da77H27J9T/0Za/ sfekfTq9d6vqr/ZS+5/ctN5mN9KKVClBD6n9s4ovsdcfKWPHNq6zPTJ1/qf87m6XCdb27bNSL71o X/ryl6xTqR62nT4oGpZU3Guv31XJlkyRKXr3rkKo/2ZbP3ahzS29Pa/9q9zcyHp81Nr2zFY7v67v QvXcVVf94tY3rfsH79uhBaqD+gv9Yre3f5P3bMv6mdZw0x1q//tU/0ftwWaX23sCLSf3brFVW0Tv tp12ZN0qm9NwuW1QpIsDqn+fZ7KsyD1F7MjG9bZz6RL7sWJbsbABcPUtmR2njh5sazqtsdVlTtk+ lTW/3HYreVtZWzlN+1SyVZ2+k3PuAxo7Dsu3saMc9FuofbWDxt7LNLDtjRvcfHCasGpfXNJL+jlx mdiehL34MmeGB5k+cOH1Abb7IRhsYsDZVACLmGvsewnQOpfj0P7DNqbFVBtaO9val+5r/Z+bqD31 dtqhjw/buPem636WddD9fs9mSRuzzfZ/fNDGvz/dhtTKsk5l+lufp8ZJ27PNPj79sXWe1ciaZr9i Nfs/ba+P/4uN3dzOBpwaZo/bU7bONtoZEbpo3CobXCPL+tYYZW2f7m+z6q2xwweO28OPPmzfk0P8 fgGNYwp8+zs5Pl9x5RW2buFWG15/sg2sM87av9DPsstoW541qQPnFoQfB1X/0XIqp57tXu1j/Z/N trUjd9jBox/bmHen5fCllOr/jO4PF1+05dbYlvAl2zqW7md9nh6vbV522L4T+6zDjDfsreziVr3f U1Z67NU2RvXvc2qQPW3P2XrbHOq/YPSKUP8+NUZYx6cH2cz6a+zQwaOB5NVyev+ezES/+Z+f2Y9v e8EuKznW/qPiVOtcY7LKG2MdXxxoU6RN3L3uQEGqmDLtgb2HbHTzKTn1LNnHBjw3ydZP2G0HD3+c yxfdf62vDXh2oq0btcMOHz9qY3P50kF86fP0BFs3dJcdOL7f2k2vF+pfrd8TVmb8NTZ+S+dQ/2et iG1Q/Tnmj1hmg6ur/tVz6j/jjZUKyiywsm+P/VRO9LfJx+m00t0lx/EfSJM4ddgsG9NwmvWvOcY6 FBloUystL9T67999yEa+NcmG1lE/V/sPem6KbZq4O/R/+sUw+KL7A6Vt3Ji12w4fPWJjuF8HvvSx vk9laVul3fbxmUPWdmrtUP+qfVX/rGsse1t362UD7EV7xbbY9lAv6j+E9q8+3No/OcCmN1hhx46c CM/YNgtw9Q/y9WNnitAnZm3Ut5ZtA2uPtfZF+tuk8kts1/rCxTTHtctJL/nzsYPKeQFYRN1mK5V9 Qs6cHAATIonzn2jUDGhsl+HRoomSTaRv9rjjIEJ1dIsMnkcjOrNlDAOiHx8rajmRrb28uC+GATga ZRt6onvS5Rc5nPeghUjk/IcGoqtTFyJZc00Ud6JJs/EzJ9vCcE160hD5mo1vuc9v8uJcLeTr1+S3 etVqmZtXhbS8Tzlck49fwwd+k8bLddrIj3y4pixo87LJg/T+nN9eD9Lzm3v8Jg3lfII25U1+PCMd v6mbv8s1tPq7XEMPz7nPNXlGr5PxkffhIemdj9FrbwOeO089rdNOud5m5Ef5iXyF9sDz3Ho57xJp pewoX+EJ9XA+cs0eftAKPfx2PkIPaSnL25D0XHsbk9ZppV155vRzzfucnp7fUb5CH3nwnBP6E6+9 D/Cc/J1W5yX/vb+QH+l4B75yHW1zyvayaD+/dlqj1/wmTRxt3p/9W+Havyv/Vqh3tH+St/MR+qEx MThtHMBaJjNJ3JZMsePKrgM28e25NqbKbJkt9G0rjuKqQVtt7569Nvnd+eH+rMprdf+0rRooTc+e 3TZZJpsxVWbZrCrrbFvV07ayt9If2WmdF9S1xrOetrfWPhI0OSM2vm9Nj75tV9ofbapNszOnz9ii EatsdPWZllVZmpxqR2xt04O2b+cBe+DB++0HCunAmEug3svlZP2HP/3e1s/ZahPqzbVxlefayqr7 bW2tg7ZpqTR2hXRQdnbzOTa2yhybW0XtIG3RikGbbc/+vYEvo1XP2YEvqqf4sm/vvjy+zK6s8aba GVvTT5q+QwoMOa+2NZn9jDVb+6i1Pn2vDd/U2hodb2p/0t9M/Z3R38JhK210tRmh/huqHrXljXdL GZOjL6De18nRGSHL+fUHZCqsON2uLTfcxlSaZmuq7bc1tQ/ZxsXxu0qky569O/ZbVrM5NqbybNVf 43bVU7Zm9DbbKzmY3dz7hfhS5ZStGqL6H9xvE1twP5cvVVX//jts18fbrP38mtZY9X9rndr/zH02 atOH1uR4M7tafzP0B8JcMGSFja46w7IrL8qp/5vS7Bw+JmC9z/5HoQeukYmQHT34fdU1f7LVU9fb BEW5H1dpnq2SBm9t3UNq/0Ks/7Z9NuHNWWr/2Tav6ibbWOWErR6teu5xvszK5Yvuj9wScIDzZW4V yUnxZc2QHbb3+E5rO6d6qH+z9ar/qXtt1Oa29sbJxnadXW8L9McEasFg1V/tT/03VjtuS5qI17tz 2p9xhr1y2cnEjxWT1tmYmrNsfJV5trraQVtT56BtXbk93eZNKx24oqeC6543gMXgxn55bErMJrmj x4wOA31ZrWx5Tc6ODLJsDvucHDn5zXYrlRT7hD3Q2ECY6+aK3wKBbJXBYP+mVjk0VmyJYfKTYJBn 3z5OQBWDSDPFTBmi4G00WKqDRmEbkNZS4bF3GQMq+fF+N6244aP0/JNt/bFl85awIW/zt5uHbTmo K1uXdNIWGC4c2ZaEPfQ2bMgBQoO0PJUNa9nKhTTUie1f2OSX7VSo8/va2oJtRIbLF4B685x95hAc oG/OKVpVg6Bpo3gqHbW8lv0I2V6Hd6GdbUu4z/vQxvts8ss1284AWtkLjj0Ec7aVyQ7v0k78ZouU d/Wb62lyEuQetJGesqgXeVEXaEXoUh78dEAJnTPkVMg15bNpMBtBc807vokw1+yNSHoHjeRDfvQJ hCS0Ui/K4ZrNnNlSxgX+AC37pl7kRRr28oOf1JP6OR/hEW2Q2+HzgAK8od2gd5mWk0MbIJ78AffQ 5sANfrTTUm/KoT6tWrcK+Y0cNTLwBh7BqzHy4QEEDBk6JLSz8xyesgcj+UAv9aKN4Sl9gnr7/n8M CG+/LVOJ6KEPsp1SYpvTBuwtCE8527b9KA/88E3QrvBj1cpVYXsf6KNPwFt4xPvwhPrAR/o0/OUa uumH0AltlENbcE1bQStlUE9og072U6RuXFMv9iaEL2xfAy18a/CWvTe55vsAfNLmXLNpNHl7/4QH gChopR7wkXo4H+k7bF7t/ZM9LukjlAOvePZ5AKwNS7bawkrbbFvNk7ax5hGbJH+TVTIP7li/yxZW 1v0ap2xjrSM2ucxKWzZtle3YtMsWVN4c0m+qfdgml15hyyaus/V7VliLrY9aq5P3Wusjj9gbK++0 6ctG2c4ze0wbawVwcfLkCZvTapWtr3DEttSVcCm/07Lfnasnp+3RRx+xf1MUb8Y3Jp0/lLnkhtuu txUDBZYrHrGtdU7YqsoHbLx8n3btlHmwkI5Ny7bZggqqT61TtqHWYZtYZqktn73atq3ZYQsqbsnl i+r5+jJbMWeN7diw2xZU2W5ba6j+Sg9fVk6WfurAGmu+8SFrffJ++yDU/y6bSv1ttw3WH8fJMydt zvurbEOFo7alznFbLBNs1jtz7OjxI3m14fv+jlYlXvHrX1mzj7rZ92pMtC+XUp+rtMHWVdxj4+vM yxPIhcGCjYu22vyKW0M9N9Q8bJPKLrO1i9bbrk17Al+2wxfdn1hG9Z+1xrav3an0m2w7/UX1n1Ra QVinb7AN+5dbs60PCljcb60PP2wNVt5tM5ePV+332VD9cZyWImNOS018KxyzrWr/har/xPdp/zN2 +Mhh+4NWEHKyNdk3tZKzyCvPSzu4zdZVOBzaf2WlfTaurhYkCOQW1rFxodq/nPRLtU/Z+pofS0O6 2NYu2SAQsyOXL9xX/csusTUL19ueLfvkeya+1Mzhy6Qy+l6m5dT/rU2q+6kHrJXq/8ayu23uCo05 0lyNMvlh6Thx4rjNe1eyouIx9f9jtkCm5omt5tqJ08eDHGecqqhQDYxHBw4c1BsC5N00ySt3WP3l hK2g/vVn276Yrc8KyptjUiKdV4CFFuo+7fsEKAJIueaJwbCUNvHkAAg9qCXCDMAAJJAmAAwhxoDA fQZpBlRADNdsLMtAzkDKNRvkArjY2+xZgTUARtyeeAAsABTCnw15GcR5n4GfBuE++wkiDJPtDce9 l7TCBQBZWbFmEDK9JQC4h6DGPIGgLK7gapSDAEV4Af56KHQ/goM6ItwQHABQ8ipWrFi4BkRy/YpW ASHwEMTcRyCRB++SB7xFSMKPgRKQPfSctGwczftseovgLFmiZLhm4+nJkxFm7wVQUlfbBcDPkiVL BlrJC7qh42U5BTIwQTe/i2rlEuXTfsVLFA/X0EC7lC5dKtxHANLO0I3AZd87+AFfeBezKkK5SJHn Q73gE8LzeW3giTDE1EY7vKhouwBJntP+5Od7BtIm9B+EOOXBKz4g15TVqlVLmzHXDkCATa6pF/UB WFB/aKe+AFvq53zs2LFDoB2VMjRQNjQV0XYO9C9oGzxksD2nIHb0E+iGLyWUP+1Au1LOK8VeCdek f+fdd8JGxfRV+jA8oy5sYA3/6WvQxQl/OPuqbMqn7aCVE8DRUXzoP6B/mIDktfmggaGOtDH9Hj4C QACTlAePyYfyaA/6W/Ua1a1b926hD/FeDQW0hHau6WN8gwAqviueMbHhpJ83bNgwD2DRx/h24DNg BkBGPvRPyqJ+gDJ4x3PALsAH0OZArrP4P0LX1If7PCc9gyG00q58i7zPpAzgx7uvvFI08Jr01JPf L738UqCB9qS+1AUaEo/PQoN1/OgJBdScYK/dUcHuvUoA4f7etn7wbjsuYTCm3UQrLZ+X+65+xN6/ r6etG7jLjp06poCIU63svVXt3qsftpb3dLN1fXcLPBy3PtM/sMeqXWfXPfw7e67rFTZsxzt26vhp O6E/P9bO3WhNX37fHr/hWXvthso2s9ZaO37whL1W+lX7Ohv9agxiIoEGp2yFsnZ4zzFrU76LPXPD S/b0NS/b6BJzbdfKWA+RtGXM8WMnbFircVbi9nJ2/58fsXYPDrQNw3bbsZNHbWSbLHtVfLlP99vc 38c2DNkTrAaj20601+7UffGl1f29bMOAPXbs9BHrMeU9e6SK9BUPX2FFel5hI3co8KSqfsJO5tGz atZ6a1TkHXvshmes9I3VbUYtmUhlpvQD2cKkbK7CGezessEqdRgvX6xJ9s2ive3ZG8vaONV/+7LC A5jHjhy3Ie+NsWK3lrH7//SIdXx4qG0Zt89OCAwPay2+3FHWHrj6UWsLX4arX5w8biPUX0reUT7c //B+KRQG77Xjp49a10kt7KGK16j9f2sv9v29jdklM5eqfjJS/5Uz1ln9Z5vbw9c9ZWVurGWz6q61 E+qDTC7uUtT6XyjOGmMS7f9h2zb28c5j9l6pdvbkdc/bC9eWtOzXZSJbXXgA69jh49b/be0Jecvr av9HrdMjmqhNUDsfPyG+jLZit5SxB/78mHV8ZKhtHrc3TBKGvT/Wit8mfqn+7R4cZJuGi19njlmn CW/Z/eX/bNc98jt7ccAVNm5XBzOZP6P1Xz5tjdV9uqnq/6RV/Gs9m1VfWyCdPGMTssaHMQIZxXi/ aVOOSRWg93aJD+3x65+zl64rZZO14GDX+sLr/5Rx3gEWIOcJRQZGmIGeV6xcEcAKAKAcyyx1YBok DRoCNFZltCcXQgchycGMlFk3SJQDoMbg7WY8BAiDOgfpEDZ1tddQsoE12eiAQEVoAPQQbKsJ0a+B GeDGwaCPME080G4gCKCFGTtgjA5MXQA7mECpw1NPPSUhNyTUCcHHjBvBAZ3UDX7w4TODpyPwDM0I ZSLwRmprBAAKebvWAeEBIAOAMjP1GT1CvJ8EDHRhZmVAna4YImhh0LCQH8IK+igTFaZrlBDoXbvk aEJIjyaBEz7M1T0HIjzjpD4ITDQrlAEgAsDBF8oGhAAsABm0xTOKnIyARk1Ne8GXevXqhXZtI2EK 39AE0R/eavpWuEaQwkfSPanVULxHO1WpWsWe1q7s1BMAByAHWGcLuAEEXlV/AyTBN+in3vQT6Iav H370YeAZgAQ+QqNvWA0fyLu6tmfw2Q+0AjbgF33scW2ky3/4TXt1ED9py3lz5wXA0qlLJ/Fsbnhe pUqVUHfAGEKOtgNMAYAAhvwHcAIM6LcA/ZG5G3MDMF2bRb9HU7tvf06bA/zQtjKJAdzv3LkztDe0 QhuAvn2H9oHmvfv2hjanX8NfQC4gFZq4BqQCsumD1Jk+gVYJEAtgQwMF7QDDlwQo+VbhJaCZNPRp 3gf80Cb0DTTPtAXX1AHtFM9pB8oGNAPi6BvUg/4IQKZP0SakgzbXUgL6nnnm6QDe0OYC3HiHbwXe 0z/hPdfwCRr5djyf6Pf7WQCsPRv2W41X6tmH7T6widOzrM5rDWx4u3H28Y4jVqdkA2v9USsbmz3a GpRrakM/GmtH9x/T/mmNrWWrljZh6lhrUP5NG9BihO0/vsMqNHvJ3n5L2uTs2VapcQn7cFADzeC3 WQ/9oaXgGNh6hJUvVcn6DetrLVu0tDdebGYnD50KGlaE6hXyvfq29pnD2Xe8hM7S7NVW9qUKNmTU IBswqL/VePYNWz1vXbIh8qzu7dl4QCEWalu7zu0se1qWVS9a10Z1yLKDOz7O4UuHNjZm4mir/3oT G9FuggT+Uatd/A1r3baVjckeZW+UfVMbPGfbgZM7rXTD5+29d1rbjIlzrEyDF639iCaq/XaTB1ce bX3fG2wVX69kg0b0t3ebq/4vNbNDe3IAFmMzEytkC/1k397dcqzvbr989j0r32WcdVIMrJpPNbC1 C7Q/XiEd21fvskovVbeO3TrYhEnjrNpLdW1yvxl2ZO9Rq1q0lrXr0lb1HG21ijew0R2z7dDOw1at aJ0cvqj+dV9raKM+mmh7jm211+o/Zx+2ameTx0+3UvWft25j3jUZT1V/BeDMPbo372tVylW1gaMG WLNGb1vDl5rbicM5ALSCYl4RsPQ/tE0STt6LFi20WSPmW4VXK9nwsZKfPXtYnWea2GZpHQvr2LJq u5V/obJ169PVsiZPsMrP1VL9Z9q+zQesctEa4kt7GzluhNV8+Q2b1Ae+HMvhS+ccvtQsWs/GddQE W/UvUesZ6/BR51D/EnWfsp5Z78v3aosN0R/HGTladXm7l1WrXM0Gjhxgb9Z7y5q8omj8AmFjxo4O Yw/jY/QY3WOClStZ0UZmjbDuXbtZ3Wea2vY1cvAvxOO8Ayw6Ns51AAcOTE00NgKTgRV0zSB5g1Y4 IFwBYQAPBA8zVt5ngGcAZlDlfPKpJ/MGawZThB2DNQiVAZ33GmhrCQbdVAe+VbwPaEH4MCAjLAFU 5AFwwM8KugAaCProgeBiAKc+CCQEHr+hhVk/Qp3/CBe0KQgETtcGvfdeyyBU0foATlxjAIgANLjG AHoQoHQSBAgzesyozPAxQwEU0G6QLzxFQ0LZAIny2moAoYUARZgi7AESvPf++62Choj7CDHoRrCR ltNNMHRMygeEMjhxDa+pE9oU8oPfpCcNmggGM/7TzvCSNgWIAjjhNeCF/9W0nQXCOPxX+Z+41n1P x3/nJ//JBzBRT4CkTZsPrF79egFUNBT9aFSoB+0GKKUP0Q7wDlppb9oJvsFj+A8YAcBwDxqgFa2P 0wpvnDYEPTQzQQCMIvDJnz4Ab+jr8IG+gzYK2mkr0sA3+jJ9AlDnGiP6+6sKcEc62pC0ldTOABLa GiC4Zq2iU6tO3uaAWIAKNI8fPyHMzgCwTitADt7wLnUjX9qCNuea747yAfh8l0x6oJ3nXNN+tCv8 BLDAJ0AUJ7+5R5uThr5Jnfh+6HPQ4dcAMHjZrn2OtgxNE/0CHtL/AWnUn7IBgHwLb0lDR18LtE5Q cEB9N+QB/bQD/ZWy4dfOXTn9EwBMnQGP9A1ALH0U8B31seQb/iwA1uQx06zN2x/Zlq05M+dlq5Za j97dbdKYqdb23Q6WpfhA8GFC9njrO6CvzZo81z5s0c7GjR+n/tPAJk2bZD3Fj4kzx1rjlnU08z8Z tKdzps+z7u0kEA/WNrmrywdrqp05dMbeqf++TRifpb7f0Pr06209+vQIoHipAlT+67/+a57/EX0f 7X3Hd7tY9tiJ1qdvH+ugIJADhwyUMNKqxEI6poybbh+1lJVh88bgGrJEASCp/7TxM6zd+x1t3IRx 4TtF+PZVKIIp46ZZ+/c72WgJRPrWZNW/b7++Nm3uRHv7g8Z29MgxGzRY+8rNX2ad23Wx6oer2e/0 R/1PHz1jLRtqPJs8xerW0+R68EDrrrKYTHLQ19xlgL6NZrp5vbetfZu21vzNRtahY3sbMHhAGMML 6xg/PMs6ftA51H+SLAYLly6wvv372MzJmgy06WLDRw4P/X589tjQ/jOyZlmH1p2C/OEbmzJ9cujD E6aNsXc/ahbqP2zoMFu6YLl1ad/Vah2rZb/X3zT9nfr4lFbWtbaJ2ZOsTt066ieDNMnrGMZ+Dr4r 9z+7WeEKjnx8xD5sLsA2cbJ17tJZY4FcxlV/6CysY8zQcdZN/XS9VjIyRk2bOVXfex/LHjXRerTv ZUOHDQma+LETxoT2mj11jnX+sKvGqQFhnMtWnLC+ffralNkTrFWHd+yo/MkGK5TFzCmzrXOHTlbj ZE37s/7m6+/onqP2XuPWlq2xgm9+0NCB1r5Te1u/dn2YgDJeMdlnfHB3gVZNP7DZM2eHMb6fgrr2 1jeDoqAwj/MOsNBWAHTo6F4xhNpiovjqQMPF7JgZMJVDjYtg4poD5vD+FAkJBBjaC4ADAy8ggA8F LQVCgoGVAyGG5iCdg3IQIMxy0YghIBnEGRAZhABgdAKEN/lGD+rGhwtogSY330E/eTBb4mOBLjoM Wgo3BZI/NCLgAAE8g0d0DgQbz6iXC3U3jaIVQKiSFuHOQMTHiBYOLRofLHm6uRPaGFB4H1oR9vAZ 0IHABfggWPkQ4QPACJALuCQv8uc35dWXMCANQh/tBSAHoYkGhjoAfrkPIGDgpAyEO0CE+tNWABkE HgIZPiFw6fiAAtoWQco1fOKaunBN+6Cto+68z0BIW9E2CAz3Z0LIVpJwR2sF3YAZwAT1RODTh6AJ kERZ8AWaqSd1Q+Dznzaj7WhD2hJaGeygBSDgtHGP65riBf2Yvg2NzkdAL3Wmr9J20A2v+O0TBkAC bUgdaAeAAwMC7Uu/pg0B+IAIvgVvc9qEtgTgkEdPAfOPBCygFZqoC+WhFaPutBvaIXjBQAOt8Jlr /rvfEkIfExs08H0A/OmX9EUmIcul2aqu39zjGf0UnlF/2plvBdMttFJXaKNefLP0KQY0aAEgAkRp BwDT8OHDQr+BFtoJ3kJ7r569wuSBb8Z9MplQ0Lbwjb5O/yctZfviAn6TJtlE67MAWPTZxUsWhe8M kzHjCX0Kbcl8RTenLeAbQBcB1EHf5yzFLOI9eMv/cL99BwVDz+nPuFvwXY0bNs4+WP6BvWalTEsY bJdCFTDZYRxigoX2cfXqHG0gB8AXMzdtgVYQwNmrd09bKE1G5co5kzXy7yOBFl3gk84Yml+aYWrP JVoiT/2YPHDQr+iblMu3T1+nnQFgXbt11c4xC8J9+iBtPFaAr6OE6RJF8V68eEkwde3ft98G9xts bVa3sdKq/2b9bdkobcbQwaG/o7lmEsW4xOSHA7Du3zHXaGm7atybMWO6vS4zN31ylerfu3efT/nr nS0PAMMbN20MkyzGRNqfb7K7IvfPUxBW6s1YQX3p2126drEly5aE+4yt06ZPs1Gj5cLQsbOAwobQ tmj1kYkDevS399e+b+X0R/03rd0UNDV8U2iZ+bbhJX2Ig/HsKgXa/CfFg4InR1X/3tpZYLYiyjMZ gkbAeL++/T614vZs6w8Ypv58u4zZyH/qTzvj54ql4K23moW6Dx8xPNxfpOC3KBgYnxmnh0r73blT Z9u8aUvoD49o6yjA4aC+g6zt1rZWSX879Ldu1bowMUHhwQSOcZ3xk8moH4wRjMv8B2fwvTC+IT+g ZYG+yd59ehda/Sk3OLmrPrk+v1/MMA2JS7ijHSr6LDEdgMFXu/mqP18d6Ku/GOx9lRrCyH1Z+I9g IB0n6cgDwcIz3km8dsd5X/UXvYYOdwDnua/885V75Ee+fk3eUVp8dZqvNnOa/dpXgJF3lDanm3Sk 8VV00VVrlOnXpE+89pWOvorNVzr6CjvSR/noK9egA34lu/YVdZTrqyujfI3m6Xx0fviKOqc1uuIz Squ3A+mgg/o7n72+3rbOT1/153x0J35fRcq10wFdzk9fYZhfm0fb3vnGveh9X/3pKwO9/3l5XEf7 hPPO+6H3HafJV1p6HaL9m3vhvhZ3RPsj+XMdpcWfJ/ZHT+srG8nf+Zi4AtH7gvPV6+ZtWFAn96UC KOe6inDgwEEBkAKuAXsMthOyJtibTd4M9WeCBojl3nRthQL4BDQz6UTouWvCm03fNOj58MOPgvCg XaZO0trBmdMCuOKAN2g3mByhMUSowSOENwdtyOSD8mi3vXv3BKHKxO6xxx4LQJW+3UtgCLoK4+jf r3/eSlLqj8VgiDQQCFXalAkTdUbIMQniPu0Fn6g/YAn6AMnLli0NPqP4UsLP0SNG25z5c4KZiANA z0QGsA+YQ4PJJAshygEopSx4g8n6Y4UKGCCwN33KRHvk4YcC0KH+AAB3RTkXHlBXhDa00l7Qwz0A DGUxXgB6mFAwsQL0IIRJD4DCt5GJAQChpWKH0X6AUbTDmPuHKijrAqKQ649jriKnwy8mXLjjACh5 h/ZnIkrdAadMQjh27tgZwDfv0P4ffNAmtEkfAUxfzX8u9UdWMimkjQFutD8HfY7JJdp76ALw0Odp E/om93hGG1IX6Oc+7cekAx9MwNHgAYNtubYT8vrPkV8d7g28g5sKkzQmGW6dceUI7Us6+Mz3RbnU n4k84ybvJY4V58IH+nKPHucxTMO5EHehv8tAiNkw8eQD9RAUPlvkv6eD6fz2dNH7PPMzmi9po+n9 t+eb3/NoHqRldkr+URoT3/V3PH1+9Uu873n7/cT6Rcv0Ojp/kvEjFR/zo5l8nCf58TGRr/6Ot0sc LZ4u2qb51Tlav7j0XifS5Zc2WR+A79H0yfqV1wnak/WBaJ2jfOB3MlqS9fvEvBNpzY/2xP6Yihb/ rpK1YfSe0+28LGgcrMIAWAgwZstoFNFUUX9McGhSAEQIYO5DI7P41vKVQqOwbNnyoPVC88Ms3lfj Yja+XvsVAkYmyRQ0Z9GcPAGzWY67fTT7RkgCNhDGaAzHjBkbBBZCDU022hEEDEKc8rMnZgftFRpl BD0CLdEV4mzH4UGDBgdadu7cEehhvEST1qbNhwFgoslCW88xYuSIUE+0LryDoAvmsQnjJfzaCkDM CZpcQi1MmTrFRg4bqa0JF8sLK2dZPflBu0+OADETVTfX4HgdsEig8V2/TitoZRLtNHicgkC+b60F 3gBn8D1ucVQ6/KC/DRg0QOXkhN4JmkMtbujXv1/Qlq1Zszr4bfIb4IVmz1cq02fQ6EMLmr2OAkto r7AE3KiNiNG4Dx8y3JauXBq0NxwrtWUOGkP3naT+ADRABHnRF90FgvS7d+0WLf2DxgtwASCnr9E+ hQUwADM+IfX2p00/0ipnAA71RXsNrwDCWEOWq+8DuLCq0HYApI4dOtrMGTPD5IL+D2AbMXSErd64 Oq/+TCzoQ9u3bQ/1pj/TntOloaS/458LT2h7QBzKEeoKwII/fJPTpk0NPEmlcEmn7aNpMgCroBwr QHoaio8nALFcB/1Ur0dV8+mq6QvyMTCQMytPpwORxuOVpVtlZhbp5E1+8ATeUEZ+cca8XPIkvQPa OHqcJ/yPy9vzSleoRPNLp41I4zxJJz30OIiIqyfPqSPCMtHHKL93oR8NRbrtBM3pzug974L0yXS1 JeTpfSYdAeigkz5/6rQ8XROOOBNhYQCsGdNnWD9tWPzxEZkjNHBv27bVOrWXX5n8hPr07W01a9cM mgpAV/euPaTFmhF8jDDdYbYYN16hSXR/qgBFL21wu1shFBAcixYssq7ywemyo4u9qj9m8UcPHQ1a C/xZKmqvN1aIoi2aMnlqnn+au1DksELmqj79bIa0YICvZs2bBToGD8wxKRbGMXXKVPnWDAgaFwAT Woj2bdvbVNHUVz4vVatXDRoZTD9dOnWz7KyJwRenS9fOwc8U7Uq3Lj0EFOWL1Kd/CCEBIFsqc2H7 j7TadU8vGQhLhfoflkYKwDZm/JiQZy98igS4pk2ZFqqC+RrzMkdbRVNfu3KZVegw1r5dMduuLN3K PmzzftAWDdBG2oV1TBivPR5HDAuLUgZppS/msi4yd2H2x0euUuWKwRQ2dtxY69Gtp02ZNNmGDBts 7eUPVqmS6i9w2b1rT/FhnA3SNko7tu+0D1p/YCuWrwi+Y7329rQy+gNkHjlwRGb/zvJfGxXcGvCr GyQN6syZs0IYIbRZ0YOVfICY6TOnB3+/Dz/8QAtrtCBksCLZF9IxZvQYGzNutO1SZHjA1kptLN29 a3fLkp8g/aJCxfJhNTNayj69+gSAN0R+WW0+yvGzRLOLRi1bezMOE6DcvHGzJiQtg7m4U7uO1vtw b6uov136O7j3YDAxUn+0XPSjvtIWLlq4OMgAwBqaMMA7B2MIbhKz5s4M5ui2AvF8L5RTmEcGYBUm NxPyAlUzIIQZgv6nEgwIMXxr3LSB6piZb6qDmSk+Vdia4w4GFzoSPkvMHOIELKpWfHOgg1lQ3MEA hvqevD1AbH7vIFRRGTODhiZmXakOVL3wER8yZkKpwATPUIMze8cez0cUd9BOOLUjvJhxpTqYUTVq 2CjQjNodoZHfAY+hm5kj/ERbEQc+MHExm6SeUf+B/MqgbfDvgP442smDvPEXg/dxwAmBTHsy80Pj EndAA+2JMI0zrzHowZcQS018j/OZxIxE/vQz6EkFVvGPgw7MLpi+3A8pSv9nAbDWz9tiNR5tKNAy yFZrK4836jcIQGG3lsLXeKyRtRPYGDthrFWsUMl69+xj+9aL7qeayeekiw0ZoZWUDRtb947SSu1f Zi81vcP6D1KsvY3brLlMZh3ULm+dect+pb9s/RGuulP1PtakanMbOLS/de/Z3WpUqmEH9h8IfY5v B8GLqYqJEMdI7QfYoMRbNmzUUOXd38qX1VYpC3MEUGEcG+ZvtqqP1tN3OMpWrF5uNavVsv59tNBk xR6r8kjdXEAkn8zXy9qAvgNt56q9VufpN7WSuZvqMNDeqCdn/a79bfNB7VfY4HYbMXq4bd8sc5f8 9jpopVlj/VH/LP1xtK/a096s2dwGDFGIjm5drFoF1X9fTixE6l9Ei6VaNn/TmjR/14p1X2RfKjvF Lis60h5toqjh/XqGFYirl38SiJwLH1ZNX2eVHqsdANTSFUuseuXq0ryMVLT0fbpfK/hijRo70kqX LC2fsiG2QyEyajz1RjCjDR4+yOrVrm+Deg61tXsWW5F6dwV/tI3rtliDhm9Y1+4drKH+LtffJP2x kLRN+c72Vp23w7sdO3W0GhVq2skTJ4MWCN9RTK3RMWJA8+HWsIzaf+QQAb4+qn8VW79m/blU+RPv rpi61io9XsvGsWJV2rZK5Srb2BHjbNOC7VZR9e8hEyJtWqpEaRs9fIztEl+qP1VfCzt62uBhg6xm 1Zo2qMdQW7dP9a9zlwB4lm1S/WvXrmFd+3SwN6yB/Z/+FK43hKz4oFwna/7Gu6q/QKpWT1cvV8sO H/pbHLTEivVqOsiaVG5uw0cPs55MarSictP61LKooMzJAKyCcqwA6VHXM0MNNuQYwY0w9oCfqDRB /HEgiFkJanNXs6YiDbAG8GCARfDECXrU0JgkUJ8miwGWWBaAhtVf+AvECW6EK4IPYEA5cbRgP0c9 zgCBCSDVAc8APuQPwIpG7s3vPdLAQ2bAiUt5E98BKLHqjfrCy7hgtoBD8gbo4XSb6kDbAqDxCPG+ AijVO/idYErivzv0pkoP2MdxGpW4z+byS48PBYAGOkgfB5wBQPCEsACA1lQHvMA8wmpZJghxkwn8 I3CY98C8qfJmIgMIoz3pM5jGEo/PAmAd3HHYelUabi/fW9Keffx5q3lLM1s7RtqmA8esX7VR9urD Za3oc8Wszh3NbOXwjXb046M2oOZYK/FAGXvp+aJW45Ym2kJnix06vceaTXjNHnrtRnvq+SfsgYa/ trHrOtr6kxtNRqacWFgSsAsHrLIaDzSyV4oUs6K3SWhXmijN1rG8qsNzFhVgpuHYMG27NXmilRV9 WvHD7ituHZ8fYPs2EISxcI6Pd8mRvPwge/l+1f+xIlZXezGuHbdVsakUfLHSMCv5yOv28nOvWL07 3lGE86129OBx6111hBV/sLS99GxRq3lrU1s9dKsdVP0bjy5mD716sz1d5HF7sMnlNm59Z9twapN1 0Z+HqZjXb4VVub++FX2hmBW7vYwNrTrJjn18PFTm2LGjNkraoSra2+43dRX/6tVJ9i8VxtldTzSw Zx580p6940Xr8uJQ27uh8LbKObT9SNjy6MX7i9mzjxaxBne8Z5um7Az17FZhkJV8TPV/5hVrcKcm MGPFl4PHrFvFwVZce0i+9ExRqw2/tLXQgdO77I1hRe2hErfYk88/Zg+9+WubtLG3bTy12bQuXdia zWCkpeu1zCreV1v1f8WK31LWRtacaicUi4yDCRKTWiaRPtFfM3Gz1X/kbSv6bHF78a7i1qPoCDu4 tXD87yjzwNbD1u613vbSg8XtmUeKWKM7PrAt03eHcAwdy/a1Eo+pnZ9+xRrf/YFtnLzTjn98wrqU 1yrjR16zF58uam/cJr6Mof47rc6A5+2R4rer/o/aw29fblO3yL/v9FptlyOndP407s/qtsjK31/L XlH7l/hreRtde4YdP5rT/smOleM3Wq2H3rSiz6v+d5awnq+MtIPbz217rMRyMgCrcMaSpLlgZ0bV j7BPpenwl315OVqPOK0O72BDJtZU+QrlYx1TAT0ALBxd40ABeSPkUbUCDtI5qKuvikvHLMfHDsDC 7yPugC+kxX4ep+kArKGdgTekT0cLBAhC2HPGASzAADNMZsQA53RMi9CQjhYQAIOGiVkm5h5AQlz+ /5+9s4Cz4kj+OPFLcrlLLnZ3cXd3J8TdiBIlCSS4B9cgwd3d3R12F3dbWIFld3G3kBAc6l/fetub 4eXtm7cLmyP83+xnPvtmpqe7urpn6jdV1VUAPkwiAKdgM0AovlIvwJk++M0DwB6aT3jKi9kv9RRA jxVszqE33Li62G8uNAmgL9wGyCZMAwAhEq0kzxAaG4C5N82Wa+PPAFi/7t4jc3vGy8Sas2VsqZma iFYjZg/YJLv3/Czz+ybIxFqzZUzp6Xp+r6zU8z/v3SUL+ifKpFqaj1DPE5U7re9Wzd33s4xK6iTN 5nwntabll2b7XpKhmzVswW/qT6l/bEc1ENDKOZr65KcFMuqHKbKwtKa/qrvXosPvU3DB88nG89NB HZrZNqZukanNFsroylM1anqSrK26V9YuOXGpUvb8ov3vsVQm1Jil/Z9lUdbTh26Wn3/bJfN6Lcvo /wzjS9qgrcqX3TJPNUsBvsy0KPNp/bfJz/t2yoikDtJ89vdSW/vfdN+LMmJjYzmsUXMy+69CdsXs VRLbYL4CyzhZXFpTSf34i2zbqIl7M7YxK36RW36KlzzfTZEH62kMudZDpE/Z3tKn1HCNpp6o/d8n aQsiW33u987i+q8//ypzesTL+BqqTS8zW6PF75dVozbLL3t3y1zt/4SaGiKntJ5Xvqwcsll279XV 830S9Lzyi/6XOyDpA5UvezWOYKJmDJml4U2mvyfN9r4kozerT1tw/2emS0x9jbFYIVaTF2sasPq7 ZPuWHbJpc2BMEfaYg50Gc13yRktNM7rSFJmlQTbX1jgoazU/5YnadqvZblZX+j9DJpSeI+ll92vO yc2ac/IXey6ML9r/dM0+kD56i/y6X8/3SrDy48rMCpQfqv0/sEuGLG0tTWdo/2e+L032vyijN7aS wwePinqrBua/gszlM9Iktv58GVE+ViO5b5bl9XfIrm27suwOaZFIZTSqki4yKa1pwjSrwtqEYyMF HC8v4HnfqJP78bIx9P04VBKTBqHsAmaGawlB5paW+/mZsNoG7RVf9miZAAfhNgCeC3cQCQDiq5/y flqXnHCOB5wVIfAHwc1qp3AbTp+AJVc+nCYFQMISZ3juItj70Qggc+Ev/AAcvhQACEATwttP+4Yp i7oxtfr5SVEX2kvAEv11DrDh6Eejw/J7NE2RbD/W/dH8W5w/Srh74CGaKzRH+LP4zZvGjRuZ1hCg 5ReDDrCGKRFe4m/hgvpmRQ9AHHMipkJAlh8tgDBM7nxQ8LEQvPkCrKTjX0W4JkGDtVbYIb/W0FVb NUXmlU6XlHmaY1BToiT/sMvOb7PzqyRphsaqW7tFkipqcls9v53zpTTnY5ymcdm+XFpszy8d5XXp JO9Kg7WvyeyUsbLz6M8yRv/YLFVIm3TZVkE1B7U152H5XzTf3xLzPwNcsbKKucL7xYH9hMFKS/lA +TWV98n0GprsefOJi2S+VvPaJWsKmj3aF/o5u4zmiJynuRdTNxtf7Lz2dW6pNFkJX1ZtlaQfAvyi /Pwymptzqq5C3ZUizba+LZ01B2NnyS/1Vr8qM5ePERWfMlH/rP9HD8ri1mmy/QeRn7U/K8rvlukt FmugSV2kceiwVB+TKqeVmCJ5vo+RD1vFyOTpGjeu6URJKrZDtmt75G6cpv0HkJyobU28po8qF+jP Fo2ZPatsiqQvWStbNSVQUjkdZ+3jVr0GX1bM1Vys6VskscK2wHnd55bW3KKzFCjvSpJm29+y/tv4 p78uc1dO0t7vFvVyMnIPHz4ki1ussv4zninlf5aZrZfK/oMavLNyJdOMo9HlncJ7Rr1TZWlfTc+j 4/+LG//ay2TH9l0nqvtC/5PL7pDfdOHiFu3PrDIpsmqZpoxbsUkStf/GF93nlF1pfNm2foemeNpm 5en/7NIa93KW5tXdmSyNt7wpXeRNfQbelfppr8uClFh1cN8mcfrHtu/gPlnSYrXsrBgY/+Xld8nM Ntr/Q79rcL0dA5At7ZWe2X/Gf2rteMsTeiK3qAbrRHIzqC5WKiCkMP1gZonEyRnB5742w5FG3e7L 3KWmCVce4IHWIBKTHPWgycHJ1A/85IR98AE60KAAaI51vv1jjQhj+Mh98DEcUEHwUjf3wBf81Pw2 /IVY5hxJX6EXjRcaQUCu3wZQdjHeIhl/6gOcoJnyA9mUxQyNk2gkc4bymO6YB37mPtev9hqotIgK Z4Cf3wYQZv5i9otEA4tZkDkWieaNelldRL2Afj/zOX5+zC/GPxQI9gNYjPGvvx6fuYwo2ku7psnU eovVVDJERhacI2njN9o8XtZ9lUyvt0S6FdfzX82Q1DHr5dBhPd+D80ule4mhMoLzIzboN/peGb66 ubRdWlSqDP1YKszMJ5PXdJXWh9pqmMVHLNkx26rpG2Vew+UypMpE6fnlKJlTe4Xs3hFY1BKjjuRV VNBi9nXbpsTtMr9pioyrqaC+4GCZWmaZ+kGduEjWB1TDtqRTmkyrHy9diw6WUQVnSdqE9QYG4zP4 0rU451W7MX6T+Qst7Z4u0+ppeT0/suBMSRu5SbVUukhgVRPtf3Hrf0Xt//j0ztLkUDMLNDk/o//p UzfI3J+Wy+DKE6XXVxqDrP5KiU/dJG91XSZ5CsXKhWVjpWrvOEleuljn6EZJUR+puY2TZXTNqdLt m6Eyrbyuyks9Ntq335wPd33Prr2ypLOOf10d/yKDZPTXc2XN1E0Geu28jn8X44tqcdREelDfFfFd Um1eWP+/mqXzYqP1f/CqhtJmSTGpNOQjqTgrn8Ss6SFNDjeXJ+TxgA+Sbmlx62XOT8kyuJLG1Ppy tMypu1wOqTP7Ys0oUVM/aFur+8Yvnvy86+O3yvwmuvqw5jTp+vVQmVFBU+WsOnEAG1P4og4pOp7a f+3n6ILa/2mbLVXOks6p9lx0LjJQz8+WtdNYgKBxJ7X/0+rDl4GBeTFuk83/QakNpM1i7f/gD63/ sWt7SaOjTSWfPCsJssz6nxq7Tsc/SQZV1P5/Tv9XyJ5fsjZ5blys87/xShldY6p0/3qYTKug769V J27+Q9OB/Qfsmft/HQcrpw8RAhBB5ZbXB/8HCLiVcpTNqpz3PC9ft3IrXHlXN2UAcH71A7DcSqxI 6KBOXsz8j6R8dsvAl1DL+kPVk10+euuOhH5XfyR8pwy85h4/nru+QA+8j4RHblWl64PfPW6Vogt1 4FcemqHFhUIIV37Pbxr0d3dgoUUkfKRuFxYhkvKUiXROujluqwKVn3799IZpCAXIwwEshNAyBaK7 fv5Fjqhv02F1cYl0PxRwh5FfdVVbi1bN5dmn8kn3opoWqZomVi57QH2KtkivwT3lubzPS7eiGtyw muZ4VFNQyohN0rlPR3nm6bzS8bs+El9dz6uJJG3EVhmiDuh58z0t5fq8Ky1WfyxN9z8v41Z3kCH7 RshH8rEFmpw3Z768k/9tKfmOmt2ra5Jg1WAk/qiL+DcrwAxk0rEN8vAfRCv5xjuvy4tPvCITKs6R lZW2y4pKO2W1ap0oE2l/g8t5+1+3QV15/NHHpasK0WVVNTZfaTUFjd8qvYf2knzPPCc9ig8N8EX7 v3LkRunYq73kfSqvghFNf1RVNXdl1KQ4epv0HzJA8j6r/e+bX1quKaAmwudl/JqOMujAEPlECmgk rE36QTJX3nznDSn5bkXNwZgsayv+LJ2rrJKrq02VPIVj5dbqsdJj3EyNAr9IJqm/Iibk/B++J/mf +0RiKi+UlEo7ZEVl7b8m6M5J/12/TdCnBTKDfF2ooDyf90XpW3K09n+9mrz2qq+VZnoY1F3yPZ1P epUYLkurrtOEw2oiVtNZ576dJa+OfzfmS3XO/yZpY7dIfw2/8cyzT8kPA97X/n8sTbT/sWu7S/+D Q+VT+cxigbFa9KXXXpRy+avK3BrLJVU1eEvrbZRdu48FGEyFJRq0lgwPb773hrz65JsyudI8Samo /a+yU9albM5R/5kH8CBj+qtGeqlUrPyDPP3E0zr/B0titQ2SWmaPpMdtlq79O0s+fS76lhwlS6so XzThdKoCzI49O8gzTz0jPYoNlWXV1MSr/V81QcdfV9w+nfcpqTjkfWm17mNpvOd5iVnXR/od1iwQ 8o2lDJqmEenzvZhPKrxfXebVWCGpZbX/9dfrh/bvz7AqMm07rEzAJeHTrz6VD54vILGVF8nKijsl ucoOWafaVb/x5zp7ysKdsnCCmva3q6wM8czw3P22b78uSOgnzVX7rtr6PyfQaPDXJy9ZZ7LgqxPn W3wznLP0gQP77avYbZz3aib4WnX+IdSFOYwAf37O1jkFVu4+aMBE53yPov8DqYyi+6nDAxfs1AVu /auNrQtem51Ao3tUczV15jxZtnqHbFAl1lpVgka64yO8ZsceKfDF15mpSfpqktvt1VST2XKDtOs4 QM7/x9/tWl9Ncru9+hGZ33K9NGnWTc457xw73+GNvrKzxiGZ23S99BswWS6+9FI7/+WAO6XjkTel eUIxWZymwYl3H5RpB5NkYXy6XH/DzVbmrRs/lp1qjlr0w3qZPkIDx/5yWKBph/o6j548W1594x1N /HxuJm0XnnaxxBfTIMeVf5a47st1xdp+Wad+3pH2N7icppmTLb8dkZJlK2e20fXtAdrPQzK/9QZp 065fZv8HfjBJzx+U+a02SqMmXeSsv51p9/TQ5Mfbqx2Rec3XSd8Bk+Siiy+28wUH3CWdDr8tTZcV lyUa2Xy1OoXPOpQiCxatkmuuvcHKfHzrZ7Kz9hGp8cMqOQuTYJFYefanOBk4ab706jtQ3nv/Y7nk 0ssyafvPWVdKSpndslwFbGxP7f/Og0Ifstt/5sk29Ylq2aGH3HBjYCzcPvTjqbK5qo5/2/XSonUv +dv5Af4P/XiybKmm/W9N/zvJWeeebef75Nf8qjpf5rfYoDSPk39ceJGdLzzqXulw5C1pvkxdN9Zs krRfD8rswytl7oIVctVV11qZz+4sJLtrqBa84jqZMUYDW+9Weah+2zt1ld2kGQulwOdfy8UX/542 6V+nXSpJpdZJioLLuN4r1BypuT9z0H/j167APOs3fIJcedXVmf3v9d5I7ecBmd9+ozRt1U3OPi/Q z5GfTtfz2k/lS72f2srpZ51u5wd+oBkbjC8bpEfvsdr/f9r5IhPuk46H3pQWy0rJ0rQNkqahKeYe TJOZc5PliquusTKf3lFYfsW8XHGtzBy3StZqLs51StcapW+zpqVct2u/FNPVjOeee56Vv+H8m2Vl mR2SrP2f0ldNmD8f9O3/Zh3nSSM3S7Ny6rry7SJpXTFB3xNH/nAfcyJl06/Sql0Xadmiee4ALEwX Ll0GS8/xFXFpWDjPCxyfDXxxeIljMsBnBWdZ4qPwVYyjNWUBTXx583XgEskCzHAGZnchDkgngB+L F5RlBabwz3A50/g6xjTWrn07W9pK24A14oWEMnkAsLgfs1V0j/IgOgdOvjnA84kpNzsA67c9v8qE OI2UvnybpKpLznL1D/fd1cKxXK1L61SYVf6xub28zzzzLNVIvCZ9GsTKlOFpkrD+N3nrw8/t2lOP q2bjp1iJG5ouSzQ8w2vvfWTnn3jseelZd7zEDFopK3QVWumqtez8fY89JD+NrCn9F2rOuhVbZKW2 t1Lb0xRsUqZyPStzzfU3Sa3ibWRyt+UyVX13EreoSV3ph6Ym7fvIRf/6HVhcctm/5fa77tPVXUVl VJsFMjVmlSzbuFdS1ELk29es+KE0rVahMlX9aS6+5HIFcudJvnxvWX+mjkyXZev3av8/M1qfeeJl GdBQAywMT5f41bvk+TfetfNPP/mK9G0QI7FD0pSO36TYD9Xt/ENPPSo/DdeUTguHyLyUrdb3FG2P /pesWMfK3HnrbVL+u5byyg9zJE/xODm7TKx83jpORsUtkKq1G8ml/74iU+ifd/4FcsMtt8mXH5aU se3jNTaT9n/Tvhz1X4dDBbnIj006ymmnB0Di31SA33jL7fLyC+9Jv4ZxMmXkKonX5N8vvZXfrud9 6jXt/1Q7v3jVr/Lc6+/83v+fYiRmqI7/ln1SpHy1QP+feUwajdEQKIs0vYt2fkX6z7Jy40HZrv0v UaFmACzcdJs0KNtZYnqskGk6/klbDikI13my/ZBUrddSLtYxd6Dvgn/8U2654275/P1iMqbdIs3h t1oSNu2XFNVj5HT8aWuKJgu/6tobrZ2LL71cXnj+beldf5JMGaWpi9b+Is+99o6cdtrpqsF7XQY1 mSFTR2naNfVJfOr5l+yefM+8Lv30uYgZmirLtf/fla1k5x959glpMq6ODIwfLXPjEyRJXRZSda7q Ql0pVLxiRv9vl/plOilQTpHpc9ZJ0tZDskLnCf2hX6sUbH5XqkomD6645jopVKC8JhRfrP1fq/3X 8ffpf4o+T4tT9kvbOimyJO2grNh2VEYNU9/BDUcy23L849lbtOoXadSig7Rq2SJ3ABZ+Fi+99JKp ZIlMS+RYgAwOyORMwqfFhbbH+RYHaEwApErApwN/Gs4TwoCw+kQ8ZhVUVwVQ9dXZlTLUiRMxOYwA b+RcimR1Gpo0yqEyB+CRi4rVZ6NHjzKndOoCABJTJ1R9UQ3WqaOp+atpZqL0Rjb3cqLBAmBNjJst cxVgpelLfIW+oCPZFScoWNolN91yh5x99t+kQQtd2blNQY5+Pa/8+aik7ToqDz32jFyqgm6eruBa o8IhdfdRSdy4X2669U655fa7JWHtHtF3siRtOyxb1Q7xacHv5PTTz5DRUxfLJi2foou80lQIINRT 9X/6zqPy0uvvyvl//4eMVCCxQQVu0rZDoiGVBHcqxUzSsvPAzC/2m2+7S6rU1VhJsZoiN/0XvV8F 0HYVDjuOWvlI+plVGQTLRm2/64CxJsQKfq958vZovSpo6H+KtvHw48/K5f+9Uuar5FujwC9NgUni pl1yrYLDW++4R5I3BPq/YucR2agLxD78/Fvr//hZiwL910Ve9B9whYBN13LPPv+aXHzhBVKv71R5 oGWShmCIlf9WipUqXdUFevZSqVqniQEeaLpCNT1Fy1aVPsOnyNzkbZKuY5a8/bC2BxDJWf/XKb2j py6RCy8KaNpee/sj6TlkstWfqgKYfqdqmeVb98nd9z8sl13+X9VAbrN+pv5yVJZt+FXpuk7uvOcB SVZ1U7oCleUZ/X/v46+N9olzkkwTuVLD7jFmyyaNlJQ0TbemFvy8L7wm/9S2x89KEsWwgfFXnq/W aylb9suXhUtlgoorr75OipWtJgNGz5CFGo9tldaVbOMfmC/HM/6M/Q81fgoApZfelHEzEySNenWn nyu27tcxvtfGesmqHbI6Y/zj1+xQjdc1cte9Dxm9qUo3479O+/Lex19q/8+XmAXLRdkU+LBYtUmW jh+szxM0H5JHnsgr//znRTJZNVl8TCTqOZ45xeGZ/dmgc6fboPH20YMGF1A6LV7N0N7xj6D/jFlc 3A7p31k1yNCjcwY6QvGN+blEb2jcMhcBFl+On376qYUTIA0EGiG0QTh+AaLYWEHUQlVoH374ofn9 ALrQYKGtQqNFokiCEhLyYIDeR3BNlxSY+wmJz+oYTILeBMIAukg20hAAojA1DtYVZemqSQskf4y3 2wmnTxvBm8tFaPnPPHnoXM47NBou75vL3+fNTefy+7kcay7nG87WlHc59Pgf6phy3hx41ONyAlLe 5aFzOfLcsdO0uNxv7tiPNuqOlFZHm6M9Ulqzou0YWjWJbSS0BvMxK7760ZYVX8PxcU1GDkqX49Hl UvxzxjyQF9LlRXT5+dxx8Pz0oy23xzwrWk/Es+NyhGZXg5VdgLVcBR9gpv/o6arFOF3eyv+p6Aex CTDAABoXTC9vv/+5gq9zZJD6A6lcVwCiqwWTt8oF/7hIfWjeFg0dZGV1oZVgiiiVocHpO3KKHXPe vcwBf8s3HVbQ8owKrVvUbPSLAPJojzKKVWREzHwFdP8xoZf/k69lduJaowtQwP1OE2R1eurOiaCF B5t10VbTdj2sPf4rvjRaaEcVONr/T+Xsc/4mwybNFcWQxrM5SevknxderEAxv/UfuujDJr32famA qXHw+Ol27KUrXQV3mmq5HnxIkxg/+J78s+o8NQlqCIbaMdKyX5zMXKjx23oNlwv/FTCJwfvY+cuN 5/BGZfxx9x86qat4uYCm7fNvSyj9B6xfjL3jL31K33FEXnztXTlHNXsjYrX/yhv6O3PpGgMRr739 gdUFcFZXqED/S1aSM844Q4ZOmGfHnEdrsnTiSFmZvta0pnff94iB8xWbDgXmm5ahvVU7D8u3xX4w uqjjY433NGVhiqxXYEA78O9EjT/AZ7WC/edffkPB/gUyec5yUQVSZv2sHVjF9VfesuujpiwSxUE2 F+MWpAkaxXc0VhpAyGgCrGt/C5eooLSfqR8E8wP9V94kp63T/g83cJykqPNW1cTdeNPt2ufD1ic3 /918BpCnamPPvvi68aKyAu4tCt5VoZbt/gOqJqlf2MBu61UjFnhmvEDOOz//FICFmS5fvnwWSgBn U5ZxE9OIpdYuASRCuJEmNHVBIQEzRBFnw8RI4EgCBhLuHuHAvWis0FwhNABvBM/Df4vyrMIiqScg KdzGS5f4OsQdwkzI1y5LmVnBhRmSFVdo24h5RCDH4KXhtEdZVlghhNjRdLG7Y8L/s4qMYwQ54Q8w kyLU6DfOdoQf4DrCgD6xWopj6MFMyoomjvnPsdOsUY7y3Md16gGQukS6tEN7LvEzdECPo43VZNAK LZybNn2a5bxytAJq0SBy7My3rOByApe24RHHmGKgDTMux5z30oqm0a0Yc7RSv6ONMWM1nKMNvnpp Rcvo5StlucdLq5ePtEWbXj463z5ohDZodrS6ucQxfXR85BgeeGmFR27M4R10wUtHu9+YUzfgnfLB Y+746Mbc0eod82A+MoeyO+aOVvrhxpw6gsecDPXww4GwcGMOf718DDfm1Mf8DB5zxtnRxm/mgTt2 Y869zBtoDX52vGPuniWAWnYB1oTYWTJHgQ/CDuDgt6tCyoRF/ead7CXevGNv0Y9x4by7F2HaqHXP gMlDv7pnJ6xV0HRUTUsd7Nw3RcuZ8KM891G+bfchdq1wiYomYLx08AJPWHdANR8PqbnnHlm2Zl8m vQjYJEUSTzzzgt3/gQbuXLntgNWPEPDrT06uG81KY4uOfazNes062vHyDB7wu0GLrnbt8adfMC3e 5v3qL9WgjZ0DTCH4EVq0z+9WXQbZtaIalduuZdBOmQ0K2GZpwWu/aqGxrSbJ6aWnybtNJkvv4dNl 6jz1TUraJA8/+rTd/9nXxVXzFeg/Ajgn/Qt1D/MDLSV8vvCiS2SWhiGAzuCy0Mt41m7U3uh58tmX VIunSX72HpEqPzazc0VKV/19fDLGv2Xn/natdMXaAV7Cm60ArFGqyVmn2s8jcuPNd8hd9z2goEQX C2RobaChdsNAW+edd7782FjzXyrAQcN1Ivvv+sl8W7pqj9x6+71y7wOP6pgfMQ2ju+6ej+r1WxpN T+d7RRaqOm7TviPyQ/WA1quUmnoz+6j95Hlq0q63XStfTbNmALC1f0mp6yR+QgBgLVPUfv2Nt8id d2v/tx62/nt5T7uM+dCJc017ddc9D+uzpYsN9F43L7MzF2hz6rRd0qe9Ltow82sApIWqC43g4rTd 0rhF+9wzEaLlwXTnoimjlUIAYepzQRR5yXvj+LBs3xuPiBcsL1O3bB2hw8uXjZctQROJ0wNYQotF nBfK+y3l5qXLS5h4OYAoABOCjGPi6LBCkPAAxDsiSGdwFHELIqZtE3ASTRJADd8vwBq0sAMi8eFy SS8JOgqtaPLolzN7Upa2iQ8FfzgGpBDTCQHP/fAI0yrnuU45ynMf1+EpcX+ol/pph/bgJeWhFVOo o5XI29DLvZyjH2gWHa3wgejgHCPQ0PLBL45pE9oQgNSNEIY2+MV1QDLHAAWOGQ94CKCgPEAbkAxg dlnsAdGONgJiYqZ1fMTEzDlHKz54LpmoA93USXnagFbapDw0QAsAk2NorFqtqtFMefpAXxwfATCM C32mPDyAF7RDeXgUPObwkmvQz5jDa47hffCYM0YAdsdH75gDmjGBM9ZcZ+yhnfNuzPn44MOCY8Yc WnkOAmM+9JgxZ+5Bj+Nj8JjjF0l/uE7/+JgJHnP4Qd1uzAGULlwCtC1ZvMTuZ8zhY1Zjjl8jH0du zPkoCjfmjL93zCnLPfDFjTl1ujGvWaumvWfcmMNXxpbjbAGs39RECMBKDPj62Mszgh2hVqxcDTVp nS59R0y1F3uymrTsXv3P1/UitZdgCkFo3HP/I6ZVuEg1LGeedZZ0HzQpALAy2kIbNW3xWvnXxZfJ lVdfL/OXb1Etwe/XEWqL1Pb03yuvlYfV9IiwX6kAhDYR5s079LN2br/rfvUX2SFrVSBk0hNBf4L7 THvUwW7as6A6qBvtUNcB46zdclXqB8BGRjn6v1CdvO5QegL9f0w++qKwaq8uMi1Fn2Gxx/CMvk5b nG7A5Wr165m3YltAQ6fCV+Onyqj43fJYs0WSp8w8+UepCVKmw3gZNWGOTJmrH6ebD0vrLgFwes/9 j8pSdQ5Da3c8/Q81B9COJKk3M+bNG26+XU1Yap7KYs6gMZuXvEVByD1G1/0PPSEfflZItZcXmlaz 38hpRqN3/OPmp5v598Zb7lRhHTDpLd8cAFipq3T16MrdOj8uV4D3vALIw6b5oY5x0xNs3gAqMFWj WUxTm3Ni4hqdi4cCICQHcyCre5gP8epLdsttd8t9Dz0uiesOClorb3nGc9ayjeYrRv8feORJBf6F 5O8X/FPOUa1m/1HTjhl/NJ4xc1fK+Rf8Q26+9S6t/xfTGiWtDAAsTKAzl26Sy/79XwNsppEFgAf1 C9BWqmLAl7FGg9amCU7OYf8Bp8vSD0nbmitkxuxfZVHyfunVWhOsrwvw3ts282BxqgKs5rkIsCIx 0f0vy6CVQuvlXXEIKHTgD58wjtnRZnk3zgH2EDxoHvgfbndlEI5+ZSO9HlxXqLqDaQt17FcGerKi 29svbz2R9DOYJ+Hud/XZwoKUgEN1pLz30uJtI6txi5SPfnwLNeaRjJnf+IenWx1kszEfw7XlN+Z2 74qs5z3jFFw/tGU1Bt72wo1ZJP2jXadRzS7AMg2WAiwNdm7gKJIdE+BXhcuYsBg+aZGsVQEQfB9l Bqr/y7//e5W98N3+8RffqwDUL3BPe7ywEUrvF/jGyv1QvZH5IfESByhwDQGET8lb730ia/AF0WsI mZXq4P7YU8/rfadJm65DRP3lJVnTrEXSj1BlqDteHauHjJsvg8bMUcC2S3SR5R/qo8+j45bJWQoY PvmyiJlFvfWtV+Hfb8Q0ueyy/x7T/wJfFTUAYEIqg9/0ZY1qXTDt0f9KtZrIdgUKq7VM8xgVrFVm SZ5iMyTP6/XkqXe+kUlxC2WGRqJfukojgCvweV1T4HBf226DTfth4OoE74CIFep8dN+Dj8kVCnTh URrAIot2AD99h09VUPC7wz00fv5tKTVZav8R/Bn3wotV6r/15nsFrB816ys4QIuj55dOGCWr125W P6dkBVFny7sffmng00x16uvn5swX35a0MQB8JCsiiR/dX5YrCnag/0TxAw1dmpou8z73qlyiJum5 +uwAKEPN/x6DJ8q/Lvl9wQV9+/r7cjpmx45/oP9H5NU3P7T+o4VT/Kp5DRVgjRtmYH74pMVmcv7k y6IG/Jkz3jbNZ0vB9sOPqZ+WAvnYean2XCarrW/5egWaQeUj4Qd+ZTGTd0qDIvFSOf88aVdbZaNq FUO1vUgB8P9rgHU84A4QRngI/L74z44WjN17HHzd79jd6+rL6ph6vG1FcpybtBKwM7h+R3sktIXr C9f8+OZ3Pbf4Gjzm0OFHi9/1P4vWnPA1t2gLniM5oS3U/KOeYG12uDhYv6kGC4A1Gw2WvqARzJHs vOARlOecc64BLL7AQ92HlqrfqOnmc4TJ4gu9Z9HKnyUdIaggKPMe/U2dQ1Qrc+55fzeNxNhpy0w7 lagpOREwnfqMyNQWAV64l3sGj5tn2osH1USWrN7iaLci6UOoMvRj9JR4eezJ581/5rzz/y5P5n1J Js1eblqEJA/NxKmcpelWLtZQCE/nezUgZDF5eniIwO+rZjz6j3nzy29LKzDZbc7r3v5TL4Ck/6gZ 6rd0rlym4RoGj58rpYevD0RlLzNTbi7UVvKcda58972GLlj9m2o5NO2O1jNr2RZbyXj7nfdL4lo1 nWJa8vI2wjH14xnAAt8j/IfQQg4eNzcgwLOoH4FOn/oMi5MXXn1XtZkPy9dFKmj/dcGBmXVD8Wqa gYhLFZROnKUWAQWZi8cOlXUbtkmrHsNt/CvWVO2/1gsQHj8j0bReOPTPTthk5zS8mYKK3RI/ZpDy +DczQfv1LbvXmddFMnzmWncdbPNU3euOaQcQQrmegyerP9Y71n/8xJapx3uo8adsryExxlsAbJyG 5Finsd0WjxkquuhRmnboG9BMqemRj49g/sHTqQtXqxP8v+QpNcumKYgDDMWrD1uiBqFlYUZ2+wnv MP8tSNgrs+b9ovw8+oc5Tp1ouxYqwGr0/1mDdTwAK3pvlANRDvw1OeALsGIUYCUowOIFjNCLYEew FipWUU5Xh+IBo2ea5iAZARN0L1/JCL3EtftlhqYTWakmH7QeodqgLJoJQAiCBFPgLHWK3qFf8jhJ f6jJgjnfTeNFmUkSUKLtlixf287XbdrRzHSR0B+qDFqyuPlpaqK5+xiNE3U/+mQ+WZK68xja6cei laykvF1uV7+YJDUVoYnw1r1caXT9n6kaJ3hsACgErwzAKEgrqKsp85x3sfzjU/XXqrBALq8+R8r3 nqP+vYHl/Z16jzSNnvrwG4DpNWSinS+swpu4VjntfyT3AWzqaogG2sNXzMy8AKys5kzG+Ceoz9xM xl8FsY1/qP6rMKf/H2jyY+pHKzlXK9+k/o6btu6S19/7Qk7XsAd9h6l5UfvJSrtqdQN+TmUq1pWN jD20AKjUvhY/ZrC2owArHH0RzPVQfaP9HgMn2yIPNEYr1SfMaXGPKZ/Z/73Wf8Y+EwAHtY1GL11N n+9++FXAd0tXjM5dtlq27dxjWslX3vjQwj70Gznd+h88h2i/9xAF46rJLV6utoFQFobEjx2kpsYN ZiqMZIxDlUEriDbLNMoheMa8X5gSBVi5JiFwGmZVIqEfWPUYLn8a2rDuuhAAfxJie7EowC8ZLxoj crlFkrIFcyZ55fBrYbGAn38aPj/47lAe3yW/DZ8YotXiPO6XEgbfNmKfURafML9E2PiUsWCBUB34 5ASbar20cY0FCpiHcDzHR8dvw0SMnyA+a36pdWbNmmk59Fi8gd9euFhrmKXwb8IRGwdw/LL8chey ktUlk46E7/gi4uMFf7jXb8NvDf81fJX88vnBS3ye8Ef0m4u0y6pdfNNIy+I3ByiPLyHzF9r9ciMy H1kEg98c/A+XRojnAl8zfPCYL87/08ubiADWUgVYvIARfD57kgp2hBtmHARBC/V/IrAhAj+rewEW mLL4qg9XP1qh+Ulb5e57H7G6+d+yUy+p1aCVrUi79vqbZcHy7VYXYRxSNurSdV1Z+A/9ap+6QBew oBmLoA/BZQLC7Yia6L7I8GV6RBq26ipN2nS35fbQ0qhVTwvG6u7FpLok7RfVHN1n/jjLVmmU8ix4 GEn/V6jgIl9zo+HL5LSv1KdMkwaf8VFbefu7alKkSAk5+6yz5dobblH+7DBzLnRAT5XaAcfxVp2H HENfTvjgdw9aurh5aXLRRZdaCIJFKbtEQzsFhH2YPZL+UwdBMmdqbLHblKf06T713WrdebBUVq0V mp0bb75Tga76Z7FycPtRBR0fWQyy8dOXGZA1GgBUqiU0gLVWARaAIAdzItw9GgRdktbutVAc0Plt 0R8UaO6xAKTszCeeE1dHpP2nX9MXr84E+Q88/JQu/hgglWo2NN895mK8+jqlZYy/l0bAdb2m3Yye 5u37B8D2hoMKsIaqqVH9c32evaz6y3Pm9+zS34UrFGA1Ux+sVrkUB8vvhX8qX0fI/6ArJnEk9hOW CAyEDU65ODgDPPySA+N0X0ZDWAAM/AQ3QADnaYAbju1+AAtwgpMwggpg47cBll5//XVLUuyytWd1 D4IbZ2rKIpT98uIBVElsjfAGUISjHT4Q/qNly5a22KGXJjj12xDwAGCC1fole8bhu0CBT8xRvlGj RuabF24D4PXRugFwOI+H2wAlAE+AAQsYaMNvo05A8LDhw8zh3W+jj4AsF+ctXHn4x84qRej3m4/w nAUe7XRBAoAo3AZoZh7ixM/c8ctHyapLgCG08D/cHIDOejq3oJnFCS65cfYA1kzVFG0NCAUVRH67 aU74Wh6qqVn0a/nlNz6wYzQTXGMPWUdW54Pa5Et8VGy8Riy/6Q+apHJVfrK2qB+TyBRNnPwPDfuQ 78U3Az5kKgz86A91nTYxNeLjhZP9pNnJsk3NMrr630w8Z6gJEl8fBCAaG+qgvYUrdunKrlvV/Pew mmwCwR51QZ+Zb7JDRxp0rz0i5YaskvMrzFbN1Xz52+s1JM/p58hZHv+1ijWamAA3HzPd0WR9UKCQ gYwRk+IDJrIIxjCnZWiXNvGDcqATzRFgIqd1Bt/H+A6dMFeuujoQsd67V1YwyXU0YYtW4nB/r+1o yDLnL+OTAbCSFGBldywi6Yd7Brr2H6cm7fONxieeeUmq1Gohg8fM0rE5aPMzy2chzBiZ7+KY2fKf K1yE+NMyeVCjftvM8ffSybgwL4qX00Csp52mKapiA3MhA2AlKkrCdBpJ37xl0LZNmb9GviteWWI0 nyVzPlQdUYDlJ42O8zqgpkiRIrZazk9bQFNorxD0PXv0tGX3fhvC5osvvrC4YH6JgRE6rKyrVKlS RImBcTD+7rvvTOvlVzd0uqTDhE6IpK8IYwLN0o7fhs9PiRIljH4/MAbAAkCgdQFEwCO/DU0KQBJt k5+mhjAA7du3t3HqomDCLYYI1wZx1ABAfhvAFGCNFm3SpMmmfQunraM+gDvzq3uP7sesxM2qLbRj JB4FCLG6LtwG4Af4wFM+Evy0ewBVxhT++IExVg4DJtFcwXf4Gm5Dy1i5cmVbUcnKSL+NsaGsW9ka XN5PgzV+8kxdoRQ5wPKCC8xpp+kLveZPbVSgHLKvZvvaRYvgFSLZFMAIi2EaD+nhx/OafxUrz3AA X5r+q5nZTMBpW909q/gwiWRXgLjyAKxiZRTQ4ONSr5U5WHMNQb5UNVP4+Dz46DPWL7RwBvC0nzia szLyyby6soswFyrYkzTyZZL6qkQi2OHRGu3PjOV75e0OiZbu5qySsfJl22nyo/L0bg3IeaZqruj/ u+r7lKAOyw5IQEfqlqPmL3a5OpLPSdhgNOWUBxHdlwGuu/WfaEFRb1Nws1gjXZI3+ESBLHhigHfM TLn/wSd0/M+0xRQfFCis/f/Nxh8wP2PxJot79vSzr1q/ARnWBwNY6uQ+sp/StCeicYio70Hz2Uza +s1Z7ceWcpaOkQOC5513gXz8+XeyQCOawpfsgiwHlvqrKfCBh55UcK/9V+D/yRdFtX8KJEMAJe5B +/dZweJy5hlnybCJCwwIZwIsnSzZBVjQzfPcSjWI9K1p295mdgzVH+bkAtVgNWwa1WD5va9zdJ2v eDQ1fKEj8P2ACtcx97CU3U9AYVZjuT5CmOXrmCHDbaQAIlArX/N+dFAPmqKyZcuaSSaSzatR8NOO 0Te0V2hpABQIz3Aby/4BEZh60MD5mQgpC9AjQC0mLr8NDSDaFEAEIR7CbfAP0yD1ltBYa35gEl5Q d5u2bXy1htTFOKLVI5QD+6FD6mgTZkO7+Nlnn4U0g4W6Dd6ULFnSQlD4bcxbzMmEvwC0+pn9AM2A H+Y62ttwG5pCymH2A8ijtQu3odVFc8WcQXPoN8cA12gyCbESCrxFBLDiFWCZFiXCHSGoL/B6TQKx nlhJ93b+L/TLebIKvvVmKtugL2cNXG3CD5MK4IT6dfV8RO0gMOZrhPAufSdKt36TFFxpQmAFPNyf jKBXEFaxepMMv6RxAc1WpPR7ygXoOqTC7AmLUD590YaAYNR2EBzxaXvlmutuFMw1aI0ozzXoGzh6 joWq+PSbUrJm3SFJbNFREjUmVqKeN5CFUM6CpuV6bZXyvP+cnXJbXQ0cWjhGrvghVip1jJGRY+fJ 7CWbZOp81X72Hm/9X5amztEZ/adOgMZSDQ9/i0asv0XDIQC+OJcTHmTnHiLMp2jqmudeett4/13x KsZ7zkc6tpG0B3/n6eKLzn0mKJDWmIkKdNMA18p7zJLTF23UXIuXyzPPvWbjZYDeAXmdK0v1gzNJ NVvhxsCXDkAbz0XG3D2mvNLBXKBtzMf4Yl1yaSDQLfurb36kNP+SvecqY64YyKT/CZulS5/x6u+l cRhXa+T3jP4H0015wN77Gg2fzArjpmrMRhYSqF8gptJERYMh+xDmeYHPjGuj1oH4XD82bm/PdKgx 5t2xYHkUYPnJmRxfR6uDwGRlE5qUSLQd+OtgNvHbEFBDVOixsRTdz9cIGnqquSxUwNRQbSEg0WBA z4neCImBYAUkEjsJPvkJY0AHPkYI4nAmSMAbdROnyeW99KMfLRqAifhOfqZW6iQWGKDQDxTQLvSg 2cFcFcn4U4a+Qo+f+ZH6oQfAh8nNbwOUME/QHOGn5LcB+AB5L7/8ckgzm/d+6gZ8wksAsZ9GinvR 0gKy/My+lCUsAyZQfNkAfX4fCS6QL+VDaT19AdYk1WAtUYCFEAH8RLDzkgVs4AP1zfcVMoUKfiJ3 3PmAvui/kVLqfN607QDVRMXLguTtWv5wJuACINmLOsyeuDqQLmU1/jYZWjHOcQ/3I1DeUlCHiWbi zJSA9iYC2r1lnLCOnZtqEeaffeEN4wN9oxztz1m63TREz+R73QQqwAg6Nuq0QtuF8Knfsoes0zhd CSPiJFFzuiT2HiNJy1STFYKntJmKJmztUak9SiO7l5+uwUNj5MFaMdKid5yMm7REpi3YpP5N+wS/ rNXaL3YDdhn9pw7A1tT56+TSS/+tqxhf07HQNDAZdGeXD9kpb+BSeT9ozFyL62Txp5r3kPUqjB0A 8BvbSNoLN/4AyQXLf9YFBndqrDFdYLDmQADAe8Y/UfkbSTtZlgF8KLhOWrZJncR/DWjCguYXNBpQ 1vGJT/1Nho2fL+UqN8jMhVm1dksDSgaIsjs3g+e/tu/GP7guR8Ob735iq3Bj56QFfOP0w2HJuBGS qB7uoej3e/74iGnSJhBM98dGHQIAK2MOeu/lmVmQHAVYfnImej3Kgf+XHAA0ASQxE0YCyP5KTAoH sPZqmIZxCrBmKMBymhmEY6Q7AAR/k0o1m8t1NwaCKnp3ABchBG685S6NcfS5fun3Vmf09Qaa+OqN tJ3gcrZyTTVG96sJhZxz85O2BUyH2aCdsgkqLNCU9BseZ3SzMhKh4jRt+JzEzVurTt2XyCuqkbCV lipQTZO18bA8plHa8dsaEZcgq9UfK0FDKyTqAgA0WIkLNIByhlbHS1eanpu34oB83CVZY1tpu8Vj 5d3GMar9myaTpi6X2Ut3qtbsoNKmuRuz6A9aGQDekPGLTIP2+delMgV5dnmQk/K0D8CtXCvgYI8P WIXqjZUvB8w0lZO5lB064P/KzUc05dL7lr9w7FTNZIHPk5dfGSA+O/UeU1bndoIGxE1o0l4SNMp+ YsIOSQTkhBgT5gt9Zl5rikVp121UZjT1JamqWdS6ckxHBHOaOQmgeknTE/39ggtVu7fe/KUS1xyV BPVVS1yt2tUI6vGW4dnAVN+0bSCILwALkyHng+ui7/OjAOuvJBaitEY5EOXAieBAbgIsXrZmJlHB Mnl2uq1iwlfmzrsfVGB1mZoOf/dNccDrttvv01WB7fUlfcCEQnZf/JQH6MxL3CZXXXO9gSy+1MMJ dbeiywEnb5toGFp0CPiZVP+xtQEsdx0hNW3hBovL9dLr72ea4BA8fYZOM/+ohx55RoHUQVmxbLsk DJ4giQvTJVFjNiUmqybLI5BN66aCdviC3fJAw4VmEry4XKwUbxsjw0bNlpiZ6TIv6Vc1hR7+A0+g G0CKAMdsA9/SNMmcOTUr3fWadDYNUk54mdN74PfKTQfl829KZoLql1//QAaMxMn7sPERrWIADP8O WnPaXvB91F9ZgT39L6r+c/Q/1PjmuD0duwSN4ZWYrMA5bqkkatDZRJ+PAp4HW3yg4POFV/Obb9aw iUts3ND85JgWH3AEf9M05lXe51+1aPdzNDZapjYRjWs2wZX7+IDHLTsGUjjV0dRHUYB1It7I0Tqi HIhy4JThQEQAa7FqsDJMECYIsrtj9lLQgzYoSb+a56p5bPy0FOnQY6yUr9JI3tYYRrff+aA5xDug 9dpbn5ggwLxiX8XZ2NPRLM1N0xWEF8orr39oAszMjiHqcH4ytAMwcSY+VxZzV636HY22Zu0GmfnL XQPUzE/abYEfH37sWdF4jbKWeECqtXvq2VesL4BFAp4mqilxWcNWktC2lyTGJCi4Ug0U9ACO9L5U 5W+LSZvk8sozDVzdXi1GGnSLlVHjNI/qvA2yUB3dE1Zl3JPRD4Q1pkBoWpauoUTGLlQwOEhK/1Bf faDeMef3887/h4yNS7K+ZZeP2eF5qLKMecKqfRpAtkzm2BL4k7Ft0X6g+gJphgEcsDHzKn0BYKjA LMPfL6ft00/qGjc1SUN0XGQR1SdOX2FavIRV2ZtLWdKgwCRBHc0TVx+UxKTtkjhyZgAw+8xT2ke7 WLF6Q5sfXfpOOLF0ZTHHk9YetGTYLDxZnLInoCHOxjMVXJZ+rFN+OoBVs76mnlMQG4q/vDt4Thqq ti8apuGUER3RjkQ5EOWAHwd8AdZENREuUoDFly7C6Th3AAwCFBC0inQmABv9P0vNkO26jJSXX30/ E2Q9+/wbsmj5DtE4iNlqd7UK1xET480M8/nXpQ30JCFMgmgHEMWv3CsNmvWSgoXKqbljoAFAA1la lnsQ/uUrN7KgkZ16TpA1OLhn1EO55WsPy+Ma9PKCCy6S8SrQV+hKrkJFKlsfbld/swVJOy0nX+KC jZKgQVcTMQc5XuIrlaJ5Xuevl+96r5DTS2loi6Ix8lL9ydK1/1SZGJMoMxdvlyUpKsQdMMj4D8/g y/AJS3SFYy2l4QUztwabYb/5/gctd0SS0VIc59hl936ELTSmaPt1G3fVxQDHhta4SkNe4Nf2hY5R jbrt1Fk/VmJnr5KFyb8G5gd+Qjmkm/4yvzCPwhPm0lJNOEyd2e1HyPJosDTcQaKOeeIQ1WSpb5yZ fH14bABLAXeJsoFVqb0Gxdn8TNC1Nlndyzy0Hf9CtyswZ/7x4eDOhfKZWq7XN6tZcpiaizGX4lzP vD/e+QC965TuVh0D2t2a9VrLetVoheoH7475iQCsdlGA5fdCjl6PciDKgVOHA382wAolRBAeOMKu tTxxh6VB0+5y2eWBHHWfFSwhqRsV9GRD0ALaeg+abpGtS5ara/V6ARZCAAE+T812r735yTFO+D9U bSLprLbLEGoArGJlapsvU8+BUw0Quj44AFasdCCBLmEDnng6EFEdYdap52hr2wDV/A0BjUeGEE7W +ldpO5MGzZKni6mjcJEp8vfSMfJtqxgZNGymTJ6Wqpq+3bI0Vf1jnNBWuhFW0DRqcoJ89On3trLR C6rQtP3nv9fIw4/mldIV6suSFaqtQLPyJ4Mr1x68RsgDbGJmrtLFDXU1fEMgUGjwDiC+5JJ/mzaw dIV6MmzcEgMDtjowB/Rz3zQFrzfdfJe19eY7nyrg3W6A5ngBBuOY0HuUJOiq0ISBCrRW7g+Y2nzo DHwsHJB7H3jckndPnrHK5lvwfdBH3wGJ7PTFdrSd+DYypzTZMvPBeOTdM8pyX/KaIzJwxGx5RHkK D6rWbmGaJz86/a47gNW2yzCrt4aGo/ADWD81jgKsU0dyRHsS5UCUA74cCA+w9si4iTPCarAsR6EK UBOkKsjNFBfma9zvxQ0Y2Kimhj6Dp8jF6ttEnKNu/SYfoznyqwMA0q7rqAyB0joAcjyCDyG3RJ17 X3otv5XB2f6qq2+03xdeeLGMVs0RAMwBqO+LV1OAdab0GzZD0I5560LoYX4iFpYDDEQVr1G3rYEx E+Roz1JUAC/dZb8Bi2nKpw5xW+TqqpqkuchUuaH8eKlZq5OMHrdA4mavUyDwm4ZeOJLZFvy1FYzr jkhtNVk6AGo0K8h64qmX5IeqTaVb38kyJiZZtUB7jNb/Jbjy8gleAgTQAM5YuEU69hwn35eoIQ89 +qzy7joz5QUDrn/96zLTQMbNXWu8DKWFjGQuoCWiLup/9PHnZKD6tEEH9OSkTmuTOT98mvpg7Q74 XoXQkAbTBtDEjFarQSCd0LPPv6kASRMte7TD0AMYTdU6Z6ppvv/wuepA3lVTHVXRPI8FBT+2vM+9 IY898YIB0cefetGOX3rtA010/oV88Elh+bxgKdvfff8r02ySf5D2brzpDpm+YJ2BMT+++V13AKtD d/ecNZUNYTVYP0sUYPm+jqMFohyIcuBU4kBOARaCICH9qAzpsUkWLtU8eyoQpk75VebM35vxdR0A WkkqjFbgZ6RChK9thAznDISFAmJ6Du3OJjWj1PhRExirYHj+xbcVKBy0e/1e/FxHQ9GoRSA+T4Nm PY4BWLSNcC1Ssppdv/zfV1rZJSu2S4Evi9m5yjWb2tc49FG2lGpTMBF26xvzB4BFewhEQGC+F96y vUmrfiYgjV7Xzwx/q1SW46cfkfKDVsk5ZaZJnu9j5OlG03Vl2TgZ16yTrvDaJot1FWFCmvpbeTRX gMLkNQfl6+9+yAQiaKq+VRPgCA11kZiu0cEV7AEm0YwBrDL5nAPtTyR8zlaZDD5AE7yBTvq0NHWf Aq5NCl7nqOayl8bNqirPKQ+JwO8A1y233iMDRsyysTBAFCmAZ/5lmHnbdh6m4REutTpZlFCibG31 bVtn44mmx0zgbqy8/7PiHQBr2FRJXKagGRAdTFNQHen452mf23YZYXSgaWzTeXjmh4MBaHzqtNzA kXM1vElF1fTdbyswQ2n7snvuuutvlT5D/viBkK0x9PDCAaxOvcYGnpkajaMA61QSDNG+RDkQ5cDx c8AXYE2YIdMXbjWwwEvV7WhmEnRFW/lXZ8nQnptkrYYf6N16rYwdGkgMTfl1KlAQ+pi5Fmh8goXJ qpVJPWznEJZOqHnrdb8Rvos1OOGtt98r52ksqzGqVUIQhiobfA7fkOp1NBmyvvjbdB5qbbkyaKaG jFloy9XPOedc6aiO9nx5ozUbE5Mk559/gbyuTtgIOoQzArhqba3rNM3n11EFIs7iHj6Yz4nugIZ4 1VKxQ2cAgP6+U2aVCvFpyzQqe7sE1VrFyVllpsrH5TpL30btZELzLjJbI6DHK2hN1OQVwbxO3XBU ChWtmils31Bz12g1E9IW/ATEAl4i4c/JUgYeMQcYa/hNXwAh8SsPyFB12P+6cAXTKDKOV1xxrfQf Nv2YsYy0HwaydNy69pkkN9/ye7LuG268Q4FWLRk5MUHn5UHzKTJe4tsEEM4AcyHbgdcKrhJWasiM EPOBseAZAFgxh2ZpZHnMo+dpHCr6U+DL4trOYfuYSNDxhgfx6o/3XbGqFvbDC6BYGPDfK65RU+ed ugL3IVuZ+lTe1wyIPvH0y7pS9mmN9/Wg9e2GG2+3NFLXXnezxgG7y+Kzla34k2pZVxotzMNI+Rau 3DKlmbEi0C20/lD1J/so4XzwffBhfkJUg5XjtzURxUmtwk6cILeHOw5V3ntv8O/guvyuZ4cW6vKW D6bN7zgc3ZFcOx5ag2kPdRwJDZGWyS6twfPBbxwjpSNUuezS5lf+eGjxuze7bfvxLZLrBKYNjvzu B7DGKsCaEQJgIXyWpRyS5uWTpOOPaRoGQRN6d1ov40Zss2XosxZv03QuneSrb8vKq298LE/nfVWe fe5NXUFWQL5Wh/JmbfrrS3d3pv9JKCG1Xn1FqtZpaS/wWvXaZToD+wkIfEzKa0BH7usxYKIJAl78 0Iwgz//Rt3bt+xLVTahiskOoLkvda4EpSRqMsMN0Azhr22W4la9YrakBMdpHADtgALhyYMEtBvDS iLBN0/L9ZuyUW3+cr7GtZsjV1WZKpS7TZJimvImt3UDm9x4rSzUMg5maMoSg06ggoOs17mY+ZQSK rFyrpWn0OB8Aun/93WmATOOZwXfAzqCRczSK/tMBE5eOS9ycNTaG2e0z47NWxzJuzmr5+LOixkcH YvCFeuHl/FKlZjM1Tc/QCOm7FRwdsfF1AMn8oHScObeSILoW60z3jN82F/TY+UwxJxJXHbIPg3KV fpJbb7vHA44/k6Ur91hdbi4layT2jzSEiaMJE/C77xeUanVaq+Y0TgFSuixSc2RC2j6dH/sVTB/U OYd/nmo79ThBg54uSflV/Qp3yvT5m2Xmoi32gUIZaDE/rxM4T3ieMMV31UwK0Fyuct2wAGtebgMs 92Ij8rKLvuxNL0LkbKJd86J058l5RoRqd8w1bwoTAh96I1dv3rJZSHzsNtohUW6kwRFDRYUGPPml QSHSNnSRQ5DI6tDEbyKUE52c6NNElOYcx1wn/xvX+c117nPXiYJNPzjmPu6hLPfQDtHVuUaaE34T rZzrnOOYyNj8pg7qd9dpw9FJeY79aKMN2mXnN/U5Wlz7tEMb0Art/GanrPeY8rTvrkOno5VzXKOM o51jx0vaoC7HR2jnGN54+eblI7zw8tHxNRRttOOlLbu0UncwrY738NjxLdIx5x5HJ7+p34259xj+ cez4xj1evtL/UHx0tAbz0R0Hz0d37MY43Jh752c4WoPnJ8fevlAPuxtjL630MytaQ425OxccoT8S gIUGCw2J14SCYF+cdEB6NF2tmqt1Ejtpl5kLxyvA2qjarMIZK+nCmTIefPhp6atmCzP9YH7Ql7Zr g6/61SrURulqwLM0vccHnxQyYXeMeTGUSUfPAcxKV6hjL/5+Q6cEtB5aH4KZeFKYn65Uv5/ZqlVA KHINkLVSEzI/8fSLltJk3tLNJkQRTOM0UCimmgceflIWq5DbqF/qCWmHTdiPnrTUtAPwh526vHxa CXjT8Aq1Rq6TiyrPkTwlpst5+RtJsSqtJGZaskxTH5ZF89IkwfnFePrkaI7TlXX/+e/VcvppZ2jI iA6mGcTkam0FtRfSzJUFn07asmhBMgAxfZ29ZL08/Uwg7MX7H3+rY6arIp2pMNK+ZfCKOQBA6qUL Ft545zMd638foy3CXwkn/BdffU/NyNWlQZNe0nNArAwbO1/GT1luYz59/kb9gNiqc2SnAppd+gGy 2c5PnLpCBo+eLa07jTRt1VN5X5bL/3NVZv3kIfxGtXJLFPi4eWdmaAXKLdoPMbMhGtRCah4cr+ls luuKVqdVI7q/mdkz5hnz1T4M2DPOcZ3dAcAUVhqiiUPbdoLnCfUBWHv0j7H+lf6hdsBEGKId6ANg NVBNbetWLciMsjOPghR9TMNv7uUUt1Jr9tkQ0BUrVtRliq0shxhJXnl5kqCYxMMIBVKOkI+MFyrg qXr16pZ7jkTDgBjuJQ8ZOdGoj9x7P/30k+VfQ2BQLzv55wBrJJsdMGCAb3JawB9AjrxlJJx1gIz0 LbSJgOJlTr68UKlISMFB2R49esjYcWMt8S7tkrqEdCrQSt969uopU6ZOsVQslsxZU9bMmTPHBCeJ gDlHOfpPmhTSqpA+hDrIvQdtpPyAV+SEAzwi8MhDx3VSw0AfuQ9JPUJ6nvnz59t5rpNihPQl0MYx 6XKgjbxu0D5p0iSjp48mAuaY3/CS3+zwiHP8hlbaR3CRw8/RCj2kYKEN+ACtXCPlS3x8vKXz4V7u IY0KCZbhw6hRo+waKXmoH34AKhxfGXNABLS6VD+0FRsba30lBRF8oxz1T5s2zcYM3pDYeNasWcYr eAEfoQ1eQSf00jfGmRx6lCH3oqMVPkIn9NI2dQIESGVkY66pYbiXcWXM4SvHzHHSuQAGaA86Q425 o5124BX3QRs8ov/0g2eFMYdOjhlHUu9AJ/VDmxtzrsFHx1fuZRw5JkUOfIQf0A6t8MXmp15nrsFH 5gr18WytXbPW+gFvOA6en9wPLfCR+UHf3fyEVnjHdeYltDIPaIs66Q9zg/nI2FGePtN35g7ladPN T++YM/aUDzXm8DF4zHkWsg2wxqsGa/4We5GbMM/YEXBLEg9It0arZNqUX6RPq3UyoOMGmThqu2zS OD+Fvq9kWoJrrr1ZBc2r8tY7n8s7+b9Sf6p35IYbbpfT1bHc+UD1HjhNVvOF7amf3wiIJeqsff0N t8o99z2u1w/LcgRrULng4w2qlSpeJrAMfuBwBXCY9TS1JsK6XqMudr54mZqyXsu5e6mXKOrPv/yO re6aPm+1HXM+Sf2bHn/yBbvvyadfUa1cKXn5tQ8F3yBWvV1x5XVSsmxdWwHppS9N752nIPSTzsvl 9DIa36roJMlz3wdWz8UXXihtu42WFA2zkKBxrnCaDu5HkgpfhFgJDcNg4OLDb41P8CVR++PHh1Ph OuPGOMXMTFUz2bVm1h0yan7I+RJJf6mPuQx4X6mxyKirjK62fPixfBpq48KQ/k4kVP773/9p8c4Y c8x09z3whDnMP/bEczo3H9P4UvcoaL9e4479rhlzHxcXaMqg11Vz27X3BJtTxDxz45es4AefuXff /9JWqtZv3EXWkf4Iv7CgZy6S/v1ZZeDjWn2uevaPNZ6VLFdDNipi4nwwDfRj/jI1ETZqm3thGsgf 99prr0nz5s3thchLlA0AVahQIdMSbdu2Td54Q+N1qNBAW1W+fHlL1Arw4RpggxcziZN50SLQAFxt 27a1lzovd5IHIyB5eX/++Wf2AvfbAFgIJABD69atTbAiFABoToNGe4A3XtrBGy95EgQjgDp37mxJ fb/99lv5+uuvLYcbdAHOoL1ylcpG/zfffKP0fW55/hAgJAHu1bOXCRIEOKCS8oAFkjlT15dffpkp hOAZ1wEhxYoVtevff/+98Yj2EY6dOnWy/0WKFLHrlStXtrqhrWDBggZgETqASEAI98Hrr776ynb4 yjl+f/HFFwYeOAfdX+iOEEMQQ2vXrl31uL8J1k6dOhsfEJyAGe6DD94kwLRN36GPPgKy6Ttl4SNj T/3U446pm3voNwmrGWf6SNvME0AptFCGviKkOYb38JDy9Ic5QyJt6kOwMwc550BxrVq17B7a7a30 Va1a1e6DPs7RFnTTLrRDK/dCK+dJogz44nfhwoVtrnKN8YN30AQAdHOCPrsxhx7uA7gW1yTSzVs0 ly1bthigYsy7aD08C8xXxgVQA+BhrnIfHyzQ5fgIrW5eOj5CK3zz8hGe0b8KFSoY36iPMowLfHXX uQcgyDHtML7wkf5RnnuZk8w3+sKHEuCO+cM1eNG2XVujiTnAM1WsWDErT1JxABXtUZ4+ci/PlqOV OeXahlZogZ/s9N3NAe+YQ6clT9d3Q7ZNhBkAC+DAy9PtfBUDsDrXS1cAclj6tl0vLcovl5jxOyzI 48wFugJq6EyZohHcFyT+HPBVSVON+vI9+sWv74t2Aw008XK+9bZ7ZfaizSZ4vG0gfJYraHlEE+X+ WzUBvKQBF94yoX6vVyBVpEQgFtVgVoyRFkRBWbpqqwB6JJ8eOmaRnXf30xbC7yWNsI0WI07p5pjr lOvYbcwxZqU/auZOk4YaT4uyyfhbKZ3D5vwsD/ykUdlLzZY8X2pKkf/eKxddcIFce01gxeK9KqQX x2+XFDUl8eUf3Bf6ulTDLOBfQ16/cbHJmWAxVHk/vvxVrzN2gOYfqjQ2vhUtWStzTLPbJ/Nvy5jH zGmADGO2IGGnDNegrjXrdrAPAVboXaN+TPg/ZdehnITKV159g4Lxl6RYqZoK8merVvOAjR3zLHiO o3HKq0mp//HPi3WObzVQvTTFf55nt+8nsvyylQqwlG89NHaZASyN68UYcT64Hfg8b2kuAywAVIEC BUwo8OLkRYrQQLDzYmU7cviIleGLG/MgggvAAyBh48XNy9YlvwUQ8SJ1SX/RbvBSp61mzZqpkK1k gIuv9Eg2wEbt2rUtmTAvdO5FcLiky2hVHDD01seXNMIF4UFb7AgC7gVccQ0BSnJj+gCgQhg6rRCg c/ac2QbwJk+ebGCAr320Hq4+6kKQocEC5CFsEZ7wEM0TwIj/aCgAMghojrnfCW+0E4BSBB1CCtoQ xNQLXZTlHoANfASssXs1Lxx3VrDRT8cNXiAg0Z5A6zgFznWUfysV7EIj7QKsELKYxgAVDRs2tKTX gAZope+//rrHrqPlaNe+nSVDhn7GgLbRRjJfoBna0Rg6UAvNjD/aDgeAOQYkM35oS3bt0pUuCpjr 1KljQBx64DW0oT3kGHopz9yCNvhAfb/88qtp+dCwwVfahlZACqCLMaUOxpK5DK20vW7dWpu3zPeR I0YaHfQFfjPPmJ/wn2eBcQHUwUfOMT/4D8AqUaJExsfELANrAMutW7cafYB0+gDtAETmLbQOHzHc ngv4CG39FfgCMhytzKWBSj/HgDP6hRaO8mi30AyjRaM++MWY8aEB3dDKM+LmJ2MIX+E/48ucYA67 +Qk/eW4A9IBa+sWYM0ZOW+VAkWlUN2w02gGjgDcAJMAYWinfsmULm6duzAFOzEloRatIG/DUjTn8 oQ/kUmRcgs39viZCBVjTVYMVCmAtVoDVtqpG49bEudOn/iIl8s4wEyG51Vaw3JzYPJg2MFXoMTtf s5xDiMxdsilTM1Snfif7Ig4WPtyLM++FF14i0+asl5WYxjxAL9RvNADfFgkkmR46aq5pO2g3fsVu W6p+i/rDLFUfKy9YQ/AB8F56Jb8ldo6dmZYJ+NAkca1ZqwHy5DOvmsYir/qTFfqukpqQOmigTIJZ nmYCdaVG9l6tNDYdt0kuIyp7yZlyzifqJP93zbl4zbXSSfPQTVRTE47K0NddNQAI+YQQggmT6Kjx mCfPldfe+MT4CXjz6/+peJ05M2X2agO/jz6eT0H9gT/MyZz2G9DFvILfgPA0XVCwWP3hxkxOlm7q GN+kZS+p+WMrKVG6jnz5TTn55LNikv+Db1Ur9am88fZn6jtVRAPVlldN449S9yf9wO0+WkZNUMd5 DWLLmFEn8y8UfbTN+AfmUB4pr/5aPBsO3Oe0T977/LRaOWnDAayeEQKsuQqwGqgGK9dMhAit5557 zoQmGy9JgBUvQIQTX5a85J966in7GuUFXqF8BXv5YwZEqCBQOHb+Pp999pmBFwQe5T/++GN7KfOF DxABdCC4EFjhNl66gDru69a9m72oEaCYTaZNm2p1IjgR8GjGgn21AGAAQa5BA1/V3MvLnhe905wg 5BGGCEEELVoCzJEIP8ogWBBECA0EFwIaQYVggU8AOWhE4NEvACiAAzCCxob60f4BQuEvWgHa4Bxf 95idEDTUg5AExCL8aB9w88EHH5gJjjqpA54zbvQboUzbm/W4qYIDZ3pFo0W/0QIBABCAaLXQTqCZ YLwQqvAIoQ2wQFADcBDWCFt+c53xR5sGvRwjeKGfseUYYQut7hjAgibEHXfp0tXAIsdoPhh/gBH1 OU0dwCR+SbwBAdoGFAB+6DcgBQAKPZjtoBVgQdsTJ000njhNJ31mvBytjB98Ygxom/EDDMGXatWq Gd+Z+9DEmAPOvGMOqOEe5joaR9pmjCtVqmxaMvjImAGq6SNzAECI2R0eMP+gkx3+U97RBg8YJwAc fQtoGTsZn+ifM1dDO/fDY8bX8dV9IEATzyB8oo3fx7ylzTc0feW1z442o3XIYCvHDq2Ad/gGHfAa YM/84N5NmzfJvPnzpEyZMsaHGjVqWN94VqCFe3r3Dmg8He3w0Zkfg8cc0M98YszpJ3tOTIQArGBz BRqs+OWHZGh3ffekHjWfmDZVlsuUGNUyYQLJMOOFMhnYOd03q2fFANVykZPt1dc/MmEEmMk0Q2ob CD4HeuJmrQ6YV8KYCLkfTcGX35RSk8sZMlIjWDugFzdrla3QevW1QFuAKm9bCEJMOWiLJqg/DULO NB66mylHry/RKOPzlm5VPxoF30rLZg0ngU/QI2piwuw3LjZFSg/ZIKeXnKKaq6nyRJVhcvFlV8h5 55wtXXppWhSlbauaUNt2CjjOY1oEEIbqE2VbdwgEcqyjvlcbVDMXip9+AvRUuA7/mQsPP/Ks/Ff9 0eZq5H+OT1jfMkxbzJ/l2hbgm/nAXEIzw86ccR8LaG0TUtXBXPfl6mMHLVynHOPJb3yPAMR+NFK2 jwbG/du552t6o7+p1qu6LFi2zepJ0znmzM4OCGWah4M+NGiH5xAauQ/6mbPUz0dGqN0AIB9CWs5M zxkaPj+aTbOrvOmjvmyBeVw9rIlwnmqfGzTMRYCF1gLTIC9VXnLsvPABHICrgwcPGihByFKO8nx9 8yLH0RyhxG8AAV/ZaB0oR3kABiCL3wgpfrMBmgBafhvtI2gRcggWp0FBGLZXjQr1IYQBDQgPryM9 dfM1jcYKgQgQ4WsegYag4KUOIHTmG/5DF4CJ+gBzfGEjdDgH/QgdhD8ADUGP0EOTgVYJIYPgQVuG pgCa4UvRokVNcCLIEShoFZy5E4DIdeqiLwhMzFjO/wuhB+0IM2hBuAHY0I5BCxo1rvMbflZSQQkf nL8XghcBCpBF8KH5oQ5ADP2nX+yAHMa7dq3aBh6XKNCZMiXO+kM/qJsxhS8ABPgE2KtWraoBLfiK lghhDAhgHsATjulDWlq6gXOOnamqldZDfcwN6ge80h4gkzGFDoALWhDog2/wHbo5R7/pK3MVfnMv AANtCMAF8IQQhzfwn+MePbob/cwl5in1jZ8wXho2amj306/gMU/RecCY0xa0wy/aADQAVDHVMe+Y p5iCGRMAMCCUucN5aIX3jIEDudTJHEObCG3t2raztgGrzvQJXwF/HPdS8MIxYJFjwAvlmUtOG0x9 jDn9ol035pzjOYB2aI2Ni5XC3xW24x07tltdPBfME+hnzJ0Wu5jOTwAR48tY4yLAdeiGr3wgMNaM 8bFjnvaHMYf3jDnPUvCYB78LItJgzVOAhe9TBjDK/K8vY3v5Z5y32EtoWFQb84eywffqcYp+1aNJ ul3j/bC8HH8rbzsIVcrkU20RsYOmqa9SKkI1RF3uXBIaARUmn2pMq7PP+puMmbQsU8gMGxNvIR++ KFjG/F4MzGXUhSAk2fIXBUtbEupBIxbYfcFtQc9KnIpxHta2lqkpZ5P6nhQvUlZOP/8Sua2ixgUq OUOjssdK6U6z9T0TiLeV/4NvDLDZSkZihilY/OeF/9LUQB9KOjGuAI1B/cIEU7tue7u/VftBZpKJ hK+nYhl4DZ+IvE/ohpjpaw1E5HZfTbOYsUMD88RM1+wZWlmOOc/1zPJh5mgwzdzH3CiRkRGA8b7/ wSelbsPOMmPeWm1Lk2MrmMH0vUbnLcAJXjjwxLwA2PEfsLdQzZ0z569W7edSNW2PlwaNe0hFzVBQ XM2VhTRu2teqbfuuaGUprY74tet1kC49J2nmgBR9/nYHQBgfOiHmo5du+olpte8gjeUGwCqjAEtp CPXs80xjIsxVgOUHck6G6wAr7wboc9oqt/qR/8FfwWipEEputZb7DQhywtStvnIr69yKPK6739xP OY7dKjZXB//dCkJXF+24+tw56rNzqYFVba4eTEFuVRb3uXrd6je3Qo//rl5XnnrYvcfU61Z8uTZc e15ecM0de/vJOe+x67OXP97+uXrCXXf10QdXH/9dH718db8joc1Lq+OPH+1uHOGZ8Xrl7+McyZi7 8XRzwjvm/HbHwXwLpjXdw2fHFz++ZsXHrOanGxs3r4JpD57zHFOXW+3o6nUrYN1cczw8EWPuVttm V4M1BhNhVgDLObRmCBO/l3KwYOHFi/B4UmP5kEdvpubrA7y4cibE1D/pwYeeVK3Fteon84sBLj+A xVc5S97RCIzT2Fb2Ja/nBo8I5GP7uvAPJkiC6UWI1aoXADRNWvQ3oeYnwJfjH6R1f1VH09182ElD MEyX6yvHSp3OU/RDb4m88MLbpknrO0RjOFFfirpJrD8iC5N+VlB5m9x9zyOaIFdTnrCKMAjEosGq 16ib0dO8db8APRGCVz+6/2rXDYQooHr+xXctKvvU2bpa+E8AWH8GnwAlphnT0AslStU6Jrjotdfd og7wX2vQ3TbSXtPS9B08XU2XSfrhkKQAapkMH7tEevWPk+Zt+knl6s3l40+LyoMaHZ8FARdddKmZ l09T83U4P7Jz9Zm47LL/ymOPvyA/aN7NMZM0vlqGmT+r/kcB1p+I2JyGDf8ctFn4g/Cbnd9o3/gN gMvqOue95fE5oTz3u/q893LO3ePacvd726dtV87d7+rmmOuU51wo2jgHHVnR7qXD9TUU7aFoc/dS N/c4Whwfg2lzfMRcSxnXN0e7t6+Ob1yjvHccsqKFMq6vXr67trzj4Nry0uLlI3wL5qcbJ3c+eMy9 x94x9c4l75g7/rm2/Pjo5Su//fgI77x8dPMxmM9uXBxfuS+Yfi+twfPZOx+9fPP+9o6xo93N33B8 dGMC7dyXXSd3X4CVjS/1UAArKe2g+tQ8L5dr3B8c3b0ACzC1KFFXEV5/i9x110MKdo6E1qR5aHCa jvc0rQgrvyZOUWBPPCPdJ8StMP+q/KzGy/Bn8tLEuf4aNoJ4U+/k/9JAmJl4suhjqgLApJVHpIJG Zf9HpXlqEpwpj1QbIx37TJGY2BUyaepKDfh4i9xwk8bV0jhFy0fMlISGuoiozzhZlrhL7rz3UblB YzstVm1DysxkSdDl/hZZO6M9NATdegeWwZfVaPKYCP8MgX8ytgHYTkzdb8E08aNbrAA1czXlcczB k6WvBrLwT1TQ2LnHOFuheLYuxjgGGOm8BDRdq4FEWZ17lTrSA6SY01kBKFbrsorx0sv+Y6sgr9YF FoF7r9eFI1eaTxvz3Xs/aaOqEmttjboOZfFBA71ozHoNiMt0co9qsP5E0HWqNRUsmP6X/csuLcFa i/8l7dlpO7v9zE7dlM3N+nOzbmjP7phmRY+fiXDMuOnhNVjHIdwAU4sTcTy/XQXnXerTtfcYAAUo mjhlZSC6upqGKB8O8CAsMftxHwALweIAFqbFhQnbTSjhpI62INjsiTBZoKaM6xTQIXjGx+piDRzv g7RGSdrOKi07Y+k+eattouQpo/Gtvhkpf3/iC2nReqBM0aCQS5L3y+gJiRZW4PW3PzdH5sS+4yVx drKsGDlbEnQV490PPSPXKmBY0GmIpLTuIcva9pHEeRszNVmYjWJnrjHzKGEBkjWgpJ8G72QBDCea DoT5oBFzLG/kaxq4NnWdJgD3gNET3d7/qj5nqsbHr13nEfLRJ9/LPfc+ps9A+NWMhHggvMgddz6g ZucPNJRIGTULNlYH/X7SvU+sarriNU5Xui4U0bBEc9UPecY6jeGWLL0HzpBGzXtLMTVlY4rH/9CB LZz6V2rAVfNVDHrODWDps9FdFwFQvtwPumAqnIkwPmoizK58irg8ZkX8ovAPwvfHb8P/BMd//F78 VkBiZsFvBz8vfIHwKwq34duGfxR+LJhA/Tb8v/BTwh9mqvrI+W04xePjha8NjuN+G35N+MvguIyp NdzGYgScmvGTwr8mVGBY7/34o9FXaMd3zU/o43eFbxD04//nt+FvRHl8i9COhNugmzmA/xE+Rn4A Af8uxhW/Jkx7fmOK31FV9VOibrQ94Tb4wPzC92zs2DG+84BxhOf4DzK+fhtjia8bNDl/yKzuYa7j 0wbdaIL9NrRu+Jzh/4XPph8fMS/iA9ZcFyiE8sf8XwEsXtCAl5HjNJCoOrm/qOERAEbObOeud+4x 2l7gZSqoM3gEJjvng/XJ50XMYXhshg8WgmulJkp+8aX35Oxz/iZDRi4wAREsODDjsbSeNl969X29 rqs99RzCnLqXE4JBwVXf6TvljroLAiEYPlUz3r+uk6cefUqmzNCI24n7zD+mW69AlGvCCtgKycGa uy59n6zQsBXL1NRzl/rZXK8arEV9J0nKak3srEmjE4fOCOS2U4FGmyvXHtYI+G9ZEMp2nUaYEPtf Cf//VbuMHb5H+T/8xvhZt2HXkGP3v6IvN9oFSJu/lT4TszTkyWAFl206jtTVjB3Ul6q2rVgsqXvZ H36Seg276wKKiQqiFimA0phqqullvrGjhWUuAtbRjrEwg48N/psjvJ5HU7peHeqXpRyQgZoT8j01 ScLnM888y0Ae4Db4I8M9n100aTdlK1ZtGFiEEcKEbT5YUYDl92rP+XXAD8IGwcMKw3AbAgNHX4Sa CxgZrjwCjJWGOCAT38ob6T7UfYAUhBmLBSLZcDzGMburAoQYBUPhNgQ7wA1QhlM49Ptto0aNNOd6 wAqgyW8DdOKsz3+/+gkR4MAV/PcDHi6kBiCIMfDbABw4mfM/VHw07/0ALBYWlC5d2sCn34aDPMCW FXR+/QRks8iA8gDKSMAhcwDw3qFDe9/6+SgA7LGQIJIx4kMC0ASIYwWs33ynj4x/JBsAC9CJcz1z wK+vACxbLaorWFm0EvxR8WcDLEAKL1yEB6ukPv0ikGC5Sk0NrRIEeBAQhYtUseude2gQ1ggAFsKO cgX1Cx7Tx3DNaYfpzwmE2hk+Vmi4oAFB5hUKCJ0ps9aaaY92X9QUKsM1d+FKDUVBLsEUzVlXZ4Rq lYjKriEYTn+jtuQ55wK58PzzpGuvSaZhW5Zy1IRNgyZdrY76muaGiNwJA2IkcZEGzdWVjYs0JctN dz4ot2vQyvhBUwOaKTWRJg6Z9rsvVoaWoFnrAVYPEcZZPQfduSHUT9Y6MT3B27POOkeuvPJ6dfz2 X+xwsvYlO3QxL3le0Ny6lYDMT47dDlgykJQBpCLR8oaigbYA9NRDGwA35tybmvPSFnsEOb2756lN p8Aq1+qa0ioKsCJ5g+dCGQQ7GgkEgp9Wh6/41m1amxMzwoxVifiRZLURagHNFUKEMAJ+GgPqoV6W 5COYg1dEBreD9oRVa6za89vQQKFdQHPEyq8+vfvIoYOHwt42c+YMW91GP/2ABBVBB2ACoezioWXV ABouykITQMgv5RF9ZeUctISKdxbcDmMK+AQ8+QEJNHVodVjlx0pJv43yhEQYP36Cr4aJOUP7AHjG PxLNJKAWUA4IYqVjuA2tKKEj6Ksfz6mHFYqAfVZh+vGc8gBmwl9Au998RPvWpnUbA3yAYBcDLyv6 oZfVlTwj8D3bTu6YCOfqKkJ9+ZqDdU52BT3cn64v7nWsdFIQMkl9owp/X9lMPjjYTorThRmERcio nxQzS5J/sQS35GWbpQ7waawgjKD9DQrcSpQJaKH6K2BZq0IjQVf7cf90jaVF4mDarddQgY+CsRSc y129LD9XQEZg0Qv+EYjsTWiHF55/XUpVbCov1tdVU+UUXBVR08hDBez6BboykSCj5j+GUATkaT8/ 1vhIaJ766hL8tbrScFmXoZJQXzWyfcfKDF21dZmGG3jyuTdkxcAp6p81QxK6jZREdTA2DVYGPYDR hJR98lRGqpgXXn5X5sdvs/pN2xcBP/6qZVhZyViO14UKN6ofG7yuXL3F76spT+G+ZzVmzC344t05 dyLHeJU+h/GamJ2MC7fceq/9PuYZyeA7z3JjNS8yLvUadjItGM9ZMC08+2iw6jdso3GwWuZOqhw/ gXIqX0dwYNJAa4BQCGeq4hoCB61Iw4Y/GUDgqz2rjaX8gAJiVNEGGqdwG2APgQMgwzTnByTQFJQq Vco0Un4bgp1wCAhvzE8IQj+zHMKYqN2RRtyHZiJ4E0vMb4MnxAJDYxSOh64ewO8nn3xiprxINoAb 2sNIgCFal0kTAyZCtEx+fHER5tFKoVnz2zCBQgsrOyPZAFeEEUG76rehdYWHaLwi0XzSVzSHzEc/ 3uB8Duh05f3mI2ASupnDkYA9PiI+/fRTC0MRyqTsr8GaphqDLfaC5UWekx1glaiR3PsPnqWmhGYW nBHnXOfrUUWFpjmdq+Bw9fOy7tw9YH54463PZJUGfwSYRdI+9/7YQFf06b0t2gwwUMdLn/oBJtVr tw0AI/U3IcApwAtQ5drnP8et2g2Rq9UZ2Og891LJ84YmkC45S/IU6CF5Lr/Lzt+sDtdtO46wOqCP drh36qw1utrtcnUqvknmLdkeiKmlGqykBWvVH+uoBbHEBPPhFyVlzdDpktSmlySOnKtO84cNOHn7 CW9Gj4+Xy/99pbXJqstxkxOtXy7EQyR8+SuVcWC8j6ZRIj0N/c73/FsqwH8TwPdfqS9/JVqZv3yQ TJu9zhzjSbSdnHbAPpCC+8H8q6mrGxmblm0HyvqMVa7B5Xh3zI/fFQVYfoImp9cBHmgBENx+fkau DZfHDp+pcBs+MZhw8AHiHjRf4Ta++BGSaJiIleTnO4RmBBAUSTwx2kVjgfaFuoPDXoSii3qJ+xQJ YHLxytBE+NFNW/COgKDEXotkc7kK/XyeXF3EqCJOk58GiPKAt3SN4US4DECrH8BivjBGjFUkc8bl mPQzETva0S6hyQynHXVlGSMAMKsFIwHCAEJoB5D5jROAn7lCecC5n0YKkMT8IkhtJD5bgGwAosvG EDwPchtgAQ7G6rLy5zRcwd+D0o7gvF6q7I8K3nS1kgfABbRdRy3AKC/v1poIF01TpIIKM0e/QTPs 3iLFq9mL391LO8lp+9X08ZldJ4TCBx8VVi3J8kwzC+0DljaoAJmkQOahAhrL6nMNw1B2npz/eSe5 6q6n5OF7H5JyFX6SuBlrTDPnwBm/6fPHBb63+omrhXlnOT5W/SdJ0tLtsn5XALxxvVqdNrJ2wmJ9 v/wmSRk+aKH6iTDr1G2shSjgPgBq9dptZM6irQa00DoEEksfC1Qj5dnJUA7aAaqA4AXxO6RCpYaa PuZf1t97NJzFFE3UvVq/K08GWk9VGphH6RpG5JNPA/OXuFlZPXvMuxKl1USu5Xr2jTFg5jS4Xv5E AVYk0jdMGUAFL/usdq/Jxq8sdWSnvPsqd/dgAomUFrrE/eHKOxOPX72uDq+WIJK+OqDhR4er3w0D /Q1HN9ccLbThV5brznwUCd1e4R4J7dDtAuzy248e73SLhJ6c0h4JH71jlF3a/XgTbM70K+/leyS0 uzkAf0KZTsMCrL36MTIu5xoswMaUmavlttvvy9RWsRqKVVFfF6qg8XummkAFGNgKwIydF3f33pPl DNXwkNZmsTqFp2bEx4pEsNHurPkb5JJL/y0PqCP5ck2r4gAc7SBEFif8LO/mDzjzspPrEH+vkRqc MTn9iKwjD6Fqk0oNWifn/zBfVwrOlOd/nCj1mvRRX7xYmbNwm9UJXYAr+gDdyzR34PfFqlqdtD9u ssYUAhSkHZUkNU8mLd9vqVA+/byolRkwQpOwT1wkiUt+thWQWfUP3y7jiwqy666/NZNugrTi7Dxg 6FzlkwZqVZCCBg2Qgi/NyQy4HN+MXtIZKe3T1Um75o/t5a57Hs7s4wMPPqWrQVdYmUjGP1om+3xy 83fu4i1S4LPixvtLL/2PpvxZZqA2FHBijhXQtEFnnHGWpXTKCvxmAqyfTgITofuidvnnMAN4X5Le L2IEj9dxmXJerQl14QQbyZfu8WAsNAzBwS29gS6jvwOBU6N7lAf/qzmAZg9tbLZ8sI4DYDkz29eF ytnLmkjtVaq31NAFy2TBEg1MnGGWI1BnpkBU8wTgaNmKX800wX2163aU9foiT86GeRJBnarLy/M+ +4atJByhq6vMZ8lTh5n0NPl0lRotMk1vtPeviy+TV196Q+q0Gi7PtUowR/ZLK82S4h1naa7RxTJ3 gSYeTz9qdCJQHDiYv2SnatqGyRNPvmh04+PVoLGudoN210c0NHrfXNU6XXHldWp+vEFNJzvUF/Sg xdPyAwbwaq2CkUkKNt7QPHhnnnlmJggh5hdBSz/RQJN1lGc9+8bJhNhU9Z/ZZzS6fbVpKJQOHKXJ DZmhrfNrOyfXGTM0gSnaBgI8nXQy2j58Ayzxf86iHbpCbr40btZXo91/bTxxoJc4UAU+K6pgdovR nxMaoveE5lvgGQmMB89XvOZeJNfmXTqH4D8rbRs1621j5DXdO35yjnvz6QpXnhnCPzCvQvH7TwFY qOpxHsap1jk04x/Byh7ScuDciokAPyVAESYA/I9wrnXLscndhn8HphzAFKuacF7FTAbIoV7qwueJ OnASxncEp2u/jfbxHcKM5wAdoAmnalYiYW7CXBNqmTqO5vi+UD66R3kQnQMn3xzg+eS9kROANVN9 sBDGCMxI93R9eS9YskOuuuoGCyI6duIy2ayO3rywEbQrSDkSVB/CeJ2+qoqVDDio3//Ak7JMHd1T VThH2q4rh3O0SzPz+VclTYhQv7ce6gWwjJ6w1IDJxf+6OCDcL1UN0UedJU/p2XLaB63l9rz5pdDX JaWu+mt16TFBBgyZI4OGzZMu3SdoqpGO8tkXJVQr96g5tHP/mRp2okq1ZrKG/G6Y7Dz93Kh01clY ycjXP+2zesucliPgLyALsLE87bB07DpaXtFUO//U1DEOlLj/hL4gIOXjT7ygy+4LSpny9TQa/ECl e75M1yjoC+J3Km81ZEQGWMSMukF3+A/dALFVLOPXsQKMuR2eeXfOG3ACcLKaTe+lDlcX82C5au/i 1QQKUBqtSZDbKBCtULGhvJf/K7lXY5JdqCmDvPQTfTxvvjfMJJq65qjVGwlvTrUyjDXzB/7CA+YK 85ixsl1/c475wHPlHa8/jFHG+Lj7eZ6XaAy6MRqr7YfKDTX5eN7MMSCFU31dAELdoZ5T+Mz9CRq3 Dv+423V165LErJ9Tyi7ABys3NVhool544QUDPAAZwBQaJhI+f/nll6bdIFkw/j7OgfU39ReqoAmN 8fsg3xnJY4k5xAoiQBerz1gS7hIG4w+DUzD180J98MEHI/IZwQRCffh24LiMPws+Qb3UMRb/JmL1 OGfyUE64ACyXEocv5ege5UF0Dpxcc4DnE/+3nAEsjbCeTYCFoB2pmqPTTz9TBemXskkXagaDDa9A 5EW+UcsQqJPgnOdqmpseGsQQoJRdwZmkmjC+rqdpvj9S8BA8cfjohSb0uebq42vbAZb1Wn74yPly 4/s1JM+3GnurtDqzP1NC8px+dqbgwSmdXIZoi/AnQzsWDGzuve9x869CIHp5RrvwZO6iTXKtBjIF APXTII8Isez2zwm4gGbvgJo14y1NyiuvfWB5Hc8774I/0OX8zXDs/+8V1yggfER93N5TU2VxKV2u ntRt0FlatumvCwvGqv/adBmm/Bqn6Vjipq82sx37jLkbZe7C7YFdNU9zFmxXZ+j1MnlKqgLoROWx JqQfMktB6DjVhvSRGrqYoFjxmuaP9syzr8n1N9xqKzLhYzDf8IUjSOYnnxUxEJuwYq8BiOzOu5zw 8mS5hzlicdYUDDEv2BNTDpmfH3HbevaJkQ6dRypAHWx7Ow2R0FXDl/QZMFUGD5+rz5v6Oetq3Omq Tfp9jLbZ2E3UJORDVFPYpfsYBU9d5Bs10T/0yDOZPn1uPB7VpOW9+8UZSA7He2icMSddF4pcqKFM 3lMQeDTL5/t3gNU691YR8mJjNc/nn39uSXXRaAFc0EKRWNiBHOIV5c+f3xROW1TzxMooHF/RaBFD CEdu/rukv/wvXry4lWelG6uRAHOAHrRj5RWgRRLck/tZgcfqN4AfcYgAeqw+co7jALhQDtO05fKw OcHKPS7nmsu1Fu6Yl7/L6Ud5jl2ePP5Hcuzaph7Ku2PadbkMXb7EcMehaA+mLae0BtOWXVr9+BqK j47W7PDRmXy9fKSe7PItOuapNq+D+Zid+Xkixpzx/DMBFiag7hmBNkuXrWPgBjATLMwAOZiPNimQ 6tRtlJkbeNmX0zg8fJmnhNB0RSIQaSugDatu9T2mqUeWJO60c977Kce6mLmJ++WDLqlyRrl5cm75 GfJO7cHyxZcl5cknntfl6rdZKAmAFcAIMMD/v/3tPKOX1COvv1lAGjXtpYJti6wnvpaXbhWcCBnO f651Qs/LCobStM8pAKwgLVck/XNl0FQA5gIC8ahMnblWV2tOkyZq3vlOfcqe05V3pJbBnwbNUDCw CT4G/OBYftnlV8o1mlbl5lvvktsV+LDfcdeDpnFiv+/+x8yX7raMRN1EyGeVIwAK3oRrB9PfJZf8 W27S0AtvaZT76jVbS4/e4w2sAUIBFjnRWmaHbydjWcaRffqctdKsZX/z03vqqZcsPdClOv/OO+/v f0hrA8gH5Fys/AQ4X69zFaAaGKPHbYw4vl799pgDocAtybMf03RVPzXpYb6JzKWsNFeOb/gD8gGU R/McEvHdNMRZaGH/FIAFCEGDhQkPAMMKpmoaXgBAxLJ1tq1bt1qsIBdzCW0RS/LZeDkCeIglBShD owQYQpuF6RD/CuI1sWoM/y1MeXy1Ar6ImRRuA/xhYqR9ongjFAmTwCooNFsutAKgC4AXvAIM8yFx fFip5HxMWAXGOXfMMvqlS5faMYLeaeXcMaCT2FQuOTHHaNK8xy65Mv8Bgw4EUI7ygCfKs+qLFW4u 8S/aP9pzx9ABPY426IRed+wChTraqIs6HFChLdrwHjMeHMNzaHMJjaGV8l5aqc/RSp8XLPydVkAy tHr56KWV3360Oj7SBm15+Qhtjo/QCG2OVvrg5SP3eWmFB16+wsfsjDllHR8ZC+oK5mO4MQ/m4/wF yldN6g2v6DPXc2vMvXyEr7TlHXMvH0ONuZevNuZB8zMcH4PnZ/CzQ13hxtw9SzkCWGOnyqx5myWV xMxofCLc16mQDLyANQp7uboBgOW5N1lBxwp8ijBH6dfwT5rUmPQ0lC+g5rr0dQclTcFDpO2FKodp ZWH8drlTg3lSLxqe+Ys3yEalZaWCmhXEq9J+9Z+2U26ro7kEC8fIfyvESpV2MTJh7DyZpU7p3L8w frNMmLxCv+ynmnmruQo//nfqOs60BvNUK5Wi/lwIGQRkcD8xk3GtZq3WBs4uVmE5YvAUWTtysiT2 GSvLF+/UVYbH11d4iSCjfXjNTrvJK/fK4mXbTMPUofNoqaE0FPqugvk75X32dbnr7oc1Lth1GVqv Y3PS+YGxcNfRXJI3D4F/v6b5IYL+F18Vl4q6MrBt++EyetwyWbxUFwqkHxLmCgAb2gGmxzPmf9V7 ATVTZ6bJ90UqG7B15ubQPMYUHT6Bc1iAqxriGxR0v/rah1KqTC0ZrNHbk1L22KpZNFO+PCQ+mc6v osUDHy9oxbiXZzrUvbw7FpqJMBc1WICXli1bZcbRAZQQqBGToFuGjv9TjJrk3Mo1zHTe8AAIX7RI zrGdF6uLLL18xfLMaOmALZaUY04kwKRfDCQAFmAKcNdRTY4su6ctF7wTGhCMJUqUsGCLwbGDqB9A BljkGnQD1DBf8ht/MIKAUoZj/L0a/NRABg8ZbP5ifKGTcoXwA1wHjFSpWsXAHPfSNlo+BAvX+V+p UiUTKhxTroqmSQEocAxPqI96qZ8o2YBY2uU6ASnRFPKbHb836HW+a/QDUMk1eEnMJJa6c4wwhwdo FCmfkrJC266smr1ZRivgB9oAQpQHJHMMDzkmxhexrAAClMdUTBoW2qE+5oNL/UN54kG5iN2U5zcA nGvwumGjhnYP91JHnTqkfxlrdQMEaAuQTHnAC7QQRoBjaOQYmimPdtLLR/oIH+kz5Zl78IJ2OMYU Da+4l/b5eICX3jHv3ad35pjTL8Yi1JgzdrTNWHI/YwttwWPOXKA9yhH/jLlCeeaOd8wJe4C5PHjM uZfyzE3G3NHqHXOACP2kv27M4SMm9MCYp9h8hF/UB9D0jjn85boztTtzPuNBffgy8nFEO9Q3aNCx Y874Bo8588CNOXP52DGvY3VynTZwHfCOOXx1Y54tE+FvrCJUgDVfARZgR1+ske5oIibFJZmWJ58G 0+QFjAaHegA+DgTEanoYloQjkHlZv6555hJX7M70u4m0vazK0c6Q4XNMA0X9fNl36zlWVq3eL+tU mNQdsU7+UUFDOnwfKw/WiJGW3dU5fNwSNX9sVh+l/QbEiOC+Bh8Y/IsUDCAM+W/+Lxm+LwZA4U+G 2ZH/AB58rlJX79VkzQ0sEjk54+o27SnrFZQldxksyYMmS5Jqb/Cpwjx0vP3NFHAZ/juAVEc/NAP0 oIlz8Ul7ZObc9QoeE2SormbsO3CydOoyQho26S016rQ1LWIRXRH5nQr9bwqVN43eF1+V0r2k5sgr rL5nxTVYbCUV0j9KpSrN1Oetg2rxeivwHKFatDgFnwskZmqKmhI1Qr2mYaFt883CZwhne1K24Gjv +OZ4l415dtz8+h+3Rd/hy1DNT4l51wGjc1TbeMutd8sLL76tgLiiVK/VRn3oBqhJcLT07j/B9h69 x0rbDkN1gYDGXVTeV6zSRDW2NeSrr8vKJ2qWfV9TC33yaREp+E1ZKVGqltSs007aq1lx8LBpavpN 1bl6yD42mNfMk8xx8OEJZZNX7pe79cMFDe7MuWtljQNmIe7lmV+4NJcBlp+T+f/6OqsPEVbemEMI UgemOI9AYA+O7YN2blnCMgNCCB92BCS7O+YaICP4mDY551LLuOvUh4aAYzQCCDH+u2PKu2PKUb87 ph2uU5b6EXRe2hxgzIpW6PbS+gfatG7apG7a5LqXVu8x54Np9R5Dmx+tXj4G0+b4miUfTxBt8Cq7 fMzOmMPHhGUJf+BjuDF3fHO0ZZePfvOT/mbOxxMw5q4u75hzLng+chzJmHtpC0Wr91mhTjTT2QVY o3MIsFihlLRyn5opnjBQUaZcHdUebVatym8Sn7hL+g+aJsU1wSzaEydUPv7kOwVXewy0ZAKV4xSA 5tulgKJ77wmZwU3PPftseffj7+St5urEXm62nFNulhRoOUOGjZqngXBXqn/RLnXgPZQl2DFBFGbH 8RuhST9Gj1uomoIPMvtI3KC1+KNp+IqkmERZobQlDYyVZHU6x9k9twED/GAH/LGS0us8DZ8QuABI L3gEjLGjEQMU8T9NV2mmkz4ow3kaIY1ZGNMRdVCXc5inDPOBlWvW/nGOaW7z6M+snzkSN22l3Hjj HTZHiHNWQP3QOncfrY7h2xT4HAj4ZGk5B47xVWRH6+cWE3jHyxYmrDmiHzOHdZx0xSvjnOHX5T5s aBfgw3hkp7+YCPGn7K35M9Gyvaw5RJlD4eqJAqzjRHcALrReAC18y9j5HXyMb5j3Osdo9jgHgKMO dz3cMeW47sqGO6Z+55PmygcfO1odLRyHojWYtnC0R0IbZWjH9SVSWv346L0eCV9zQquj/a8+5sHz 0TvGofh4osc8FB9DzU+/+eg35u6ZDDbv+wUazSnAQojyMm/YpHsmuGDF0eNP5pN77ntEV479vvLt EvUNqVq9ib7wD5im6ESBKyc4MDsh8IeNnCNPPPyE5LlQI6K/Vl8d2edKns96yy2vFJLqVX+SAarB mbd4mwEDhAgaN+jJBBVuBR3xr9j12K2ic6Y57ktM2atOxzPV36qE+TK5lYUlNIn0Kk04vQo/sKnp khyjH4XrDgU0WAm6kOhPAFh/EKYhTL6MHQLTwiu4XfsLKHM7/bffep1y8DgTPAXXGQVUIUEM/GKO oWFijjyooUmGqSYLsMQ8AhShLTIeO2DqWWnqnpM/jJebnxn/GSfGKBMEufHJwbgw59dsOCwvqWM7 NDdv1d+erXAgLQqwjhNgRW+PciDKgb8mB3wDjaoP1mw1EToTgr3MI9zT0JKsOSTfFa2kKwP/uOLu QnWI/uCjb0yoIGhsSb++/COtPzvl0pWWbQr4fhywVM4oPNxCMOR5q6Hk+dslAQCkcauITfXSK++r b0kVBYZd1WQ2TVcirlX/lF3qY7VHQdUBSdOo8+mqHWCnbytX7dPrP8uU6avUfDNOo7v/KM+rWYeA qk4zR4Lixs26m8C0PrKrBiuxcTtJattLkodM1wTYRzMBSnb6FS2bO/Plz+ArcyEp5Re5VYPp/lsX CEydkSZbdylwB2jn0nOQ434pPYC87btF2rQdbD5gt9xylyxJ2GHzOly9vDsW/X83Eea2eMDPh5Qw mMz8NswY+NTgQ4aDb7gNHxjqxecM3yO/VCmUw78Kn5VQudmC26I+fMfw24okXQ6mVvy1oMkvDx1t 4QdF/DJv/LGs+otvHnwhuXJWqU+896Jd6t+/v9Hul0SY+1zcM+j3S9lCefygoD3UwgcvHWhNSAeD 2QuTH+MUbKoK7jM+Q6xgZQ6Eir3mLY8PIP5S0IL/XSQJluE3fMTHyy9tD3TjF0XdkaQ/wncN2ll8 wkrhcBt8xp8KnkeSpJoy9JWFK9DltxEDj/nLPAjFx0gAFj40CANesNnZeeliWkpbe0i6aPLkz78s Ju+8+5l8/kUxqf1jOxk3cYleP/q70zl+Q9lsw688X+2riRSvy92L9U6Vs8tq+AWNyv7aT5OkmPql PPfMC3LtdTeHdBomvhTX7lJfk0cezasxp963mFIfflxY90LytvYF/7K7Neo4jsnn6iovr3PxVVdd r/4wJSV26grZrBoJeAhPUogDNnOVJPccqUBL3Sg0TyPBGP36Er1+avEI7eiShM2WReCRR581k5/7 kDmZxpo5C11bNI7d4GHT5T9KL/O8SdMeNq9tTod5bpn3i5ftUr/rXHRy93sRnsrXAUEEREUAInjC bQg7BJnLFYizbrgNR/YCBQqYsCRpsl9SZqLa//jjjyZ0ItkADzgNEx8MmsJtCD+AFQIQEOGXeJq6 qLNp06bGFxIh+/EGR3Gcy+EnzufhNgQqztkspsCp2y+iPzkCce4GGLA4wm/DqZ1QIIwrQDHcRh8r VlRnTaWHJMh+oIaAvDhzE1iXVXDhNhYMEI6kXLmy1kYkeR2hhzbaK/1+fGQs4QtAlcUgfhuLQ6Cb RSN+yaeZMzjYMz6RbHsVwOMgD2BqpzH1/MAnoJlFGSwuAJQFg8/cBFjOrMHLGQ0VfiQIFQtGicM1 Tu8ZTs65IVAwrWzUr+vYRXvk2WZLzJH9gtKx8l2LyTJi+GyZNXu1LE3ebY7Ybdr3V81VVcmb91W5 8spr5bzzjwVLkayoI3r7ZZog95m8r2mg0SYSMyUp05/pmP4BsNTXa/nEeEkhVIPSmRv9j9Z5cvOV jw80oKRzIrjnBDUZo8E6mcaN5zPgl3dUWrXtJ//97zUGrt5+51N9dvdH9OFlAAsNVoMowIrkHZ/t MnylAyQIsuoniAEBgAec6dFeIfS96YCCG8fHCGHJSikEMj4yfhtaIIAY9/olk0ZAfffddwYkwtFB m9QH7fi7oIFh99OSkQSZFZYIv0iSMgPE0KbASxYh+AE+VkuiBaJ+P4AFGICXCG945LcREgTgCcDy 06YQi40xYnVdJHWjBfrqq68MbPutgiXsCRpS6Maxfq/6BPpthDphFSEgkbkWbmOBBeFOAFl+ZakH fhcsWNASXPuNP+X5iEAjyfz62UfjheYPmhnPTvrfL9E2c5ExBRyiuc0uwBqtJsKcarCCBYX5LTm/ kFwGFZgn1+mwdondKldXV3OghmC4oXKs1OscK+PHLJAZGnNpadJeE2aAvi07AqAvYfmvMmvuKhk0 dLY01rhWJUrV0ECZhXR14wcKnF6VJ5960WJqPa7xsZ57/k09/76u1CosP1T6Sdp1HGbaqiR11Eco rSeeU6h+oslSreCK6WmSkgPN4MkkgKO05BwQ8QGA1qr8Dw0MtDyb73Wdk9vtnPld5YJGN9Lxso8i nb/MY1YDEyzWBdZ9+OFnNOzCJnteIqExCrD8pNFxXucljyBGY+AXkwsBgAYF4Y0moEyZMmGBDdoL NFKY8tAYIGjDbdQPoCGmF+ADEBRuA/SgHfEDhtQBEHDghNALxC3zE7CYhgg+S/gGP7MZbdBXAs1G Yn7EPAU4RMAyBn4bmiKC4aKF8wM11NVZAco3335joSj8NkABZlk0QMwFvw0wQJgFNDt+ZmLqYvzJ dIC2NJINTSBhR/yAIXVBs9McEhrFbwP8wvN27f21Y8xHeAMAQgvrB7KZT2jpAKusCvTbMA2j2YWP oT4mItFgzVUwsIrcdaw++wvsa3EM1rAHlQaukrNLT5U8RWLkmTox0qnPFInRlD1z5m+VRE26nKIp XFx/EBSAodWqVTDBQkgBUr7ozm/OrdS0MstTDuq9exVE7TeeWBlPWcpRB/VSZ5b80rbMSfwvwM8o jbk3TuuI7r9go9x0850GsvLme01ipyTLVgX8a/VVxpzMbf67ecpHCeEWtqjZj7anzkiV0mVrCUFk nQaXj4qZc1bZMxEpXTwnS8xE2Cr3Irn7vQhP5ev4PQGaAFiRCAVWJeKXgmYEDVK4jfoQTGgxMJ2h bQi3ATratG1jJhyEjp+JhfrQjEUiWGkXvyfMj/Q1EmGP9qJps6aZ0fLD0Y4wRhCjwYrER4q+ASZd rDS/OQaQadSokS8PXT2YQonX5JfrEuAI8Fy4KJDyiXHyA5P4bEE7msNI5gxAGdNZJGAM8yT0ML/8 fKToK1pUF1uM/37mTbS1LZV2gJOfRpVnA00agMzyhmpcrHAbwJfyANBIQDBaTkyQWZna/QHWFJm3 cLOBBl72J/OepvRtVDrnJe6Td9snKrCKlbNLxsrnTSfLoMEzlAcrZJEGPFy+Up3TFSxF0hdz1M/Y 04kpRYLcjJ1j7/VI6ouWObnn0P9ifDaplmjA4KkW3R4gc/U1N6g5rYMkJO02sAOIz43nzwEq90GB 5myZ5ifs2z9GvtaVjVdoZHgHrP518aWqaasvyRkBSbPDJ2iPT4gCLD/5G70e5UCUA6cYB/wA1tix fw2AxSpB/K0Gz9wpt/8YiMp+xQ+xUrVDjIwfPU9mzlojSxP3KLDS+EAnOVCM0vf/C4QBdLapxqpX nwmaoJsFF5pwnGTnmuqmRq1WukJ1paStOmJgCzCGdgmQHwzwvWDf+1HgPgzWoJ1VjRl1bFOHdYBb cso+mTt/nfTqO1m+LVxeo+4/brlAHQ0XaM7N9z/8WsaOX2L3oXHL7vz0AqxWrVry4bkzD8oIv3ep eznFrdzlVzR6PcqBKAeiHDjpOBAJwJqvGixezmiITsZ9nQqbtRrmoN7IdXJB+emS57sYebhWjLTp GSeTVTDM1TATSWoSTFVwdTLSH6Xp5JxXf+a48IGwWTVIMXGJ8trrHxyTc5CFE2+//anUrtNG+mti 5znzNinIOSwbVNnNvhEzdtBupmsWklCGdFQacHSJOppP1qTPffrFSrPmvaSkxmV7/oW3VVN1rZxx xhnHrIC9UkOWfK65EIcOmyVr9cNlk5oEoTEnPOHdsTRDgxUFWCedCIgSFOVAlAO5xQE/gDVGNVjz FynAIuihx1x2svxGaxW//IB81jlZ8hSLk9OKx8j7jSbLgEHTZWrccjUJ7tScg4dUMBw9Kek/Kfio wHkdWhFMnoDo4HHWc1xDe+EE7GoFtdwTsny4eaJ1oYGhLptTodo7CedZro+T8sFAlmqJ0lYflPYd h8gzz7xsCZ69K1j/rhqlm9Vf6+FHnpHXX/9IfWB19XSFelKtRgupUbOlVKveXMpq7s8iRavIVwVL yUcaToRMAo89nk/uuusBueqq6zRGW+gVspgEX3v9Q0131F2mTEs1DRdaKzRQxzNOjLMzEUYBVm69 yaP1RjkQ5cBJxwG/SO5jx02RBZriBqGIqeFk2RHwW1VIj1+wWx5ttEjyFIqRi8vGSvm2MTJ21GyZ OTNdliX9qlorDQyqgutkoftkpIOxHTNusS6l32GaymAaEbDLkn6RkaMXmLBFYC6O3yETY5Lsd8R9 0nEgVMeUaStk3IRlMk2dqC0PXnR8AjyED6x+VZ5sVXNg2qoDMnDwNCmE6e7BJ/4AtiIJHZJVmdNO O13DkVxnKxcLf/+DJjDvLTNmrbLx3aKaNLRpPGOOpojHOMQ7gvm1NHGnOrm31FX2URPhSScEogRF ORDlQO5w4K8IsHRhpGxQwd564ia5vPJM87e6s1qMNO0WK5MnLFITygZd5bdXBbfmYTuJQOHJSgua iq6a+27ewo2yU+PisoLNVkOqgEXY7lAPmCVLt6lWZaid//lX0TAXqzSMRXfzC6I8q8q8/XOr0Vhh yXmuU9d2rat9h/7yY92OGnx2aABIRAHWH+YpPlYAE/gL2FmseQlHjZknPzXqooF6i8vzuprvjjvv 1wC3N8i/L79CLtaky//616Vy8SWXaVT4KyyWG0Fyb7r5DguU+6yuTnz/g4JSsnQtaaZgavDQqZoD cYUkr/jNxm9rhk8W5kDn33Wi5msUYOXOuztaa5QDUQ6c5ByIxES4QE2EzoSEqeh/uW8isWzaISnR Z6WcXmKK5CkaI6/Unyx9Bk6Vaeq/snjJdklJPahf3pqI+H9M61+lfcZ2kmqjJk1OlKbNe0qZsnVk 4qSlqs06IvXqd9TVua1lztwNdi41fb/81LCjxoWrKm3aDVQ+79c8kk2lU5cRmaCM+pKSf5XqNZpL x07DzezVR52oy1doICtWbpeevUcqUOgmPXuNMoCFluSvwqv/BZ1oFTcpCMYxHX7hW7VO8wGmpu+R ufoxMTk2WcHXQtMwjh670I5Z1LFg0RZJTN6l/N2nmsbD5uCOrxZ1AHQBb5wDSLPnVt+YD8s0wXuD Bq2iGqyTXB5EyYtyIMqBE8iBSADWQjURel/E7oX8Z/5fq0JmuwqWWcv2yPMt4tWRXaOyl4mVIq1i ZNSImTJrZpq+xH9Ws8rhTIHxZ9L3V24LANS+w2ANDdBJPvyooHToOEDq1msrPXqOkzp1m0vffuNk 0JAZ0rptH+ndd5xmYmgthQqVyizTsFE7TX3USuM3JRmYwiG6dZv+Uqs2906SuKlJUrVqQ2neQoPj dh4svfuMkcZNekiv3qNs9RyC/a/Mvz+DdgsNksEntEyAFgeY8JNCO+h2NwaAKXN0J3MCfm9kUdDn yAum/gzaaT8hKWoiPIGv7WhVUQ5EOfBX4ICviVCd3Bct2Wwval7O/4t9vQoU/K16TN0q11afY/5W N1WJkYZqEoydsEDm6TLz5Sm/qQA68j+h73/BkxPZJoK5U+ehCnq6q6ZpouzdL9KyVS/VUA1SbVZ1 mbcgXQNFbpAmqt1q0qyHaqE0ufXURGnRso8UL1FVChcuYTkme/YcKz//oia/9L1S58fWkpq2W/Ye EAVlo+TNtz6Uwt+V0fLVpbuWa9aspwGs7aqVQcifyP78v6grOzzLTtlceMZ5dyQmRwFWjuUB0aUJ Dup2Un6we4/DXQsum9WxqzfS8rTpLeuOTyRtwf32O84u7VnRGty3UDx39wbz7XiPg/kY6biEmg9Z jYlfv7Pbt6zGJRzf/OZLqPkVSTLoHD9ouXDjyQ6wNgPs1h6RKkNWyTlEZf8+RvLWnSzd+09Rk+Ay 9U3ZKitT96uAPhoV0jkUjg5gsXR/8JBpsvNnkUaNOypv18jAQZOlaLGK0q//ZGmrgKupAqO0VXtl 1px0W+pfq05rGTY8Vh3XFyjw2m0mqJVquqpbv42Ox345cEjjO6lJsMFP7RSUzdEo+KsUYA03/60o wPr/ASxPGoBFdGvAiosUzcvam4iWXHLeyOO84L25yIhmTj4870YUbL8cesf73iZ6eWqaLuvUNCVE jiZ9DUmYOSZ3m/tNEl5+0yd+s0Mf0dq5b71+qnKdtCek+PAeu9+UpX6O2amL8vzmHo7ZHS3UzzXa og3u55yjzf0ORRu0B9MGfZTlftoJPuYedx06aZNjaEhNTcukDVq5zk5djnZHj+Ojl1YvHx1t/Hd9 gQ+Oj5x3fHT9dnyiHvoVfOz46saE/jkee/lmtGf0JdCvVKvP0RdqDlDG0Uq5TL5lzIGsxpz6ocfL R8c3L21uzPnvaHW0OR4zDtDgPXbzER66OUB7bn5Snzv2G3M3Z/2i1B/v83Yi7/cFWLqKcHH8ZhOc mCb+jB0HadrZoaamxeqs/l5HT1T2ZjGaqHmGzJyxQle24V9yyMDVn0HXqdoGTs5t2/VXENRJYyRN lF3q6N6gYTsZMXKWTJg4Wxo2aqtgqrc6uQ+Qzl2HSsfO/dSfqqaGBGii5r4JMmSYBnPVcoAuzIOb tx6VJk27aZ19ZcKkeTJpUrw0a9FDps+MV/+gedKh0yCp16CjdOs+xBzoWbl2qvI22q+A31eSarB+ ys1VhKQTIVceaS5ICLxw4UJJSUmxNCykJ+ElTkqOypUqmcAEKJH/rF69ekJiWlJ6kNqDlBqkBQFY kdONNBjkyUMgkFuP9CLLly+3VCTcR8qWSPLQ8dKmTVJqHDx40BLVUhd52EjRsmHjBkvPESr9C8AO GoYPH67Lo2caiHDH8+bNs9QrpBgZNWqUJbUlXQq5BtlJbYIgnDp1qh2TDw9hSrJfctfBJwQiyYIp u2b1Gquf9C+TJ0+2XHIIZ+7lOCkpyfhKGhfy+9H25JjJdgx/qZtz0AofSfpM8mGukw6H+miX+jiG tukzphvt9Al6uEZ/aIsy3As98J06OSbVC3TAR/INTpo0SfsRACLUBW0kV2bnOv3nGu1DG/fRT3Ir cky+P+geN36c3Q9foW3WrFl2P3wDPEzXPkKf4xt95poDrrRLPziGPngGDziGfsdD5iP945jz1M0x bVEndEMb4+KA3aKFi1T4jTDauZ924QU0Uj959jjmPPTBZ3b6BTihLfhKvbQHD9mZL8wr7oWP8In2 Q9HKefhGncwh5g7nqIf74SP9Ybzgo3fMRynf4A33uvkJbzhHWe+Yc8y88Y45ddK2XyqdEwmQjreu cADrt9/2aJ/jZIkmdsXJdh2+H3/CTjrJHdreyLk75Y66gajsV2pU9hqdYjRw6DyZP2+NrNCUHWi2 /gx6TvU28NkZPWauphPSXI2xCbJNnZ+HDovTMAorpXSZaupL1VQdpjfKyFHTdQHBLilbtqaZ+0aM mKGO1r+qGbGmBq2sqvNks2xmtaDWF790s3xfpLxqvLqan1WPniPl088Kaxsx2sYSDT8Qp+BrgWxV 8yT+dac6j/8/9493R/KKXAZYJFp9+eWXLd8YAtMl961Ro4Z89dVXllcM8PLaa6/ZC37Hjh2W6Lh6 9eoGdABovNDJReeSGwN+yKlHUuRkFX4IlLp161qeNer/8ssvTThFsqEdA0CRzw2whiBFcALaEFAr U1cKCYxDJUfepPnTyElH30hETN7BLl27GAAkAS+59goWLCgFChSwMuTq4zc7gBOhRx8oT/42hCjt spN3DyBRrFgxa2ObPpGDBg2ystWqVTOwSnscA2ARfABLjpsr33r27Cnff/+9JVQuV66cCe+OHTpa jjuS5gJYv/nmG6Olmf4mCTS/SXpM3YCBFi1bGH1Vq1a1BMTURRnyJXL/Z599ZryGZ/CPY/qLwKUN dwxI4B7ahi/0jfbgSdmyZY1uxrcdfCyjfBwy1Mo4Whnrr7/5Wj755BPr65L4JZbzjr1ChQoGIug3 NJGgGtACj9yYAnJKliypX5dNTBPKuBYqVMjGgJx5zBX6AU2Ackv+/Nmn1g+AKWPTvn17q4O2AFfQ Algi+TTjw3XaZ/5BC8fMX44DcyQwxk2bKN+Uj58pn8lNCGijXP369Y1e2oT/P/5Yx+Y0vIfv0Adg g/YvPv9CyPvHxwbgjTHhGeHZYQ4VgDYFwLTtxoz6R44coeMbGGM35owRx/C6W7duNmbUx1ylD26+ MvfoX4ECn2SOOc8F9XN/Vjn/InkG/xdlIgJYSxVgqeB0jrK5+X8rwQ03HpWGY9bJhRUCUdkfrR0j HfupwFfBvGjJJvXx0VVRusItN+n4f1V3RqRuwJED0vbbwNIhdZ4+Yr9t1/HZsu2wgqajBqTQTmym jO78NiChANnu1XKbtxyxSOKU3bxlvwEw03Jl/Hfl/1/xO8Ph/P9LnxnvXAdYaJR4AfPi5qsZgQag QqgiDNn48uU6mgWSwFZSbRYaLoQ7G0ADIct/NoQMQsmZCdEOISB++22vCoEmJrS5H+HltwGcEBRo xNBkQS8aAsCgMzECXkIBLIQK7aLJgnaSL9MvTJgAGoQdmjSSKyOU2SmDYEfbAZACfCCk+Q8d3McO +EKAAzYBK5yr36C+8QChD41o+gAPlBuh9MIveIsgpi0AJyAG7Q/gwZIl69c5Ghloc0J04sQJqkma ZtehDa0SQp7+wRP4ixaDfiCEOU/7HTp2MGBEeYABbQFW6RtaE44RzBMnTjL+YlKFXq5BK9pJNB/Q hjAnkTNj26N7DwOI8BFNivFRj+E1mirapT3uB5QDuqZPn24Aw4Ee5lCJEiUMPKEdg4/stEeZEsWL G19NU6f3Fi1aVGrVqmVzCu3Sd99/Jy2atzBeMtcYY9rifmj7+uuvjb+UBSgxJowZfKN/lOOYfsMr +sUYjx4z2njcvXt3m58uyTTPBeUBVdy7Tj9vneYLPtIG4wbvixYpKnVq1zF+0ta3335rPIB/jEfh woWtDXjHMfcDDOlnjx7djdd8pDBu0EFZaGTOdO7S2fbMMc4Yc8pShjFwwJAx4Bh+oO06pTRY4+JU G7HJBOJ6Vi7l4o5JcEX6AfmiWyAqe57isfJh0xjVpkyT2TOX20qk1WsOqgA/mqt05GYfT9a6AUHs rPiCRvut/zdmpGMJPsd5V5bfdhw0N+xeT32Zx0Ftnaw8idJ1Yp533h3Lc1uDhcDKly+fCWbAC4Ia YMUXNV/2bLy8n3zySRP4CMTiKvz42kcLgdBEi4OQQAghENG8IBi4BrD54osvTJuDwAXEtWnT2jRg CAC/DcEHLQA8tGUIEQQnJhZ8wTATQhdasmAfEwQiwheBCB2ACQAUIAKBA9hBu4NGA9rRngBA4AUC G0GHgAa4oPmpV7eeCTaEcokSxe082qdSpUoZTQAywA6mIoQvoBMhTRm0K506dTQhisCFXwhkQBtt o+GADkxYgDW0PE4TiCYOzQ30QxO00fawYcOsPCZKeEOdnKMf7IAkBDf301fMurTPNe5DIwMoAUAC Bvm/UrWDaFbQhsAz+sKcAJg4Pg4ZMsTah4/OlIrpCl7vUdoQ6IAyrlMnQh6gQZuYrgZqP0oquIJv ffv1Nd7xmx3g3K1bVwXhZYxn4ycE+MKc5Ji5COjhmJ3+ch064Sf8RwvHjhYWngFioI8xrFKlirXB eTS0NbUM/eupQPvjjz82sAfo5jrgFT4AbJx5j7EHzKesSDGAtF4/ddHcAgoZAz4cHK3Tp08znqPF Q/MHGIQmgCMfGcxt6uIetLOMC/OAecOYMS/QhDHmXKN+nivmO/OBc8FjDr3MG8oy5jw78Izn/FTx wTIToQKspcs2mQbCCeET+d+Sz6og3q1mqZglu+WRRgttleAl5WKlQvsYmTRutpoE09WB+lc1JQVi +ZzI9qN1RfkZnQO5Owd4d6xIyWUTIS9eBCLAhRcwWiFAAUIHAIPfE8LJmY0oj9BEKCKA+ErnixnN EAIDwYAA4LpztkZgYYICNLAhjAAgkb7w0bgA5hBCCHqECEIIAIeAB8AAFtBSeLdfdv9igAkzDsIf uhG2CFkEE0IZ0xqCG+EMvZRFOGOG5Bzt1KgZENQIVIQ7WgzqqVy5sgFO+AV9CDIEKrRA81QFYwAo ygP2ADs1a9Y0gQqIgmcIeUAbwtDRSh8BN9BcpEgRK0vfqBcQQj/gNYCOvlAPwIVrtAWf4QsmSHgF 3+A3Wp32Hdqb4AaQAnzpB4La0cb9gGDALyAYWgFhABl4Q32AENrkGBAOH+ELwBsewUdAFbQxt6AX WgEXjv/wjPPQyA4faRfwiWaLOuBnwa8L2vjCH0AaJi/aBWAwJ+EVoMSZZRlXtEWYvqGducnco22u wSfuYxzwHUzWY2jlmHkLXwE/HDsACfispm3yHCxavMjGmDkB8AI0MYYASn4DrqAVEAd/qYdnhLrR FFMXtDGv4A3PBh8kzA/GCQDHmDN+jDlaO8YVupmTgDPmHfyBf27MKevGnLqpC/BG3fQbwHUqabDG KcBalqAgVH1lnKbiRP7fpl+3O/UF3GXKJvlPlUBU9rurx0irXrEyLWahLFnMYpK9OtZHc6X9E9mX aF25M0eifP1r85V3R8pKBVgN/5+nygHoYY5CQOAThnDFVMnGeQQWO/5a3o1zABUED2AJDQpCimME ltN6cI1jhCu/3bHTuABw3KotrgE40KBxD/WzI+woA1AAZHCd+ynLPW5VGHW5spznN/+hi3u8tAFk sqKNtqCX8s652tEOPdAW7ph2XduUd7RCP3Q4R3Zo4LejLZiPpvXKcIJ3/XGaLmiDRsdHjtH8OL55 +c/v3+sJ1OmO3VgFH7t+OlrdQgLzzctwOKeMG3O3opD/0MJ5xsU5xjueOr472qmXcXP3c51x5X7H Q8q4xQGUo103du6Y+7y0ee918y94zLOaA9QTyRhDA2NKPyP9oPHTKv8Z1/18sABYCYmq2VUNE/43 J2rHX2eX1rl63UEpPSBVziipUdmLxMjrDSfL4GFTZe4Mnsnt6sh+0IDViWo3Wk+Ul9E58OfOAd4d K1OjACvH73OAGdoDwBhgi9/8d8do4DC3uTASHGPGZOe3O/bez2/KUw/lHLhz9/CfMtzLNcq6Y87x mzLQ4sp6aaN8cF1c99LmyntpCabd9dNbl7evwde9tDna8RmiDS/fHO3B97u6Q/E5mO+Ox67/Xn45 /jgaOHb8d+W9fXK/3X3ecXH3eWkNpsWNA30N5nPwHHDHofjo5kFwXxwNrh/BtAfPx3BjGmqMw42p t27qPdU0WCcaYKkiV37RAJPzl2tU9pZLMqOyl9BEzRPGzpQF81L1i3e3ukEcMmClSsGIABblqNs5 awcLUq5zzfYI6zwRwpi21Agg23U/EfV561AluezcFXAiz27dwfzKPPbhDW2hlQjFZ6uDyOI4tWeD x/otr+8fTQej/7PbjxNRnv4YHzMc+bNTJ3z4WUNbcD/mbpuzYeahu25zNQSPuDcr/vrdm9V1W90Z tLuyaoCSHfo8Otqz0/dIykYBVo6hVfTGKAeiHPgrc8BfgxUriUmbDBxkghMHUnLwf7sKMvyt+s3c ItfVnG3+VjdXjZEmPWNlRuwCiV+yTjWxv6nW6ki22uNFj4DT7yZdwKLaMQ2WeQygQgjquV/3BHYA T/D1rPqHsAusgotsdwDEgT3+r0jZpbECf8kEgJHWFa4c7axbd0DHRxdMbWQlX2T0OYCJ4PtF+eWA H0KWYxPuXjCa0W/q5zp85F79VgrMi4yynIO3jAM7gtvxIFw/aA/+jBo9w/47cHEieBRJHfRr9Zp9 Gqtpm827SGh29XIvoLCzpgDq1HmQzStAL2CRkJSh2ne8g5f89vIavrnz8BLg5r0e7l7KwTvup33+ u/aph2OeD7czPolJ2zTOWXt1n1lmYxYJv7JbhjmSmoYGq0U0F2FuCAsc8vEpwocnkg2NGL5Y+PDg YxVuIzDrYC2LjxKO5X7mGbQLmKF6q68OK/H8Nnzj8Jvr27ePmav8Nhyf8TXCyR//HL+NFXX4MuF7 hRk23IbfHX4/+ChFoiXBlIvzNj5IaGDCbSxicOFDoB/TmN8GH3F8j4Qv0Atv8MfCD80v4jlxsPAn g4/OpzArevBnpJ/4akFPqFht3nuZjyweYQEBPnJ+W2DBSCC8BKbAU2nzBVjjYyVp+abA170n31lO fu9WAb596xGpNXKV/K0MUdlj5fkGMdJvSJzMm6Em/uStusz/gL7kj5qgMGATwU45UrSMGTtLV46W tn3K1HgTTg7s8HusOsx/W6ikrowto8lwkwPXw9WfoalBqCEkIqIHgavlKct/+LZq9a/y1NPPa5ie t9RRf59pCyLpl18ZBHD7Dn3liiuu0sTJI0yA+t3jrgNAFyxcpbwqpQFFp4ouPNcFUrF2vGBhukVz z6wro0/0ZcjQGPnwwy+0L2+rz2YNXQCx3vpDfes37NcV3q3lrbc/lLd1b6C/AR/wIRxdAOJu3YZK njx57D/HkfbjeMsxTgCN2nWaylVXXauLfebK7kj5qHxhDKZOS5C///0CXfX/o+xX75l16/erf2k1 fX91z5wHTqtH3zZsPKg+o42N1wt1DOCdzWGdj4uXrJHvNMbYK6+8rb68xVSmLQuMq7aV1b3GA73O HN246ZDFLfv225L6futngVypv03bXnquhPqnfqshZr6WAp9+oyu5Z2r5X+TSSy+Xd9/72PpNHcfL 0+D7oSFt1U71i40CrFyRHQjAWuqEDADy2wBIgA2EMHGYcGgOtyG4AW8uvhSCOdyGCQcwhhM4wtsP kCFQKQ/Yw/nbb6NeQBAOz5HEIGPVJ6AD+gnDEG4DlNSsWcsAn98GX6AXUIujO/UDorLaKA/gwFmc RQCYvcJt+Dux0o7VhKwG5TjcBg2sisRvDlAT7McXfC9+V43UUZ374H24caJfOP+zyhB++mUuALDh wA/wZLz8wCrjwsIHABYLAk6lzRdgjYvVBQqbMoWAAz7Z+Y+A3avCI0md1T/slKC+VnFydslYKdhy soxXk+DC+cTZ22XCwQGi7Na/T/PnValaz4Q0+2OPPa3C4qgJDPZt24/K7bfflXm9Y6f+wj2AAwSs FxQ5kwmCbXnKdnnoocd0YUkFS/vigBZCyzQFaHS0b+7+g1qmfv1Wcvdd92uOxFQ5dIRAmvvkgw8/ 14UjhdR8dMjapLy3Dn57aXAmJ6dVgibXtuMNbffrP1Yeevhx/TiaYrQAgriXstzjzgXzE0A1bLiG wlBe1ajZ0KZ0BY3OzvHIUVNNmHvv+dVA0GA599zz5Morr5H77rtfrrvuRo2p10n27kOw79dE0V/Y 9bvvvk/uuus+BWKf25jSh1Dj6bQq8Kxb9wDA6tptSGbbbmwAMU74u3q4llU/HV+948J9rj43bm4c KNembU/j43T1/QOsUwc7fHTl4W1wP+h7PR1vaAewwlfm8tlnnyPPP/+qjanrP+2MHjNd8uZ9MXMe Dh8xxe7hWkLiRnnwwUflwgsvkvvuv1/OOussueGGm1XLtNHKZHWvo4n53L3HMDnzjDOtfsYH+hnL Z599yc5dc831cuONt8r1Wm/bdr1t3Ivp3L788v8ouFtrfM7OsxdJWfiWHgVYuSs2EHysqmMVlnOc D9UigpcVa5QDkCGU8dsJt7HSjphHCHo/wY3Ga7IKTAAQYRL8hCtAg5WaaHUiAUyAH1a7RaIZoU9o sFjiD8gCrPht8AMQCUgIB4LoJ8AQ3ye2VqoN8tOQAcII08FKO7+NFZlojdigyQ94AGSS1FEfHvbV FYd+2QXwg2J1Iqv/CPHhN070ldWbOLT7bQAwVrDW1pWDfnOLuqCZuiMBY35tn2zX/QDWeNVgLV8R AFgIi+zsJtT0Bf+b3jt+8U65k6js306WKyrGyI/dY2R6jGYn0Hx3q9fssYCU2anbWxYhEgBY9eVf /7pEA9AWlosu+peaPeIzTYITJ82Xiy+51LQC55zzNzXnDDBtA863aGw2bT5sgnDDxv0yf4GmsErX BT27j+gcn2SCCXCWmLTOaEVgpKbtUm3HHBk+Ik5XvAa0EAEz6m/y4ouv2z1t2vTU8jvsfPLybcrH bRlgLyC0k5dvVbPYNI3PN9t+/26uOyQLF61WYLZXtSH79MNrvmrckhR8HskEWU6rtnHTQdN6ANxo Jyl5iwlqaOSeyTELtC/qi5oBDhzfTGCP1kCuSme9+i1sWlar3sCOx46baULZlaVeeHPPPQ/Y9fil gVXq8GDxktUGsBo3bm/X4CsbvN2k4OoP45qh0cKEtSxhg6bimav+dpv1o2603d9dgZYz8dL+NNXg AASnzwhEmHfzkHFbEr/WjufNW6n1zFMhvtvaTVYeMDbLEgJ8cLyCRzMUQA0dFitxUxbbmPN6pH+A 4CUKMLZomp+t244abW684qYskdi4xVrmNyvvtJOmidx6UO6/72G5+577FUwetPnG3Lnkkss0wfX7 Vjc0OMD7zrsfK6ApL/fe+6D1d8zYGdZfeFitWoD//fqNNh42aBAAbgDgI0dF3g1xL+MIPfBhzdpf FPg+JB9/8pVccME/5NprbwiYcrX+5194Va66+lpdsLMtYD7X5437uH/Q4InWTq/eI+w4p89hVvfR 3qrVqsFqFNVg5cr7HyCAxgCzH+EUWO2W1YYgJXQBwpul9NwXTiOBZsOZ2FiizyqucBt1YXqibAeN ewQQCbexSo0l/8RIAkj4bYA8wguwXD+SjToJieCnqaMugClhEtC8oFFhdVu4DS2gS/ECwA2nwaIe wlVwD5os+h1uA+RBB8AKDVNw6I7gewFtAFW0hsRz8zPjMY6APcbJz5yIGReeOxOhn2mWustqsFVo 9wNu9AMtIGEb/LR0kYz3yVYmEoC1QgGWrhfRGF/Z2/eg5dl5VJpP/D0q++M/xkj3gWoSnLlEBeEm NaOzWlk1Tdms21seEKeLnvVdUc++/ocOnSznn3++hvKoZufZv/zyO7laBcyQIZPk9NPP0A+aABBo 0qS9/OMf/9SPm1X6cSYGljCZ/PBDLROy3OO0YmglRo+eqqFYkvX8dQa67rjjbrn44kv0ndJF3yWi 86SOlj/N7jnttNPkzTc/sD4+99zL8swzz+lH5mGjp2fPIWqSukZuuulWE4ZoKoYOnWjX0tN3yW23 3WlmNgfWaLtu3Wb6LsxwmEcrqL/79h1l9yOU9VWomTQqq2C9XjVu5eXMM88yOp5++jn9IGNRz+/j x70OYNXPAFjVMwDWOAVYeCs4HgMq8CdCK0h9zZp1srpQiFMP1/Ln/0T+858rdCyP6KrfrfoR+Is+ t4FrwWPL9/LIkVPMtEl9//73lartecV+9+w51PiYlrZDAcVHBpThDbws+HURXfjwi41T06YdFMRc qkGTq+hYX2D3vqWAhvNoaUxbo3yIUYAJHZtUw/b22x/Y2KKRZMwBLGvX/mrtNW3aUS7Qc1OmLrY+ ffDhZ6qJu1/DrxSzuk4//XTr47ZtB8wHjT7Bg6SkzXLeeX/XckUDfk+6p2cALOhhbsID/rNzjfae fjpfAMwqwII+PDgeeOBRA2aJCpDh7dy5K7Tu8+WDDz6166tX//FeNx+YNwEz59UaNiZZefJ3A1j2 gWMA6xXVaN1gc5GN8tDF/bGxGntOaSlSpIzRcjzPYqh74ddqBViNogArd17/+A6hiUAQjxo10lfL BBAAZCGQ/YAKZQERCE3MT34aDMqTxw9gQ7gAvw1wiFYKc9vOXQFtULgNoQ3Ios+RbMQqw9S2bn3g qzDcRhwtx0f8pfyAB+ARs9mrr77qa1YEaBCTDRCBxsaPj9CJfxzpnzAr+pnlKI9GEsAUCVABgMEX zMR+GyFF4Ae+VQsWLvAF2cwpF4nfr26uM6+I8u4HaCOp62Qr4wewJkyIVQ3DJtOu8MUeyY5A3quC Zs3GA/Jtr+UWlf00jcr+aYsYGTd2mixeQKiVnZZeZYea8SgfSb1ZlUFDcOCgAqxq9QxYLYlfLS++ 9JpqXO7Xeo/ofNhtQKZosXIKjjRxtAqTLl0DAAtwwfHChWrOU8G3aFGammbO1phxpVUwHdA0WZ3t Ovf36TtcNVK7ZcbMZapl76papw2qxdkiTz+Tz8DF+g2/6BxJl8cff8buKVuuqrYXr0L5sGkW0FoE /GzS5J//vFBB10s6t1aqFmOqmm1uVmBwnQmitQqGEIbnnHOOPls/6XtwlNx40y1qmrtatTS6Ajtj 1ZeZhLoPtrZ6KGBjK1Gigh2/+WZ+fWdNUGBZOPM6PHI85N4xYwMarPoNAhqs6jWcBmuGCXhVmtiO 9gSBPGnSbPnvf6+0ex577Ck1Rw3SeXFU312/2XmA3guqKbnzznvNPFWnTmPV3By2Prt2jfYdhzTo 9otqRjtbfch6q+ZkiPWd5UlNAwAALWlJREFUevv0GWFAsVjRcnbcuUs/5XOKJpeubseNGrUxWhtp AmqO8+V7SX3IJqg58jM7vuiii7XOHvoB2tiOX331bRtXxo2xjImZr/Nut2pTWmdobYYF5oHygPJc B8C9pz5JHH/+RSGVLxM1hd3bBrLGjZ+ZaVpGMzRDfQcx5ZUvX93O85ysUiAEUHrr7fczTbbe/mMS ffzxAFgdN26GzV1M2DfffJvxdfPmgwZ0UlZuU/D5H3njjfcM1NFe8L20CYBKSFxnwBqAuW37EeMt AMtAlJZ5+eU37EOgTZvuyuNhCszJsrHTxhUXAIAnzwuatON9HoOfU8Z8zVoFWI2jGqwcvf8RzgCX cLu3YrRO4coGaxUiqdvdk11a/Or20pKduv3qddcdX7Jbnvv8+AjAAqgAEjEPhmvDafKyw0eC4QJW cKDHNBuufudD5er3668r79dHLx9d3X73eGnxo8Or9fOrN3hMc/Qw/ck3RQKwVqZuOmZ1mFslFuo/ guAggif5Z3msaUZU9vKxUrWLmgTj1GyzNN1MGdu2B0xy4eqK9BomCARPNQVY+ACtTN2mPjU9TIAB hoaoZojfkybPk9lzAgCra7cAwPqpYSsTnIuWpMshBRWL9T9agyJFy9j1pcvWWPmnnnrWjhEWCCF8 VebOS1YBOcU0I+epxmDR4jQr8/nn32a0FzC1b912yHxr2BGmtEmdrdt0zRztUqUr2rlBg8cbbwBT aHUQoGzfKz2YNmkDQQtvMIf17BXwXerVe5iVK1qsrPn/zJsX0G7HTQloJwCSlIdX7t6x4wIAq0EG wKpRMwCw4qYs0A+VZE2bVdb28hWqmZkY2mPUrJs/fwB8sFeuUkfNqnsNlOLoXbUawaH7ycPqz3TG GWeo39BUu8+NJf1ZsmSV8vg80yS5rWOnPlZfPwWT2xWAIfAxaWFyY1u1epfVBzBhnBo3DgCsceMD i6Bi4+bb8Q8/1Mjk+U0KSgENtA/w4f+KlM06D6YrEAmYNBkLNge4YuMWWDm0T9CQmq6qKt169xlu 5bv3GGx8pD/0hfY5DxBmDkLv6jUBgPW2Aiz4zZzxzmXqzwRYej/37VBN76233iGPPvqk5mo8YHWv 0g8D5gEAizrYg+/lmPnw8SdfahaYZw0Qb98RAFjXXX+jzVXoffOt/JljBr3/+c9/1QydavVt2rxf HnnkCdOaQofz/4v0+fMrB+/XrtupY3YSACwn6HiZ/6I6SL7OvVuwmSfY+dd7bHWoztLPNHRMAzk4 IOYQZj+0SFntmJTcHq6cu5aTstm9JxI6KJPdek+W8tCBuQyQhc+WX3+9Y8Rvv/JojKif/5GUz+05 4MbKj+7cGlOeAfjht3AiB49Yrt0SCcBKVYCFWYev4XD7HhUA+/Rl2mNGRlR2DcFwT80Y6TAgVlcJ LpLlyRvUT2WvajCO+Nbl15b3OqAOLUUAYJ2rWqRNZn7ki/3jj780Lcedd96j7R7QRROLTdB0ywBY DVXAYn4CWOl3oppn1pl5xQEsgArlTbBrG2gWpk1bpGDpEROGL77wmpkREahLtA62T1TYcc/o0VPs eNv2AMACUKg1W813Ze16hw69Mse1WvWAg36LFp1MW4H5DOAG39GoFFPgBPCjDTQW9J/zvTIAVm8H sBSIYbJaunS19ScmRv3etF76SXnqdveOCwJYNTMA1owZS0yzcr0KaPb77n1AzU6JptWCfkTSwIFj 1N/tYjNzLlJBDRhBg+JiUE+YoFH5M9rlHtcuv2fNWpYJWtFWUe/AgWPt3ACtF4dofmMaRDjD8/Ub 9phG77LLLrf2HcCKjQ1ouCdOnGX31KoVcNjfsnW/grzH5P77H7L6N2/eqxkfvjUQ8+KLb+hYPGrl mzZtZ+UbZWi04hRgQSMaQMDN2rW7jY/w14Cs8ps+wkPocDyEd8wPxmtNBsB6550PzGTIOUAL98AH 6HniiYAGCz5xvGtXAGChyVy9ZpedW7ZsrWkF33//Extz6gq+F9rXqHYOjShzrEWL9pqBoraC0TPV XP4vM0XT/iuvvmlaxvEK6BYsSJCFC1JUs3rQ6t2cAbBuueV21V4dNdNndp4/v7KYN9flNsDC2Rhn XXxh8EVywgbHYs6hCcDhuavmh6Mspqb66ldCSpBZmn6FjdVM+ALhLM6GaQyzm9NQ9O/X3xxxOcac RG42lpdv2hyZuQotRKqaiNAE4IOD8zhL8dnQUuAnhPNx8EYqHW+0dRd1Pfo/EH0+uv//4AHPAM/1 qQaw0tM3ma8GL95QO8LjgF7frkDihyGpcnoJjcpeNEbeahIjI1SDsXRhon6AbbMXOgImq3pyeh7B g6CuUSMAsJYtW22CCLPO3/52rmk+ypatbK+t2LgA4OjePUOD9VPANDR16kK7Pn78NPVdOlNNbeXs eO7cJLv+5JN57Rjhym80AMnJ6+1c4cLFzTS5VLVzbB988Indg0mNbefOQybQ2aGrVauA2RHQ47av v/5egd7ppiHavv2ACverVIuS3wQggrtYsTKZbQA44BXne/cOaLD69h1mVXnLWX9j59r1xo1bWXl4 5e6dMCGgwfpJecBWq1ZAgzVx4kwDGbt2AYQD+/btB62/zAM2tEjPPvu8gdiVakJ+772PzP9tw8ZA OJi+ak6lrk6qmaLPbmzhX2LiWiuLyfSwjhtbnTqNAgBrwCil8YiaDK81Hu/UttkYU66jFWKsmzRp Y8f0jw2aAwCrgR1v3brPQPADDzxsx21UW8j1du2623FMzJwMvgTyADduHDAZTp26wOiF94zB2rW7 7LrjM//hI/0BYM2Zk2DaorJlKxnP4M+6dQEN1rvvfmjzhfL8h/eMHdtTT+W19uJ0PrJRJn/+j+zc tGmBudirV8D8W65cFQN5Wd27bt1uTeX1g7ynmkX488orb5pWlmehatU65r/1yitvGAAGaLJBK/Sg 3WI88HVDi0WfcvocZnUfPNmwYYfyuHnuxcECFL344ou2eo3l3oAtgAl55XDmRQiTGw3AhXM3Wgfu IV8b+e24Tm40fFhYZUf+M/K+ufg8+PKQ0JecfyyzJ47RAw88YMmWI92Ir0RONuejwjEhB/gyJ1wB K69C+cQACF2qFJbXR/coD/4/zgGeAZz9TzmAtUoBFkI9w0zh/c/L+4i+lBN0dd0rbTUqu2qtLigT K+U6xci02JmSsDRVNZxkVDgcCBuQsYeqK6fn0HJgGqlcuZYJpPj4VHvlderc244xmc2eE4hhNzkm oOno0qWPHQ8cGFi99vzzL6uDejUzKXGMloltRcoGc6b+lwKJatV/VE3XSvXredME0pAh47Se3rbE HdNkfHzARFhBTWrUAejo2WuQvk9/s3rvuuse0yakpGw0DRXainr1m8gPFaubkH7zzXeVz+rTpAIa 7RB+MwgnBH6hQsXkNOtbWkAIAiq10z16DMzQrARW9HrLBfqrwVz1vgYNmlo98Ip7ATaYN7lWt25j uxdhzDEgEwDlgrJirsKH5p5771efpG/kx7qN7D9lP/7kC+N927YBAPPpZwWlabM2cq36VCHQV63e kkkv7WLO+m3vUQMwlEczV6x4GeMFx73VHytAS207/uLLb6V58zbmr4YJcsKEgEmwQYNmdp3+sY2f MM2O6QPb1m375M677tZFCHfZceeMuVCxUg0FvpOVt4GVno0aBUCuqw/AA4CD94zBmjUBv1vHZ/7D d/oC4ElL22p0fflVITtmbNat22X3MsZFipSynfm0Vs937zFAf5cxXzHaf/PNd1TzWkfnxSHFBBNt YcIL6pBeu85P6nd3s2nRkpL1g0Fp6tSpd8h7t2zZG9BwYQZVwAQopG78txhDxj1v3nym/eNDx80f Nw+mzwhodXl+XN9y+iyGuo93x4aNuQywMNMVKFBAChYsaE7W+K+gMSJJLsl6uQ7oAjzlz5/fBhXg QoJeTHA4WpNwFsdi/rtkvoApVmVhWuQLGoCFOYhl8KzYYxUe7fltACiAHQAQ2li+jqMzTtVOY4am LdRqN+hEoOI07gQrv8MdA9q81zkmD5+7P9SxV2i7fIcut2C4Y5ffMFLagmmPhLZg2l1bLldipMd+ fPO7fjLTeqqP+akKsFYpwEJ4OHDk/v/Gy1sBwJAFW+X6jKjst1SLlVb9YmX+zAWaD3OdatLJYYqr wh/vP1HnAHkIkRYtOujKr3v1vbXOhCT/MbtgskMrgpZg9uylcssttxk4oszu3QfUSlBVQdK/zSSF ZuvRR5/QxSGNM81hvXsP1ms3qhnsMtUuLND37HoTwHfoKsIPPiig2q6yZo4COKEZWKOhGd5//2MT aAULfqf9PywfffSZabac9ig2do6ZHdHkYF5DY4ZghsZNm/bYikO0UfuUv5yDnnvVVEcbbiw4P3p0 rPVn7Ng464+3HMfz5iXa9W7d+ls98Aq+8xtNSeBaP7u3VauOdjxHwajTuDgTF/xr06aLrpy802gG PABmNm7cbfTs2XPQNIjwketvvPGOLmpZeEw9brype6H6eL355nuqAbvYHN4HDRqtY3W79Yex3Lp1 jwLe6lYf5q9HHnlcLT3jjb9cpz/QSv+gHZo5hkaOt2/frwD3Q9UivW/ld+zYr4FAa9riARzJq1X7 0eJ1GWDS8ow79y/QBRiUh/eMAWPBdcdn/jtNIGB5z56jBs4vv/xy5cUvRh+AGkCIeRUtHPu9Ck6Z F99/X9KOb7jhJmsPAMWKQlYn7lXg2bFjT7sPHmKCjouba+1Tb8GChUPeC8A6kOHsTrlNm35Vk/jd Gli0qIEpdy90btgQGC83FtQ9cOAoA1j9+wcWGJyo59LVQ3sbcxtg4QvFiivi9aC5Yjk88Y8IGYAm ig0gRdDM5s2b2zHaIsAUGyuvWKLPaiZiJpFEt3r16lYeEIRJ8Ac1CbKkHLAGwAJoAb5Ydu+3oRGr VKmSLjf9xgAW7aEtw7/GfZEDsCgXvGE2dAmIARQuQTMAzR3zGwDogIZL2uuACcl2EVDhjqGJ+10y YlcX93G/A1suAbA7dsmlXXnoCEVbMK3u2NHq6nPJjr20QlPwsZdWR3tWtLm2oBXaXFveJNWcO5bP gSTI9CeYVkeLo9X1HT45Wr18pHzwsZdW7nd8zGqMs+JryDFPC/SFpNTBY+6l1WlGQ9KW+Hvybmjz zoFwY+6SR2fFN+jJasxD8ZFzLsE0z9yppMGaODFWv3r/CLAOquD/VYVu3bEZUdkLx8gLGpV9yKgp Ej9/qd6z1Uxdu3cfzUzNcaJf3H71IQApw9e9+/0HkKjXEAAbNpDI/rAJGG9ZAAlCavNmjdWlO9c4 5vyaNdsNPAbMLYF+OjMQvxFm1Onq86Ypcf46tAsIpQ4n+LzlvL+p27Xh+uGOI/kffG9wHVkdu3ah edeuwyoTdql82Zfpk8Z1NG30gfP0iT6bxiwLYE3ZAI9YgPO7ycrLQ9qjPoAn88gLEP36G2qcAXaM CaAQ2rz88NYXzH8v34PvwXTXtGnA4X7u3GWZ4Cu4/QAYC80P+k+9XHd9hsfMLddnR1OofmU1roxJ ML3BZZHln332lX0MLF++LtN06PdsZee6A1hNmjRX/NMKDLMzDwokP1DiHETjVu7yK2pmNzRVpHVh c6ELAEyAGLYxY8YcE4maL37Mg25De0TsIRdgkrg/hDIgDhBLydFWYX7kPrRKACSWo4fymwomGKHA Mn00ZggJNGEAPQAhYA2BU6JECVuSHxxnCEd82kID5hyfXSoS52RNjCXKcEz9BJEkVAJ8wOkYkAk4 5DrClL6wrB9TKcIL8yiBOCmPObRipYp2nvJo9eAt93FMPdBJvZSnHdqjXa6j/QPY8pvr+LVBL79p j36gGeQ6Jp+6deuadpFjeAuwJZAo5QEAtM04cS9pY4iZhGmW68R/ArjCP44JbgpQRihTHp6jaXQO 6ZiIibvl+IiPHVpNyrLzm3PURRkimHMPtK1Zu8bqok7K0ga0EhSU8oAxaIEmykMjx9BMefoAn+kT 5ekjfERrRnl4AC/gCcfwyJmzKQ8P4aUbc3gMr7Mac+qeMH5C5pjDR8ac8owttDHW1M3YQxvnoZVy VatVzXLMiaPmtLncz9xjDnIv9fPRwbPnaPWOOXykn4Tm4N70Vel/GHNo8Y45tELjqebkPmlSjM7N jaaJQABYNie0NJv3ySfddEWeprs5u5SmWGkXI7G6OitpaYrOS5K9H7Lyf+YObQgVb5sce8+5Mg50 uT4BmgKamED5UNcp485ThmNXNlS77rqrM6sy3nod7VnRHczP4P4E8yBUf10dWd3r7bu3Pc47Mxj/ g8t5rwf3NdQ88PIwK7679oLri4T2UDx045zl/RlzNpJ540BkctJq80UrV66S+Uq5ul0d3rqCz4Vq x8vjUHM5VL3B/A2uN/jYLZ5Yu3arxgT7h2q7vrePi0jGLbvPNO+OzZt3qKzIRYDli8C0QCRBD/3q ASjltB60YAjhAwrYEPho0BBo1ImgQSCjOUPT5t0AcAhCTJFOU8Mxu/viJ58b9zutDmVxoHfHaMaW LV1mx2gfEF6AEu+x0+zwn+uUc9oD7nfHgE1AhNN+0I6XNuiAHkdbMK30m3462qgLEMIxddIWsaIc bRw77QlaEWhztNIHL63cR3lHG/V6aaXdY2hddCyt0I0g9/LR0epoC0erl6+Oj06zSB+CaYU2N6aO VndMu/Aq1JhzLuyYp6y0fjNW3jF2fHRzINyYz57z+xw4njGH1j+M+bzwYw6fgsecsT7VnNwBWOvW bbQv6f046Or/uKSdct9PRGWPkasrxUijvjGycJY++ytW68fYHv1qPmwv6uge5cEpPwf0meDZGDx4 lCo7AisMAUh/hX5D6/r1O/RDs7u+wwPaKyK5n2ja4c+WLTtU0xdQ2KgF7sRrsPyA0V/5OisMAWdo ugBi7PwOPsaXy13HDBl8TB3e62j9OOa/i7nkjjGzuuvcx3V3b/Ax7Xivc5xdWoNpC0erlzZo5Dgr 2nxp3Rae1kj46KU1FG1ePmeX1uzy0W/MHa2Ob1nNgS2a0j23xzwcrVmNMfw4lUyEDmDxfjp84Ki0 mZIRlb1wrDxZXxM1j4yTpYviVVtMQuh95sCMU2t0j/Lg/9MccPL7L9VnBVPEwWJjUYOBq1x4dql7 y9YowPorY7wo7VEORDmQAw6Ej4P1m664ipEd+pGwU7VShfsma6LmWMmjUdk/bz1ZTcjTJXnZcv14 2Klaq0P2cubrPbpHeRCdA3+hOZBhHs+tMQssWtihEQla2CK6qAYrBy/qcLfwVT9S/XciSWbs6iEm 2KSJE818FG7DoR+TGw74kaYywQ8H/6JIUuXQNuanadOm+abtoSzmSHx3iFkWLqm16xOmsKwWDwT3 G60Jsc8wIUZqBsZvL5LE02hdMJNhwiRNEf5qfht8xC/LL6+gqwfeUDdt4DfoN2cIE4I/nR8fWY2L yY5xwo/RL5G0W2TCOEWSEoh5Mlr5jm/b5k2b/djyl7qeFcBiFfF+fePOmhIjEzRi+bOtNTikmgQv 06jstXtO1lyCsyVtZbpqEX9Rn5NAfj1MDqxmiu5RHkTnQHQOuDmAXxoAq3nzlhqHrD0+xFET4YmU Egi8kuogj8D02wAOgBmckgcMGGACM9wGMGA1JkmEcVx2CwayugfBgXMzO07YfkAF/xxijbVUB2mc yf026sVJneTDkQBK6sQxHfpDrdD0trdTc4uULFlSBg8JxLzx2wCp8JFQIIT5CGe6gg/wg4UNJM/2 S96M6Y7VqwSj5b9fzkjADwsuhuqCgwG6MMMvjyJgGcdxHOmZB+HGiUUW8BsndnYAVLgN0M6K2446 X9q1C0RyDrcxb2tkrNgFIJ5KWyiAxdgc3PebHNr7qzQYOEMuKqOpZgpPkftqxUiP4bGSoD6Aa9ds UF9MXR6uZkOwcnT/nQdufhwPTxBKLnJ6dus5Ee1nt03v91Ik9/6vaIyEtpyWYbwYt5zef6rex1gD sFq0aGkyWnPMRgHWiRYirOpihRUAB41DVhvXWCnHCkC0O2g9gtMFBd/LSjVWdQFS8AcLtwUSAw+z gWb1oR/Awg+HpMOExohEQzZRtW6FCxc2YBhpAmRW3wGEWO3nt5EFAI2KaRiC0ih570WzhzoWcEsf Wyl4+o3ARWE2gMxHH30UkVaHTAMOcHIfoDjcBsjDSX69asbQlEF/uA3/KsAP4AYA5zdOzJkvvvgi Im0aeRkrV65kibCDV8SGogm6WV3LPNj9y7ELPPzG62S/fizAOhp4Ng/t15XHP0u5wQlyVmnNtVZ8 iuTXRM2TYqdJanKiviy3K0A+aACAlUfRPcADJ2BZFMDuQFJ2+ON4um/fIXWePppZbyR1cC/7qlVr 1Wy71dqP5L7jLZPddqEL+qDT3Xu8NJwM9x88eETfyYdyNO4nA/25RQPvwG3bdphcR45qJIQowDqR goGXNsvg0agg9Al1kNUGMEArglmrtQ4IoSH8hDGCmNUJPXv1tPAUfgDLacc6dGjvm6cRTQ6TgtAI gBu/jbAZCG5Wk0WyjRkzWjPef2mms4NhgCd1YVaDj2ij4CMANKsNQAItrOSD3/A0HLClHoAe5dDC +WmkMPMRMoRyAC1W0IXbiPtGH+EhQCjcHKAegM9XX30l7XVsXaDbrOpHMwdfBikdgGwXxiSr8iw4 IJQG9PgBN+oA+LpwFpGM6V+pzLEAC8oPSfL67RqVXZMEfzdFzvxulJTqMEbmz54habqCdseOXSpE SOx9RIU3AOD3HcGZ1f5X4snx0HpIPXrz5XvOdn7nZNusCzhee+01C1UDf7OzMfdvu+02jW30eXZu O+6y2W0X+qDT71k9bsL+xArq1q2n2Vpe0nf/2jDv5WMv8bycypvrHx/6ACysGPqxHQVYJ3LQ8eep Xbu2xaICCPn51PDQIbwxzblciFnRQwR7tFEIeEAZIRfCbWh9EPLt9R7CBPht+Bc5gBWJzxZgg/hL kfolATwAZH6Aw4EOzInUjznPD0zCZ2JuvfDCCwYmwm2AFPpJCAv46Bf938VNe+WVVwys+IFgzE5D hw4xuolh5ZeAHNMssdEi0eqhKWRepSjgROPl51eFdpQYXH48cfxCOwcthGU41TYHsKas5MPkqIxe ulFuqKXpZArFyl11psp3VRtKm2aNZLDO61GjxqhP3EQNkjxR/09Qn7Rxqqkdqzwfo9dGq+/hKPXJ G6Ua4pG6j5Bhw9iHZ+5Dhw7TOfDn79AQoGe40hegzdERODfKaPee5zr0/96n3+9xdf1exwi7l7oH DRqikbivt33w4KHGm08//VRTw7ylx0OsrUDdodulvU6dOmti3v9qJPFnrKzj59ChgX6EopVytN+z Zy+NfP5PzXv4cCZN3E97rl3XT8pnVZdrB3rdvd6xo87AvSOtT37tQjvtwQ/ugz7o5D7OO36HGovA +AXKuD2rMXD1ePuYVR8CvA3Mi8D4BcbG7Y4/AfoC/Avsgb64/ruxBxQTmb5Nm7b2PASX417636xZ cxtb3uXjxo0/pk/U+ccx+X3+/j4nj+WH60tgvh5Lb7g5nnvP4+/PPbzo3buPuXFgydAP/yjAOpGC xGkJ/ISqt03uATxld4tEI0Gd2V1Kn53y9DM75SkbCW9ywkcAJ6ZQP5+qYD5HwseNCj4BQIBgP58q V7+fc3vwHIiELzmhnXuyM78iHaPsztf/dXkDWF8raEraKu2nrZa/lZmqmqtYebHhRI3KPk4WzJqm 8emWWqwzNKZoLplTLCpg7PlAYLEALgBoP/kwcv6QaFkBvoBqfOPIa0rmCXY0juz4++XmTht8kBA4 lvYJvEu+Vc7jbwgtfCCUK1fOfDmhE3ooSxDfCuqrx8417uEcH0TU6ehHcFA/deF/ec0119hOWcqd c845GbneKtt1xwfXLvd7eUE9nKMsv/kwpU3opT60qRxTj5d3HCO0L7zwQk0Dc7fdS384x04b9MP5 K/LRi2sF9bu6KMN4UT88Ifivyy5CW+469UE//10bWbXr6OCjBq0cx/fdd5+lwOF+dx1+USc5b6ER OmiT39DjeMR/+A1/3DyiD9Tl/F/dWNImfaBu2nH88o4l5xo0qH9MOdrm3jJlStvHlZsrbt7w4Vqm TJmMudQ4c+yh1c1v7jm2XIC3b775ps2HJ598UvkemDOUheby5cvbfKM/zh+W6/Sfehs1amjjz9h5 x58x+OmnwNyAXtfXcHP8RD13bgzcsw1d0ENfef55D2T4Xtk7QhUc2QNYC9ZqPoDoFuVAlANRDvzF OFB44ArVVk2W+xpq4NASU+XskrHyfYeJEhc7WRLjF2dmQ7BMAWr2dumaCDKLBhjtHiZrVliyotQB Lczw+KxhWkczitnZZXfgZUvEf3bM+7m5A/aKFy+uqUAu09x078kFF1wgDz74oJkqEDCPPPKIaYuu u+46+49w5xoCDpBy9dVXmzbqrrvuMiGB8KAsac9c39544w27l3voE9dvvPFGEzK0ddppp5lAPffc czUf4QemmX/sscfsnptuuknz0t1g9VI/POI355999lkDq4ASct2RoxZazjrrLOuP8zt1/ONehN1F F10k999/v/kukvoM4EMOXMAv5vn//Oc/5mvJecDfrbfeavcxRtCAxg1NzL///W/529/+pjnxHjWA 4sawUKFCdv2MM84wLVTp0qXN/JNVu8yDDz/80CKGn3nmmZqX715NBH2t5mC81NrlOn2EDvpFnVdc cYUBGPoAzbRHfykLuIAfaIyYW/T7qaeeMj7Ci7ffftvGAH6dd955xveHHnrIhD1lKcN/AAHjlDdv Xk3GfY+VA7hRJ/y55JJLbBz4T52OP++++67RDr38BxRCJ2WuvPJKA8GUDS4HuKdPDnAzjldddZXx tmjRopog+l8GzKnz5ptvNnDGXIQm6qW/zEPug9ekwWN+QC8gkv4zJtTPXA83x7nnRD137llm7rg5 7FL68YwwZrwPAFe8H4YPHx4ZwPq0t8aF+WaSvNxhqfAlGN2jPDjZ5sBX/XJvTL7SOc9+svU5Sk/k Y3Ljj3MlTzGNbaVaq6srx0jjfhNlydwZkpqyQjZrAF/M0C7IL6Z+zOQs9sDxn8UK+FWiySIsiQNZ pKbCVM4LlQUovFwRQLxoeel7d17AubljkihSpIgBHAQlQgphBk1PP/20CVWEO6AGwYbg59pLL71k ggwhBwhAmEE3Qvrvf/+7PPHEE7bClf4999xzcvrpp5ugpI8IOgQ3Qgwf0vPPP9+uA8TQRnzyySdG DyuC+cqHPoQU9cMnwApAECAC/dBAeYAHoIF6OH788ceNVsc/7oU+BDWAA00dbQMuABT4ZBYoUMDu Bah9/vnnVgfH/MZ1Aq0VtNI/gAyggeuAEGjhHKALQQ94QxtDPxCsodoFAMCXs88+20DT119/bbRR JwAT7Qa0AWThPxoc6uMa9dEfxofyjAnaUtcHylM/Y+eAIAtuAL+Uv+OOO8y/FT5yDBCkD/DL8Yo5 QX/hA+AXWsqWLWugGLMuQOHFF1+0+9Fo0X/vNcA7QJ254OYBwJqyweUAdIwt40F9+KB9++231iaL aN5//30D6YAw5iUgnDFjztA/eMjYA574fcstt1g/4CFADXDKOAIOP/74Y7uW1RxnvLh+Ip694Gea Z4C6AfQ8H24lOO8FPsL0PREZwKoyJl1jw0ySPAV1GfOXE6J7lAfRORCdA3+tOaDaqzzF4uTpBrEy aGysJC1ZYOZk0l+xIpe0WIS9IMI+foX4r2EuxOcRfz189YJBFrHa9CvVcoAitBF6CAoAFy9b747A y82dL2YEKwINzQwveGgD2CC00Bi48B4IcMohCBF2/H7nnXdMgCHYAY0IXLQH+fLls/h19O/VV181 rQF10kfAFTv9ggdoW9DcIHDw+2PxhgMMgANogkcZ/inWBhqbhx9+2O7HPER5NCKAWMqioQHIAbDg rfdeNE8ARUAUWjjahXZ44dpGU4d5l74DJPGlpI8AK9pCqOPPSB9pC+0TgtTxBW0SK6apk/ahOVS7 zAVAFXXSNtpOeHTnnXca4IV+aOE6gIb+wSO0VpwDfEI74AyNEfxgnAC5ACPoRzNEWYAJfQBEw2/M ddAIKOI6dXK/l1dOWwSPmBf014FOwB7aRgAX9wMmMbkx1g888IABWOpzHxRuHqAZgn/B5eAV/ACs Ux9aPcaA58HVAaAEZKGxYg7BWzdXAabQOGzYMNNQMg+D+Ud99IG2uA+gFmqOM6ccL473+Qt+phlf 6Gae8nzQDjQzNoyvfoxFBrB27T0kcam7JC5Fd034HN2jPIjOgegc+KvMgckrNHDt4vXSMzZeZsya I2krkmzFJgsW8KkjnAULJQBbTosF+EKL5fyxHMgioC2hO1gggVBDSCKgESgO1PCSZUcAOMGU2/8J l4JPCwIN/xRe8JwD2HAODQ/aGLQdABY0Jwg56EQTAghDk4JwRrghiDlm4Qh10UeAAcIUrQD3Yd5h zzCHGPBwAAshQ5/RMmC+QiuFRgJhxL2uDcAHGgxoRVhDK6Y5Au9SL9oL2gB8ODDr7sUEiEYIUHT7 7bcboKFdaEXr5AAUdQEGoB3NCG0ByrgOD1ygX/jDOYAmGhF+I6AZY8aSuuFLqHZjY2MNGDqNHZpO yuN/BIikL44mNHvMHUBCqVKl7B40aJihaRdeoU3EnAdYBjigjURrA9hAE0Sf6AvjxnhwDGChLtqh T/Df8QoaAJXMUfgPD+Ar5TEPAgQBdowhABH6AF7cx/gBxtBUMhdoF17CJ46DywFCAZhegEV9tA1I dO0xZgAj2oYm+kG9zDPog3baZY4AYByAdfxjTBibcHMc8MWzeSKfP9pld/OYftEGPIcfjCvvB9V4 Rwaw/mLuFlFyoxyIciDKgSAOHJS9u7bJ1i2bTFsFsCKcBzurM50WC1Mh4AstFr5YaWlpZirE6d2B LBzfWVCByRDBijBBgCDk2HnpszuQg7DI7Z0XOv4pCEz+cwxdmJbQ3CDUEPgILXaEATRRhtWuCDAE OgIO0wcCCWGOwEfwx8XFmTYLgch1+odAZqcujhGEACwEjgOg1E273Ou0ZoAP+ATYQrOC4Kc8WhrK fPfdd9YeQsu1QR3cA83eewGAzrSG6Yt6GBPqoC6EL+MEHwAjaOroj9PeABLwseM+QBf+WoAhTJQO YHHdgWlHc3C7lHFtAiwIG8P4A9owadEXZwJFO0Z5dmIJOrMe8wrHbY4xw2EeAxhCKyAEoIUvHf1n 3OgLfaJv9NEBDeigP8G8gs9ubnIdYEtbgDnOMy+gk/s4ZuzotzM98x/euXYBXG7+eMthBqRvmI2d Ro1g1IBkQDt9cZpGtFeMMe0xr9wYQR/9hGbmCHShTaQ++EewatpmLoWb4+7j4EQ+f9TpNJDQDZ30 H1qYe4wFvNOPsSjAisqhKAeiHDj1OcDqSFZ2srOqklWb/AZgAbbQZjktFrFsiHtGtgRMhTi8O5CF 0zurCzEZIhAxG/IyRfDwYgUY8JJ1gp7/f8YOHU4489+ZMxFCgCTMTGgaMP1g8kGTwDX+I/gBGjh5 A8Ywe9APhB/aIUyP+Log8DFZYSrhOqCNnXroP9omBKDz42K1GFo1QALmLK7x24FTBDogDgCBZhAa KIO2BgGKwHJtIMDgb4ZmwMAA92JOcpof7sXUxfhQh9NQIewxMeEYDTjAp87xCjMcvlM4x1Me7Qhj iw8RPMOPCH6hScLEh6B2PljedtEqwRf8kdASUr8DImi8AKHQjIYI7SE8x3+JY7RwgFLGDACHXxq0 AM7oszPdcQ464Q1zjvrpE32jj2jjHP+oK5hX8JlxY+e6Mzk6kyAaMHzTAD/4FjGO8MEBJbRtAEfa BUhDKxq94HL4lrHimv5BDyZg57cHgAIkAuCZj9AP4IIm+OfGyM1faGac4R88gpeYohkL2kWrx9zA dy7UHAf8UPeJfAZ5vt1O3YwRc4EdunkvMB7KqyjAOvVFS7SHUQ5EOUA4DnaAltsBWoAsYsahxQJk od1yWiwCtQKynCYrRQOQ4pOFNgsBwlc5AgeBjVBG8PFydTugwe28eHNzB1SgiUA4859j2oMuzBnP P/+8CS+EECYftBGUQcgBnAAGCHrMi9DPNTQiCDTuYaUfGiLAAdok+oqgZAcwwQvAE07ItEO9jh7q RguBozTAgPodgALEvf7666YdRFhDP5oKjqnXtcF93EOfvPcC3CiLwEbDg8YD2tFqURdaEUAx5hw0 SQAUaKU+QBhloI//mEcRlvCMcYMXmMi4jnYOAIh5GJpDtUu/ACNoweAZ/MIsSnnAIu0CANHYcN05 neMbxDxyfMHUiEkX8EDqLQAvQJexANS4OUdf6BN9o4/01fHPjX8wn90c5T+AAHqpmz4ybgCa/2vv bpIbBmEoAN//kj0Cqxyg+jx5GQ1jd7pIFkm00DQ2WH+AeBaYZnmWP+koawlUydrwdeS6lu3b6wGh xgRfWfrUv9Rx35eCfClbCNw6xkKb0Ue/ShvRH0jRN7r/gEhAnl74An104oOzPh7A84yx18ez3xnn dNdnkLbRztqj2m4A1kw944HxwOd74C+AlSyWvVh9qTCZrCwXOiRXNgvQcsirA1lNgL40BLgE+k4C rYkC+f1qEuADECKLbDq6tpwhC+Dt2zVdTQQmf/c9m6VQ5eySnTIxxgZ1MokAKSiy+ECmQLbBpON5 b/h440MPMsPL37z142FSxt+z4bnL6Hb1Z9lhEiUnkzNeeAYIm/BNipkA6ccX9OODtKPn6Ulf9pj4 Pat817nLxdczAArwoUybeDY2K6dDlmjpl/aJXMCC7urFX8mS9D6kHO+0x5n/0ge7r3LvDgIePtA/ 8CBTW/KnpTn31c1LRZd7VY8tsZ+t2gXf9CmAiKwcgXLWRu7Rge7df4C3NtFm0QnfvY+T98wxt4/l PtbpgbSlMeRFrPZvDsD6/KllLBwPjAfOAJZlQlksACtZrB1k2fTuy0LnY8lm2fxu2dDerIAtG+Et ISKBNQSA9d+uX0lkJcu2ywEIlfkystfJMzlg1XV/lm0BlHi4TnlsvqrvvvpXvFOOT3zVwat7ZzIi L37v19Ev9nZ7lAUYR170O/PbfZJ86P8fufFn+O0+i03Kd1vDP7r7a7KOn7rv3dt5R3a38Urn3O82 7vp033Seu9yretER3+je/YPP3r57Gynf7XZv78dd1lnZM8bdPpZzHRsyVsQF8aFeyAZgzdQzHhgP fIcHArL6UmHfiwVkAViWCpPJ8mWh4xtsfLcvy7KhjBagFbAls4V8dSiwhgTakKA/ND6YPvC+faCP 54AoY924Twzw8mVLgbP06oXsAFi37wivY+V4YDzwzR7oAKuDrOzFylKh/Vg9k+V/huYgUsuGMlqA lqwWsBWS4RJYQwFh/gq6Q+OD6QPv2wf6ePY749y473FAXBAfKk7cAKyfIv8BdWh8MH1g+sBH94EC VitUm91XqEDWqg3vq0DWQfVl4SqgtSqbterrwlWb31cBrVUZrcJaa9XS4UEFuA6qDNeqgHpQZbqG xgfTB76gD2TMG/9ILEhsqDDx8wv+Ac2j84d5lwAAAABJRU5ErkJggk== ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/image002.png Content-Transfer-Encoding: base64 Content-Type: image/png iVBORw0KGgoAAAANSUhEUgAAAY8AAAErCAYAAAAmFw8fAAAAAXNSR0IArs4c6QAAAAlwSFlzAAAS dAAAEnQB3mYfeAAAABl0RVh0U29mdHdhcmUATWljcm9zb2Z0IE9mZmljZX/tNXEAAP+QSURBVHhe 7J0HgFXndecPML03GBh6Eb1IFElIqPfqbrmXOLaTOHaK1051nHiz2d3sJpvETuzEvcpyUe+9AxIS CAmJ3tsMDNP7wOz/d+77Zi6PNzCMBhX0rjwe5r37tXO/e/7f6Rk9PT37zSxfPz36SV9pCqQpkKbA oCggXuLt+D1s2DDbtbfGGppaLGPECP87fB86988SfwzT72HDhh81Lt/Hr+S/k/sL98Y/D22Oaqt+ U32e3N8x/SfW1zunpPnxOf2OyBhuw4f3rSVqpr/9Hz125HCPHT5yxHr4cVr1z3p756n++Pew4UfT pL8H1XOk71lE8zIrzM3Qs4j6GaFnwhwzMjKifvXD32HeKenWNxiTaMnQ/xXqJ29QuyXdKE2BNAXS FAgAkACIABQR++oDCOdgsctZaWDI/l0fE42AJdFDgrklg0f8uNsfkGj46NLv1Ayxb8yeniNHzS8O AL2d6B+HDx8OXUa/E+vqZcACweH6ic+XNtF6NYaDBb8ZL6wyMUKsr8DUw2/uYJ39rjXFTgwkhwyd nZ3WI/AYLuA4IuACQLiSQYO/j6H1sX2PADwiSqSvNAXSFEhTYBAUiDOzwNxgktHJmp9jpY7kYWiX zKwDAxuIhJE8h5NdRpwpD5Q5BwkrlcQS+kteA5/DuANQHm+sOAOPS3UDnV+cBkBUe3ubdUlyycjI dIkD8GAumZmZvbcmA2wcuJJoehjwOObq1tq6uiKRKn2lKZCmwKmlQGbmCNP/3vbXUcDBCTn8JwAZ wEnWgSbVfcMTqppIvRMHojh/6u/fJyZrH5/jVM/9oa/U/K9PzYS6p0/xFv07qIuitfT1F0lWgRlH ABKpk/rns0erAaOV9I1x4pWFOyKatbe2CaCHCSy6LSsry0EjAGDvnQlRZSDSxzHg0dLSZt9+aLfV 5Yyy/JzhQqY0gAz8IaXvTFNg4BQYrhe1q2eEdezfbl+8vNLGjCofeOO36J0RgIjFiTdGaqCTYXZH q676lhg+D79TMffBg0ccLI5m5ififRGY9TH1o+cfl0wCkPRJJJEJ5GiwSn6ocYtQfM39q65SgjTT Eli1SfLgnwAH4MVPmGPc7pFKakrV7zHg0d7eas+t3Whd43Jt7pxxjJlY4Ft0t6anlabA25ACvMSo nHfuPmRbVqyxj5656LQADz8bo5pxdRV/sNLh/fKQOFM62mDuJvTorK0+AvON7j8Z8IgZPeIGkKP2 TMSMg6Kl7/fxjdN9kkWwe0RrjeYd5t7HP+OqsaMP5XFHgfh8o76OZtwBjI+2z0TL6Rs3vjz14M+j ra1d5pajNUrB3hEM6ABKUB/GpZJkCYX+jwGPniOHbUTPYdu0fo8N7xhhOTm5OkWcCIHfhm9vespp CryJFIBRdnd32M6dO21EZ4cd7u56E2czNEMfbTfoY26pGM/JjBjUOsEQfzJtT8W9fdr8SA0VADOV fSDZVvF6bTN96xmY11UAFbd5CDx6xNuFDhHUJLyuAA4M+sGAHpc8jvfsUto8nAjyBjh4oDbq8PVi R3/S6Mk+2Xg/Q9Xnyc5hqO9/o9dxuo/3ep/PG0UfvWNHDncJQLpl79DJ/PXO+01sn8pgfORwQvJI nJxTMf6B2EECk4svL5WNIPQf/y7OzI9j+O31YIqDVACE5PHjkk+cyaYaP8y5z0gefRLURakeWdxg HeacDDgna4uOVHFmHR0CD4QDGctRmWI0Z//5HpT9I6iyAoicaEulBA8nmP4bIeOKY1Qc5BLueHG7 Ulwzx0SdAMxWv7vl08xP1gj8iBOfn2hW8e997Kifw/STgQgmg343qG+Wrb/9Gszbl+i7Ew8BXZma Y+/cT2aOJ3svjEOL6NJ6IFOm1gCtT5l+MPHMunToYOOxzkE9i6OeS0T3lLRLjAdZeWaMd0rXF+aV OAV2am+wIdhzCYvk8Z9QYh90acLsLfbYqd4HzNDfr7gv5cnuo7fo/b0SyJvscJMMHm8EuU4kZQVD +fHmglR6PClmsOvokIR7RBJGhoCC2Juuri4HkAAcJwtK/YBH0KsBAMlTjfySeUFhgDCh3MxIp9ku D63D+iw3a7i/GEf0IUb3wuwRVtcqhNN3Sa7eA6IDiyrKlQpN/dY1d7vUNbIwA09pq2/pjvo4GSnu qFF7rLxAbmuab73m6Cg06L4GtBw7rPVAp3HlWZahcffVy//ag4UG1v7k74qeU4meRY4YY2PbYQeu 1zdetA/K9RxGqKOjaRcheX72cCvIGWGtHYettVO61FO2vkCRaE4VmhNraziJ5wn9S/IzHDjYU97T KZyvRzEkgsYGd/I5+V3wRrToZUBOuxgf8cGPPeHFwzwiAzvAffRM42oi76Xfg2IYr28/9P7rOG2S n0Pi3Ns7iaPnGO/o6E77bCWp1tn3WVy9F19rBBh9QYN9Kq/k9fRnME+9Yb0f/XR1duswF0m74SdI GwHUgpSE3eNEQHgcySO1+YWTJkzvmgUlYg5EjprtPtSpl264jS7OtFVbm+2J1xrFHCUmCWA+eG6Z ffLCUfZHP95mr+xq9TapnqMbkNRX70ksQS/WDfP5gysq7bK5xfbJb2+286YX2OcvrbSN+9rtL27Z 5ZtJkv+AL4gCAx8hhO/SRL9yw3gbVZRhX/rxdmvpOBKdWE/R5WNrzPefXW7Xn1Vqo0sy7dbnD8nD rcbyxGxPxdUhUJ82Ose+dPUYG1uaaX92806nXZ7A+GQFNt9c/pZEh4OvvWeCA8SXfrTN2rqi036n gKm8YIR9+doxNmtsnn37kWq7c1WdFesAcLLjnQw9AGSuP79xjEAt0/7gB1v9kANAp7q4m0hfnfN0 8OmxP71ujJ0ztcA++90tVqtDSrb29Km+mNmp222nevbJTD7OIOOeROHzVE8/fBaoEO2tCGgC/VPd 09/a+mPux9t5fXEXUa/HGy/+tJL7HMyTTNVH8sEueU39rSXQ7lja6K2V9qZbkkcEHB606E4CfT8B SJwCfpg9/nr6lzz8FBCdBOLXiOE91qQTXU1Dp162sbZud6v9+Ikay84cZhfNKhIjrrK543PtPx7c j4+Fba1ut/vX1OkUKBHJzSdIJ1GvIYK/TadSwCdLLznMnM8TWOKPkXf4VY3DyaSj87Ct29Xi35fl ixnpM5eAHLWjDRva0k/v3w5MkRqFU3eBTuEdAkLm+MKWJmeAMPURCV9t+ggEjPOe+CkET7RITZd6 I6fqgxP4wsn59vuXj7Z/vX+vzy9XgJoxgpXGjYyJ10d9B3+FMI9e+rFeWkW420vPMBvu46Lv7TVt ktq67MyJeaID5+roS/emo23SOpLnTv/QDfUhtELKRLW5clOTnj0u3dAuevGg6YGGw7Zhb5udP6PI pZ1wqkx+PnHKJQ5I0UcJmvopMLG25GcZ2vbulYT09vzmZpd4ezTXCB6RkvvWyVqRgjsFGKyFPcfh 4+UdLdbc1u2quGgfRGqsgeyD6ODTt5r+6Np3R2CQyYwr9V56+34a4DHVS9L3GR5VQeqI/t23CcL7 FXldHZ8SR9tW+qC5P0YYeT1F8RhHSxipxo8+O3YOfeOkYrrHVwehooqv6Wh6xaWsPsmmPxoke2Yl qDhMh3wOewIOQIN3NfwO9pe4/cbf4v7Fu97BUxvME2h0FEUTTWAQNY2d9rSki9+/Yoztreu0nQfa XKX0nw+3ujrmD6+qsj2HOuyXzx6wR16ps4dePmTFedKt6QVtF/MsELOEcXfo5UUfjsTymUsqbc32 ZrtXQOPxM4hv/qwiDnn78wft9lVSg6ntntojVifVAifcDinyI8YWgUxOlgBFzIATJ33D2Dh5h7/5 7EpJTfPG5eu0v9/7+cHj+zznCydjVDDtkj4AnjyN1dIOQtPvcJ2sg190ZBNyMNJ6aUu/8QtApA/m i+QEI88RwOIAv3hygds5th9ot2c2NDoDy4E4iQcG84JRBykMxoakxN+uIhRtoB1gzOmYtUNP7D+o 32jPeukXWrYKcPkewA8bg02DlMW4Geq3RXNkThhvmTtjMnc+Z43QMUsf3rCw1KaPybV/f3CvNUn9 9V+P7Pd5lORFtGtTn/zdrTlt2Nfm47lIjNgsIhB8mi86M7+29mj8yB4immpMtwMlxhshmmLbgrTQ HgmBQwr0HKG5MMcOzdXz/fhhDKnI7PuP7/c2qKEYt1Xj8CwBjHBQydRXF8wtsotnl9i/CcRrm7rs Vytq/LRVor3KXmoX3dhc7FfW1aH27APoyyEkPB+eM31nEoClhgAr62LrhvFSCT9BnRC9Z29feIjP vE8lE07BAwOPvj6OBo44iER7t4+pn5hifUy9f/kuflpPljjCCMmIlervoz9LBpFkNVDcMN47iqMI ABBJXH0MPPTdN9fUzN2PgSnIEvUbRf33qbz6A4iBAAeDpAQP1/e6P3CUWiD54uSakxV9zgucpV6c MWqCj7xSLzVVpV0uFdNTr9XbJXNKbM74AvvJE/tth0Dm+rPKnelOr8qTiqvJnt3QYJ+8aKRdc2ap n/ZgqNNG59riKQW2X7aAqtIs23Gw0xngpJE59p2H9kqKIaNKjxWKOQI6C8WMd9d22Pcf3eeA8tlL xtikyhz7L93bLOb/yYuqnJH/y717JBXl2Z9eO9b12is25woIM+1SzREm/F21r2nsctXFlQvKese/ 58VD9oLUcVdrjueeUey69ANNnVKfFQk8O+xnT9VYdUNXL4DAcOdPLLAbF5bZHoHr2LJsu3/1IVu+ ucEmag1njM522i3TqfyggBgADnl1YEwL1PbyeaW+ebbUtGs+Rc6wfvJUtYCzwz598WibIXXQz/X3 dn3/ucsqbbTo9O8P7LUt+1uttCDTPrpspNRSI6xM+v9OMbNvikFG6qaImXdI//nuJRU2tTLXmRyM /5fP1thurWfJlEI9j3Lb39BhVSVZdpfW/7yksxu0ni9eU2V1Td22fFK+GG63XTavxJno9x7b52tZ NrPYrppfJrVYqy1SP+El6JSoXJaRZR8+f5TASjaroizbJHC5e3WtA2uXzE1VZZn2e5dXWZ6e66+X H3Cw4/7N+9tcHXrOtEKtLcPGaE4/F833aK4fPb/Spo7K9X+zP17a2Sz7WIYD37cFcADW5fOKbUJF tn5yrLq+y76n5zy7qsD+WPsAJv/MhnztsXZJScVSX2YKEPdJFdth8ycU2HvOrrD96rtKz/Dhl+vs ydcafE/zAzDsqm2387QnarUnbtbz2KS5nqfnOq4820oFQvT/4yer/dCUcdQBIzpIRO/YaYIcCUYR 1+mfmMGf+I6B0udEapb4SMl9Hm2HiE7wvCehzxD/cOIxjgasaBw+SxWXceza++s/Pt9kKYFejtcu 3H/kSJQvLG7niKutjgasEz+X1Gorl/QTclxSsrAE94kRAyTjZMmptUcMpUOMtFMZHCN1wJmTCuwC MZRfPL3PX+BPi9nD5GE0k/Wy3/58jb2iF/6GheX2wrYme2l7oxhX9HLSD1IDv8+cVOgv8w8e3SOd XZSOC9XT9hrZUbLMbjqv0gHsz3++xQ5qDu8/t8Luln7/1pX1knrG2rnTiuw7D+yxF7c2+ksPMD2+ rl4MJ9uuFSigjvnW/bvsjMps++83TbblGxsEePvsbz8wyf77ByfZH3x/o079w+xa2Sk4Wf7jnTts rxjMjYsrnIH/TIwjU2vmhDxNwPWND0zUulr0+X776o3j1c9E+4rm9qIAE2YIo1opMNl5sNVtD1Ew VZR0LVtP5eoFpX7a/+b9u+2V3c3OVFs6uu0vfrHVx/3oslH2zPp6e2D1QTHvSjGwIvvhowDEEfuq bDjQ+qs/3WILRP9PCWyqZFsJnlFtAg6Y/p9pXj8SqAOGX71RtgvN/6da899prjDrnz653/7mfZPs 77X+L/5wo1RUDVLrHPbn8ei6Q5JA8uw6AQoSyLc0z1lVOfa375voz/G3K6vdzhKtKcpzhKruojml 9j9v2yEAyLY/vX6cNWtN97x4ULQdYTVi0mUCB8DzV89W266DbTrxH7aNe1u0pnF235pagXijff/3 Zto+3fufD+/1w8A5era7BKoOttXD7AqtDUnwn+7aoedVbh84d6T98Y8325euGWcfu2CU1KgHtb5G 7ZMud+547BVJxhr3sjnFNkYg8R1lWMA2xDPcqTn805377Q+vGWtff98E2e42C/x67Lqzylwi+793 7dSYrfaRZZV2UGC7fk+LA3d1XZct39QoVW6xnifST59/ffRaRuDhP6fYOH9iNnBq7khmTMmjpGKC 4Z6BAkZynydm7glJONEwbih2FWnirMx7iJMJ30d5oCJWGcA+tesvzzRJ2gkSsR/I+6SJZNfe0N+J wCOZpslZcJMBwO+POWfEJY9w74meU3+7o1/Jg2CS6OfYptHnEZKGNARIKIelYuBkWCp1QbNe+r2H 2mSfaHbwoCMAAx3jX7x7oqsJHpE6C314G+oB76tHXjud9sBLh3QqHqmXvFZgsdeZ9V++Z7IYRX7i 9Bzp1/eLid256oA9sW6ELdHpHP16Ye7wXvVMt07r3WJc6LFbNAaMlc946f0Urr9f292i02KrJJxs AVW3nT2t3Of/yNpDmn+7Pay5XD6vTP0XCOgO2O9eNsZPpb98er/tl6MA4OGGZ4JvRINO9XHmxHyr LM6y/7tmp+2jD/V1/cIKnegL7JnX6nxOXF3SNzlj9Q0XERqVz7Mb6229GOa4shy7+Zn9VpSTYZ+4 oNLVKcz5UHOkfuoSiGLwbWmPPM74PVMMHeD97sN7dPpvcQnpmfV1LmndsDhKfwEjv0z3cBKurm8X zQ/bP929Q+rHDklTxS4VPPpyrc/9PjFapCCkkdu0ftQzbDb8+F8TqNGGgwK0Wzq9wopFu/skTeyt a3dwhHkzx9KC4VIRlUpCbHe71dMb6uy1Pc0OEBjZM7ClicH+anm1gwdMt1Xr2aA1rNM439ehAS8x +oBSeEXt0xgPra118Pjpk/vsXoEQL/x8Sbpj9DwB4Q0a41/vbbeZknSRTDgkIDl34XHitOfZHZHE 1iIbTauN0nNDXXX21GKXHr77yB5fyyPaB+8/Z5RdqL38Hw/sdjBBlfVLPZ/pVfkOHqg9kbB2H+yw d2n/Xjy3VLa6Fj2/EQIqpMv4u5RQI7iKOGGQ6e8tTX8+YAokn9BpeDxAiQNYAI6+xIVRmvLo8hN1 73s64AkN4MbjxaD4yCmYcKo1pVKF+fo5qLhm92iV1WABOiypH8kjSB2J30kEgMlja4gGj/6Nvr2x rUsn3Xz3dHni1TrZDqRHTyR8417u4zQ/vjzHls0qsWvEWJAkYERcfA9DjYwe0herPS8dunbUY3wM 8w/6RFhulphOp5gop+cKjQtDCGPitw+DhdFwdbp9RDp0MZhI/93thHVjUqxv7sXzyU8ZsbXzN1Pl BB/psKN5dupDN7wlbEXhWefnRKfLXo1lglGgL+eCqfZKeGEc+gHc9OPutGoDUPJv1nNYQT5hfbTv 0PqwVXDB9MoKo80+Szad/Oxhcm7oshFyLEDNSHuu6HdEB+h2lwCYkzp2lD+5boLfg5uti+0JCrDx nHYaCvBtk8SAeomR+dsBMUGskfJcaxcQuM0A+hA/gVFajVGpAQY7pSbimZbkZbo9gmfKc3pegLNZ YH6FVF88958/s0+qx25Xr50t9dDTAl/GYa8wh5DmAeCs1V5h7/mJERuLxm3SweEzl421HXIY2CPg OkP2GvoDtPHCYo2t6me47od5QH7fY4lnCx360mhHB5yj90H0jLjYU9BnuVSxqPwWTymyRZP1I+B9 VWvOSfbi65XuTy+1VbSVw4EoqGuOVX9H9wW1TmgTv6+/NuFlSf599P2RJBGl+Dja5hFXIUXvQjJ/ BjQOy8Ds4OF7qdslkEiVBVM72bn1N+do3/U53iQO5Qle4hRKTK6P2Uf7JQKL6P5onUdHvEef8xOp R32RQzVt9Z1a8uhlgsEtM7ZwjQ890d3z0i/SC8Kpf5N03Iv1+/evHCfDd5NOvrsjY7j001x4v4yX KuXasyrsv/9mq6tAPnVxlV44jMMRAS6ei65cJzUxO65RasupHqYCMHBSxjCLWgoGwelyxth8/26e VFo3i9HUtXS5MZPrctktYHoRIx1h03QqXy21GGqraaNRuVRIDdIkw2qmmG6mVUjfvVyqoE9cOMYu 1anxcalmrj6zzNUbyyUNjNapFOZEe07bZWKEXOX6HYzarPnFbY3uMHCFJJbH5TBwheYBCK6QKox5 BJqM0gnfT/GxnQsjRh1XXpjl/eNoUCx68Js5okOH2XFdOqfMaqR+O0sqPa45ksxQt62W2mjZTKml 3j3JVurvSzWP38gY7JKLLuj14Eu1YtDl9tfvnezjwEhhtEgp7186yi7SCf+xdXX+vLA9rNxUL5pH 3laTZWO4ftFIuV43uaSB7alMv5E0Pn7RGPvc5ePskCSdJdobXAsnF0rKrJVkcMA+eN5o+x8fnma/ kYQxaVSOrd3RrJ/IYwsaAgAPSuL8g6vHW4mk2Ff0/XjZKr6gvwEc9hwvxDnTSqQeGuNSku8VPTv2 CfFArA+Qor/L9Bwv1EHl55JwKIaDfeYTmuNvRY9GrRfa3bB4pOwe9W5gR401Ug4cL2kP46F2mfbk fVINQqsGrekp0Yf+eeZ5QvEi0RRJlatIexPV6Q2yJUHHr9282f7qfVPc6cBf8yQO5adeT07nzU+z KywqMO7jca3wXTKTPzlO12efjcaOpIaQ2TYugfT1O3x4lJacw0S4aAZAFBUVKCq7Q5Jyh6utori2 ABxx0Bv8oztaXZW8/r5+wx4JNpRISop7V0VrSrZR+/kkcUAe/CxTtzy+q27ClhFvipcMRlSMuE++ eshfxivml9oU6flnjsm31dIl//TJvXZAKqoZUhXwUJ567ZBsCbn+Eq7a0mAfkpETvf13HtxpjToZ o764TTpyGHOlXlwMorThRIfuGa+hBoHCUzp1on5AXfGrZ/b6ifei2cViXFn2Xw/v0mf7Zf8YpjHq 7dfP7hO45LgO/VcClUmj8txmgWTz3Yd22SViChX6brr08turW6ROaXPD+11Szfz5zzYINCrEnEZL 3dNlf/7TDX7Pe6W2WCEmA9hhLIcOzBND/0SpODCeo4bbvLfZ/voXG+16MaUPyeDLmH998yZbu73B gYxAINqNV5uiXJ34JT2EWAQ28uyxBa5G2SF7Dm692AO4H9A6UyqdF7c22I8f3+MAOFGM9Y7nqm3u hEI/9bZI+vvbWzbZRwWAEypytY5yqQEPSnUXBSJCwzmyE9wstdvXf7nZrltU4R5H++s7nGlvSMz9 moUj7SN6To1a/19pLduk1we4vv/obgFTqT+njs5cqa6axKSHO+0e1Djf+PVme/fZo6QWK5UdQgbx F2q8b6Sgb9230yUdnAmuW1Rum6Saq65ri9xiExIa5p9HXj5oU+Q08dgrtfIdwStPxuin97oar6W9 y/75ru1SL2IEz/JnCm1g4AQH4gm2SQeQ4bJ9nCV7z8sCpie0TwHO21buF6hHINKqfn7x1D733KqU pIT9rUbzfEoSM2qzW3XvX2rd7z2n0j503igHzr+6eaO9tK3BoM1qHRA4pPAeECjpz0cSzbgyORis qnFgL9Y4D6896IcQ9mVk3whX4u8gfQz1m/2W6C8OHKcePI6irf/Rx4xdvyBeFbQWcWbs3rqu2om+ z8jM0vPOsOqag8rtl6MI7Czf437QS2hF+HfkQcUzjdYWZSXo/TPxWXTg7/+ibXRYPr69pq/jo+8L arW+9UVjBXqHdicHxAPZPqklD7cJRCl7XV8Wu3BhrJXO/dsP7HBbBBdMJUs/94pRoKogZqNItocD Et3/8fatrnLhRAcR//2+7b2nR5hhntodauywf7h1izuZIV2s0Yt581N7XXLB9ZEYkW/8epOrBegH wtzyrMCDmAO9oPSLiovTK8zkoPr7xzu2RgxZ9gRXQqBSUH856u/uF6r9h5Xherl8Y51vDPouyhuu k3CjvbyzUdJShtsR6L9Y63lEjOBuMQYeHmqtVZvrFeNCjErk4orennHyxCheFVOFseYL+Dh5skGL dTLFxvC/btviJ/hw2mZFQf2C5xrjr1TfqEiIAWECd66qdjVTcBX91n07IhfXhCHuFoEl4MGzOMD6 RXfmxPccqlAx/cOtm31c1ok94MGXavRzwGkOENNbkaSeV3Y2uVRRoJsw0jN3V9/ov9tX7LfbxVh5 TxjrWdku+BzPLu55TIz/CZg+7sW+PaKo71x9zxr/60HNW+NBQw4WzBG1W1g/86rWvvmbX27058c+ Qj31/+7e7qrCKH6iR7aGvf49S+RAw55jHS9p76yUlBjmhMPFiz9uiNyqRUeYOQvFzrJHNp2nX6v1 dfMsVm+tdzog7RaKDgD4/9E+ClHyCLQlkgJXaL889or6UUv2AXP/zfL90X5VPzhxPCka5Og79iXz 8owLcezgRKwPjmA/9KpyA3ld35739KdbdyYYDA1xDnt04MMxi473dzyGGzyknMmLu7DfInVUJAm6 qzWFqpAonP7aj3oBc3RYu+uuO+3Xv/q1vfd977NrrrnGVZm4wQ5TewcSPTscdzwbLZ5Zmj9qrgx5 FIaLLrEDU5bWz0chbu4oMOmrCRKp2eLLjdRpx6PfQA3svb0OoZR7HMmDUcLP0c+Ph8CL0Kt719+t +mHhuWKc/ky0alRSXNyHThx3UL53EdGZT+Q6BgMQn/YLY2a3Hm7UNw8kUfJR94d+eNCc8IfpRfW+ NM34uFF/kbY+CoijqyifE3/BoGCIzlB8Xs4HfINwD/OCIbSLaRF+EXToUUxHNC/sJ/TLnNh80qL3 nhz4vLcPgWnog3Ywb4ajnYMzxvLYhmGzeNBa4kDCBg3juO5V48I0h0tjxoYN8QO0YxOzPvp2fX7i hfR8YIkXpvdZ6HuANtLwscH72hNLwfqxCXFYcLol+sr2cWO0Sxx8sC1xH8w0AJHTJhHYFdmaoucU nfQ0T43je4UPEjTgK0gMZiKhha8cQ3meCbtBNIfo+2gcVA/RKS9kG2BOzN95FH3qpQ8gBbiF9n7G UHt+o5WIggZj+0DPkH4IYoUOkb0kWgPPI/58DmtM3+OaGI4BzC28D0e/RVH7CPyds5yGV4he7mOA qZjdMUsXPU5k5E5FrKACSma29H9kWIYz90xXZUU05z62U3Z2lh3u6lRV2C7Lkk3xyfvute/+0z8q hXmrtdScY1kC+KysHHeQ0BElAT7wE/0bnqGHfOSIOIDbQzjwyRWfQ6sk5gAgkZQShk6sOOEo4842 vUwgOli5/c3NFP2rNVMZ2uN066XDKdpb/YJH5D3E7I89EjlfC9ISTzH5lgSj8fuSkPSotrHTRmCC dJdsV+zvM55GYPy+mfrpz6fA/6WY1zGHnMQ9zkjC3BOfpZqXj5t0X9jYqfpIRZNkxhGnxVEvSWCw vFxJdIrW0ceEjvo+xf2BFketKYl+yesPSw1t+qNdvM/ee/rbE2HMpA2ePHYfTaIbwxjJzyTVobX3 nhjYsv5kGqaiRapneKLnc7x92fc8HTX9BHt6IkeI2uZ5HR35nAwMyV5CA3G3jd/T+++gNkoQmTri LhWgSRkhkJfhGOnTAV3vSoYYekdbs7i0AjubGqytud7qDtTY6hXP2PTJ4wQebTZOBbq6Whqsvma/ dQuAsnLyLStbqqysbAGKstJy2BXwwKgzFXmaE4BIXnwh95+X4fVq3wn0SPxmupF9pY+ZJq+99/VI vB/RQSQcSFKDsp9FThFgxPlRP+ABaAQL/bHgcRRDS/+RpkCaAoOgQEjZMvReMIOYzClqEmeWxxsi Ahg/nHhamIiZ9q+uCXYGPxEm2kYFj6JOHK6sR3FnqKyHcdL1070cTSQ15hfkWbdqW2zZtNkO7ttt L6163nZs32pVoyqsavQoK8iQXW76ROsWB967fb39bOM6mzx9pi08e6kd6W5W9ceEjVL94+jIKIyd I9uIybj+7W/9u7W0tNqX/vhPLD+/0Do7231STo0gfhxlk+ijzdFrDp5gcSSIrzlSpaWmVR/tI8G2 zzYzVA+7X1fdXv/nNwLChmo16X7SFHg7USAcEU9jtVXfabv/BxNO0hETDABy/Pvpt89cEv6dkHIi 9HBG7f3hjKGffEkGmfp726tr7bnlT9vObVvtSHuTrXvpRdX3brGDeTm2JSdLDhVytCkvs4LSEtu5 R7bT3AKbNHGMdTRUS0iR3bLpiGy7sg/KG6u4uNiKixRfVlgku2+m3fzzX9hvbrnZLrv8SgFVlzt8 kMl2mGwjPl93m+2rZd6frSvw3xPTrz8RI6gM+7L0DvWr0W+EeZh8f+g/0Im47SOR/hsxMRWxXI/s BtvIsIho6fpI/XsgIuxA5/JWu6933dpVkfH71F8uwrv6JlHTo58he+/DvnICA2aqLnBmYByvWXEK 1/Z65hno/2bts8hVty9w69Q//Td2hJDsMPzuG/3ovR55QUUiQ9+/AZH+3okQC9HHHxwkEu3dyYfT tm6LVEdi9AKExkMHbflzz9r9d9xqDQf22UiBQ0PtPsvPOCzmn2WdbU1WV9tk3Xm51t1ywA5UZ1lx abkcR/Jsx6Z1tuHVl2zK9Bk2Zvo5lpmdq8p8bZabk625F/oYjz/ysH3zn//J5syebX/ypT+0kpIi 2Una5BCipKtaHTaRKN47stMOkxrM1xvTWzuwJEAUqaLPmysCiWBD7CvNGyS2OK1C3EqQUpBO4naG odkH/QcJoot1fewgmZqawUAIECPXUBTk1u2BX8lY6WmxnYFGBI6M8Qnl3mks+bixXrvO/ZgiK/Ip vTwQUv+HZ5K7f/QzJiQHzKNkj/3f199kCeAjWSQeWHir4W0UFZ8a2uVF84w8tvwVPEka8tLiWNCr Shji+Z1wtTLOJlI0nPDWt+sNfTr7/okbTuIRc4ydyvtZdB9LiIA32WbS+xlOENrqeTmZtn/7Frvz N7+2Rx+8zzqb6m3B7OmWq/dg96Eazzo9ZnSF5Y4sdpBZevYi1ZbfZbtqJGkQENjVJpf9FttfUytj eKZNm7fMzpgzXxqqFqmn2mxkeamtevEF+9a//qvq0I+yP/j879m4sePUptkdUobJCzMySRIAHdXW iYzdCdVSgjS9B/bEuvsAoi+IMdnmEcfXwXhlvZ591U96kijCNqExHFT/R0Q1GNDHLploV5012v/9 zbs32apNhyL3UydmFH181cLRdt2SKuUwarJ7V+2z371yilwlM+wff7teyRQVX+DuuW/hy/lrIsvq ALDWmZ7oc/3ZVXalaPPargb7lmiTJUveIA75AyIM0dZlBdn2O1dMs6ljFFD5xA6lXql2d+T4xX0l ipv55GWTbOa4IvvZ4zvssbXH3tffoKSamVJZYL93zVQf5wW5HP/LHesjb7shlECi9TDPqTZ9bKH9 +OFtitE4IEbRjxkvMWFOory4gNq1i8fYxy6eZP9y5wZ7flOdu+S+cfgRnTijLAZv3KgD2ixDdlPE HOMMPgBEfIh4/EVKb6F+QaSPbt7HYTFkuQ12HO5wj0rK4+Tq1L/j1TX2i//6lq1ZtcraGxqtXMw+ a7jy21XvEy7A/PMVuFsoFVSJlUkaaWxutQMHFAxaXKH+smzarFn++9kVz9sweVCtfe4p2y9wmTV7 po2uGmuvvfy8fe873xSQNNlHbvqELT77XAFHm7V361AjNVin6tPnHtGcNOYRGcezciTZ6H0gW0SP DtTu/+V2CVfG+W/OQQEMkkEhFY2SQfcomgpBB8CWTvqp9xth3pu0LYW31UBGwTf/msVV9unLJ9t3 799k58yo8MjqI37a6lsKf++vUwbWqVEiQO4l8nr+ZP4WEd3/ciAjvjn38NDa3X1WEgQn+gHMle0B 86upb7OzpyvBnjYShVpCGpVTsRLcUpvbFJmv3wtF6wdX68XRxjV5hcQv6rXUNbU7GHLfvatIRHns fanmiHqSGJevvm+mZ+29c+Vu9VHmadQ7Fc1N8a2huggsPNQsQ2Rinneu3JVyPfHxSGODZzcxJ0T/ 4BKOoTNy9ybdzql4xY6z4uBtdVTw4FBR6K3Rz0DU3sfaPALj7P95pFRIEMMRcV3nMVl6zgf377Pf 3nKLrVv9oqqPFliPgv6QNmt275b5XJkmpow1nUGsVVICpVkj4zbMWxJ6Zo7t3LXXhil2Y9SYsVYp qaK5tc0O7NtrW7ftsB3bNlv5qEp79InHbe/uHXb2kiV24YXLogMBiRUFaN3dnb7v4Q858tBql2fW ww/eL16RZYuXnG3ZBHaFeKigZYoUVyd8gMmgfMIGQ3zDcVx1g8ElirM4mYtFEfx0tSQKYiV+88wO +8mjW3uLBrV3RuosAgsR4TbsrlcqdGVF1YPff6hVyewabeb44ij3k7SFUU0N9OdR5T9SVHCKJfiO 2IyoBrjc7XTq5XNO06hOqGGRp4fDOLTnVAzTDjruKJ5CsQm63/Nd6W/uYXPBCD2oUNIAUch8R0Bi OLVCD1KN0MfSGSNt1vgi+/EjWz2QsZsa2ol9z69cHYNgXOhi+Y1Kh0P4+t11dkipVjo9lgVDWuTv DeMGfHkRQmSr19Tw7Lt9dcPz1C9BlLwszDvUFmEM5o0kw3tEhDbrIdjysZf32/vOn+CM0x0I9bvV 4zmifF/QgcC2dTvqNJdJfl/f3CK9MqqvKPhNL2tCR8tc2jq7JAUoieIZZfZPt71q37xrvbLUUnwq SnyYvL4oa2lEq1w9J/qEztRkQbXGvLyGh/6GHsH/nXXma7xmRdO/spN5TnQAYJ31zZFajmdKG4IE kXSZQ7HyaH34wkl2/4t7tccUUf/iHrvn+d2+n8goDJj6ujxokScsMNQ4US4vgAZV3nCnE/NmntA5 es1P/LIf/Q5FezL673S9guTRv/o7OkVzH79TeVGlok0yxaL2PTqI8txycrOtSyqlxsYWe/ChB+2Z Z561kmFK91NI9dMsy9Q4a9aukQfVZBslqWPYMJVTyMD1NlMxH2LwSklSX69381CDlzPoEdC0dijH Xma+3g8lAZVxvayk3OoO1tj61161vTt36rNWm3XGVDtz3kzty1bfq83yvBouu0ZOTp4Nk1S0e/dO W/nc8/bs8uVWNXa8jPATbdKkSSoP29XPHjixPSwkqE1tHwp0SqjHhnibHcfbSgwbsSoROn8y4wIM cyYUK5dUob/EN549zu5YscvVIdfq35Geepg98OI+27Zf9RckxnEmdQOr9pBHRnN40H2k1bhwrmp2 KNst/QIQtwqMsvQQP3vlVHlGZCp1htznxLCnS81ysEEZUNfss7NnjLE5E0vs8bX77ZlXKfGaYefN qlAG1CJlPVUad80LgHppa5098bLqLShdRYaYznvOHad5KiOrAOdptTug/j4q1QYAcPvyXc5oLj9z tAPar5/eYefPqrSvfXi+J9vbKNAjuv3MKWVOLpgsa/nN0ztt8bQyqYGKla8py9ZsPSRVkIooJXSf vYZTMaTDeIVobpfMH6v0KrnKbNtqE0cVOBDcpdP1yKIcu+zMMf45f5OMkg0+Q31DJwATULjnud2q HKgsxqLp5MpCu2pRlSS8tt65MSbMsqt7mFKFjLWRJTkeMb52e709vDqK7neW6M8hsifwnnsqFa3p A8smaJ7KtSUGumbLIWULrvFnsXTmSG+3UDS4cM4oe3VnQ0KiigKfePYA+GXzR9t4pYzJVrK5dTvr FRl+yD512WQrLcx2+mze02QfPGuisxTofMHskTZDz4v57Fd6mgdf2OPA5/Ybn2ePDisqIzuzwlZr Ps9trPU5VoqGD2mfUSrgbz+ywJbOGulzAKTGlOUqXUyxz33djgZ/tu89b7zSs2e5bW7ttjp7al21 0+8cZU8uUIqTzUqls3BaqasV2Gdb9jUlIvlP5g3h3uiwwDsWpS05/SBkYNCYgF6AVFJwpNMPdozU NOnzRIqM6n12FZJvEsQXvcuHdfhYt+4VD+DLzc11N12y0TUcrLaMI52WK8+nYfquuKzQo8WREgqz 8/U+tVtl5Uhr0ftzsLbBD5jd6mvV88/Y5GnTbPrcs6xTkk17c6NNkGsvNo99+6tt9fMr7Jfyulq6 bJkb2ksEYsMzMpUKp8VelOTzyCOPeIzI1VdcaePGj1cyTkm9Ummx5igCPfmKM//+9leQzlLR6k0B j2gvB8Zxsq8FBuDdNS1+qobprdp40LOn/vNnFyv5Xpf9/c1r7a8+NN+uOLPKvvgfKxPZbROjxLI/ kpL7fL3s//S7i+2XT2yz59YfsH/5/BIBQKH9wy0vK2lZt33h+pn23IaDDiifuHSKpJhG+9mjWzy6 t0KMaL/yK/GmY4O5dtE4u3YJGVZb7FdPbrNzzqiw9y6dYJ/7t2dthfr++kfPtPPFpP751tfsk5dP tY+pv8//2wo/5X5KtoLVm2uVdqLavvahecq9VGR3rthpG2SvAJjWCzhY56ULxtifvHuWbwT06nsE VKwd4PjXO16z//HJhdK1j7UVrx2QiBylSQhKThh0iHh/1znjXdUH+L2qMWCEly0Ybc+ImZFe5I/e NUvJKfPtL3+0WiBZLBotcqb5Pan9/s9nFjsT/5P/el45nzLtH39nkUCwze7SfC8V0+YiMpbo6N9V P+8/f6L942/WOW0+d/V0+9Q/P+2ner8cOKIKZF7NUAv7oxtn+jr/9D+fs/MEEDyfv/zhCzoMSJzf 2+jNdhxosS36txdITJzi0e7zXD544WT7veum2/+77TWptQrs968727783ed9Pe/RXPYr/9RDL+xV 3q6pspnUKmFmpf3Vh+fZ//7VK344+IdPL1IK/Rz7l9vX9WZkZq/UNgL0U/Rdnt0qwCZ6/9OXT7MD As3/vG+T5/3i4jkdVJqYL797tp2v+W/X4WOV9tBX3zfbrlkyTnR7zs6aUi46LrL/pnmRf+0Pb5ih ZIvZdsfynZ5O5zNXnaHcbUU+726BABLiyV7+ajvXOP2Aw2nhSwvG4dT0iYAiUI5/hENLyFQRBcR5 dwipQaLv9aeJ7qOdJ0L0dPtdnkV6hDbf7DmzbPMrL0ldpOjx3FI71HDIGuoOWl5ulhXoMDuyosw6 ZY9oFhBwGCktLbYCxYE0NaiUcV6e7ilWuoYMq6mtsyrZNxrqG2Sn0D7S+zBm1Ej1V+eHvflzptv2 7bvs3ntut1deXmPnXXCBnXnmQs968JxsLdv37rXxY6ts0aLFNk0xI02NjbZ77z708jKoK8VSysND Hw369lYfjXzVRxlJj/7u2DZDu8/6sXkkqpvx1g9CDczJt76l3UGBE962/U32rvMmuCTwFb1sK3TS +62Y/f8V07lEzOw3z2xPjBMxKi5UBWys94qZFOhE++unttn6XY3OvN+/bJL9XADx3fs22lWLx3m/ 37zzVWVgrZP6qMTOlL0EJvyDBzbp5Funlz5LKptO++3T25xBMv7//c3LPs5X3j/XdeBVOoV+YNlE Z8CofVBpTN5TIBG2y5lLtHmPyJjW4Zlfx1ZEtYDRu7uKTGqNen1373O77OMy4qIq+bPvrXKwxH6z XGNSrZAcU6iGoqqziaAmf88iFR0qtp01zXa3GD3g8YBO2N+9f4Mboa8W6PyRQA/J6fzZo+xMSTOc YK9YWGXjKvLtz76/SiBYLYlkp335fXOVcbhQaqQimyaw/c97NwhkD/iJ/QIxY1J3AK4fvGCSM902 rfNZSVo1YrSeB6z3uSdcCzVOu57n9LHF9qGLJut5bJdkpsqGkoA+IQb9QamD7tHa6YurATqJ0ZfK BTKcqdgL5PqiPapApMqXJGUwF/59pyQ7wONsrfuxl1QVUaf6BwVIP/zTZV5o6Y7lO1w995HtU+zT V06znzy8ydPEhGezQ/uMZ+Hp7CVVYVPiQgJslWN+fUuH/31Iz2/TnnqfP+DB2scpieRNF02xB1bt tsdf2mc7JRF/QgeIz1x9hn30fz1hT0o6vV6A/tNHNrs0BchUSlpDQmO/HJVxoe+tPc6/ROAEKA/E LjCgLt9yN/VJr8dzBIlA4djst30SRbQwD/zzD/vuDd+4utdVoFJbZmWpv0jNeN5559neLSoQt3WT 9ma9tcpdt0pSRUdrg6tDi4rzVcBNquk2eU5J0mhvb7OKkdJySBPRoIPnyNHlSg6q6pwypE+YNNVW rV5tv77llzZy1Bi76tqrrbZW+6y6Wm1G2pTJE23r9p22+sXnBDKSntevl+H9oBVIXbbkwosEGtMF RgXaj+IVUoshdWRKMqH6acQAkyEkFfNNBoj4PScCj0Ew8+Psqf5dU4IEMJhTEaeJ3ifPYSBKgMiF IYp/thFloyuXXEjkb3KxFXtBxJR9k+g3iQxDDieMnGRD5fKEg/r3XSt22J/ftMA+f80M2yhwgbl9 4YaZ9rRA5pl1yrIb6lJoXOwvXDARpKPAeNCVY6ymLjb67CfW7nNGibTCpr94fqW3Q1KA0bmXq9s2 ohxUnlPKRVCpgfR3VDfE7DWBmScW1Do+d+1MMa12nzPg0eRzICV7pK7zmiY9nigLKvUCC2AKveiT et3o8QG0Okl1bDkcCrz+efRK+XwCjVC9YEvgQrsDnRnf1+JGfiUUVFveuWfFSBv08vgz0AcAApf7 pkdJdvw3CQX9c1QA6rNLJzpolY2nWBBX/Y6o6FL8VE37DJ2yUGXSfpXAbG9tq68fNWGhToNId8sE jHWSgFALdWitSH6oLL1sifpAgsDW4OqERO6z4FrsRkrsH6JTeBWjpHZROgquyAGgr1YJUpjXH9fa sGFhWgIQvGaJ6IfUBU0Zg984FbBm7vXcay6iD+JU5+/Y6amyckKjjPbaFzw2cr8dTabIZVU2o4QN iSSD3NQpGwD0JIaCFykib8QP+Jv9Ghm0M53+PM8Rkg4yhstILSliRJv2tPhLd2uzVe/crXdbh4kW FSjbvM0KJAmVSGJokUuubrZW2S/aO9q1/1S6uLLMCiV17NurxJ+WbYWlFR7PcWj7HispK7X9O7bY ojnTpKrKs5XPrra7f/wLu/Ciiy23pMp2VR9SxPp2q9m/w1O4dzbJa+tQoaSQlxw8ps+boViSebKp qNaN+MiBgwe1BklLvE+H291YT5lY1kW6Egzu7uA7QIn2zYiH61/ycAY+uFoDfnLVC4Y4h9SAMXLN llo3Xl44b7Td8ex2Wzan0o24L24SMgsICqQ/J4srvA5gQBVEEsJVG2vsCunkF04t16m4VTrtUS7J 7DnY7DU1OCl+8ooz9PlI+9j/fkwSQa7f84MHNjizxkgarSM69XIV55FiWTXQ1Z4Lt+B9tS32svTu 56qfP5Rahn5nSIp5bn2NMxGuRWeUCwy6bM6kErXJ9KpzpPHmGlOeZ0tUSQ/7C3OHQaIjb9Ym/r3r ZtoN506wr//kRdklRrte/xrZfnZLtYMbMuNHSfoSiRL1ogQX2mjOkREZgznJDGHghVJHYeeBRmu2 HHRmv3TWKOn6a2yZxmho6ZTEpGyy6Jl0feSSKfbqjkNuN+CaLjXaQy/uthekwrlovlRt75kjaWKr bCclkgZqe0/SUZXEKBU18Rp7a5slAdbZeWLwSHTYdypkh/nVE3IWkMdYXoKmnu2YtA1qF06dOAk0 SQJ8TtLRDedOtD993zz78UMbbPLoQldHLReA3bVyh50l+9a5eobfunOdG8Ff2HTA3nfBZJ/zXj2n hXoOz75Wrefb5rVYuPI1z5Aue5okrvPmjHQbEBcSAsXKQqJOntPuA80uCXpbzXWf1sW6z59dqXoe 2TZXqkCkubslxeFS6XYQJEdJlIBmgfYQlEXiAEROHjuiA0d0ku6TQH1Cp8sV1E1aj+e2TnizBUbX p7LSjfwvgS6OE2Kehw4dsrw8cklFKdE5uHEgGAbouJcclTg5CEQYrPJj1iN7xe5te2z96pet9sB+ 21u9W6d/qTA7Wm32zGnWWSv1lEuKCtzTu+F2P4HHhIljLUPjNMvFtqCg2BoatbdKi2ybvKo0oOwa 5XagZq+11Ndqrx22ybLnVu9osecefcxKxk6wWvXT2HJI7uN5cmAk8rzQEy5OlFF8X02N3XH7b2zz ls120SWX2cTJOphJQmpXipRO2VmO6N0/rN8ZwwSWIgQHMtKD9nhs1NGHkiClJidFPBF4RO2QzIZu cx3HKT5xKjpZ90XNr4tyrnr5uwQWe/RSXrFwrP1MKoav/XClmOYEMefZNrY81772o+ekSql2dcFe qT8ocvTpK6c7492wq14n/tH2U7XDyLxM6oVJlfkylrbYf8h2cFBAUiRgAlBueXyzVclr4sWNB+xO AROb7OWt1MWOiM/pGc+oRWJKG+XZRaGlK84aK1VVnnt6LRADfPrlffZXP3jOvvLBBTIuj7OzBFZb 9jbY82J0MDtA5GLp+Tn1IpmMl37+DKmEtik3zi8e2yQGXOXqoFLpUVHBcDI9e3q53bNCZW7lVbVh V5HUMeVSa+20S2TruVqAuGF3gxh8kzNlwJFT9wgxubGqW4EBHBpMk179UvUNo+FvGN/4kQXulcZ+ AITve26HGHi2+h8l3fxsl6L+4vsrbY8YJG63/3LrWrt6yQT7sw/OV0r4NsXaHPCiSQWiyX//2QvW eRO2nlECliIZhBttr4B5lkCG8WDYY8R80fvDbOuklvrL7z9vv69n+Okrz3A6/FBA/f371juTXiwa Q9MJ+nzq6AL11ep2Ly4OWYjs/+83az3OZb7o/tcfOdNBFPBh3k9KXbVS+wVj9SG9wIDXv2r+HEje tXS875HnN9TYP/7qJS8ENWdiqY83b3KZrdQz+slDG+1CgeHHLp1q23XI4NACw4emDzy/0+l6kfbV jmoZO0fl+xqh/RNr9vjz/6P3zLNPaV2jZTf5ycMb7Tt3rZOBvMxtR9zL4WJ8RZ7qkLR44CsHCvZO ymyeJ3pP/UgdRRufnleoyNinTjmWyUXShGcxSKTuIK19p97ZDkVno0YCJMrFvLNlbI6Ez0ja80y4 ePLpBNUtFVC3jN+44K54Zrltee01q9m3y/ILc3R/l5VUlNus6XOss67JavfvsZoa1a0fViYWLS88 ufBWjRlt+w8cEEPvsImTpkgdpWJgO/dbtTyq5s1dYAVKQ5InR5rtOzbZ3j0bLE9prYv1zm3ffkAH 2WqbsmCuggdnS4V1QAfGDmuVXezAsDqBTpXlFZTKZlJjL6x8zl568SVbcu5SKx85SoA1UQeXXKm2 BSCSmrrFaxGSh2fmam3si+jQmnydCCjeqL10HG+rhDfIIDZ2lpg2OuU//vbT/tJn6eFSpe0+vbzP vrrfT963PrVF3kAdXuPi2XX7xJD3uE6zQMBx/6od7u6ag4ulTgffvusVnQZzdfrOEJNqc48fbAq4 A1Oh8BePbnJVEJXnHnxhp9Qdu10U9rTnuofzJSD+G43580c3+ikGFcV/qF9UHKhcSKHOSf1PvvOM SxW46aIaYrfWiwF/8d+fitxDqe/hjDBKu40E820xmJ+J0WDjQc3xR//BuqMoeaoA/lLgdsez21wd 1KTiSrc8sdlPydmiy83Mx73LoBMHD7yRun3NGJfdnVlj/eMtLzqz4m8MwV/85lN+AsvQdwDjzQKw B1btdI8n+kQ9xemfcb5//3r7rdaO55dXIWTuWjdqg2Zt8j///gpvhxdVvWw4GB6/d2+L2w9g/Mxn hER8Ti8YIrfsqxeArFSlxxyXJjHGQ39UUtDhB/e/5i7EeFUhGUUuutGFBFCnMb7x0+dVMTJTc1Kh L0kjqImQBLGV/fG3n3FVFvTwOerl+h83rxI45flzqdaBgedWnJdt37z9ZW/LM0Qt+a07XhbT3+Dr bqUm+hMbo3K+GvuFTTX2+//6hDNr2NrWfQ2+RlRgrGtXTaPWtcJGyUMLNRk2E2gPiP21Dj70wzhc X/i3J3lYvm5AL77Ggb28QfLoU1EOrN3b565IFc36Ii8qruTYhEgyjb50UICq+jtTdovRoysVeNci Y3aL7dmzSy6vuVZRrkhw5aCiXWenVN/sZba0nkOnGP+LL7xoTz35uA3X6X18VaUOOzU68Akwappk h2i2KWPGWWFZmeV2NKroU65UlMOtqf6g1FDLrVkuusNG5OgAVyBje55t3bndxlRWiclPkNSfrT0n CWXEZBnSFWO0Z7/V7qmxShncz505y8omVtljTz5jWzbut5GVFeJxpcrU22pjVL2UeaMybc6VGu3g AXv0ofvkzSXPwKXnWGVVlZVVynUeN3FpKagHgkL1sPiAONxxHnYi0PqYO+JtAvNGocyOH9qrH/AA 9SKGlnCVOalRAYEmMQHUUlyo7cjvwikSw2WzmIWnDdDfbJtDOs0Gf385OUSbTD+ivTMv7B68wEyH lzU3sjb7XYwFI2QDwbBg6J1i4jDuRJYYf8mxKRyslz81kpurEiMDW/ibtqTTQAXBaZ2JwWwZz91a xSQPUd8jYYPB88gDA/37Iw4wSBBNuPwl1u2GcZ/TES9hCiOCSbW0apPq3zA7r7mh/3nBoITVlQA7 aMQKoU/vXPm3S/hR/i9ugJkyz+ECv0Yx5QbNg/sDjbgfCYz+omcRrSc66VEUSnYerRnQoL8obkS0 apBkkxifzyKDZuSHj40FWwOqQ+YX1ZinRnq3P19/NAn6RWlJ+rYt/3IVko8pcE6snXl4LI8+6JDO 29PVkMpGDAXmzHPltM+FizPVFdt1X5NoGX+GTB8ahJxabQkb03D1xXctAiKWzgHioL7zfaYf1ojj BM8/eV2M0buXnc/11Upx0EyA/0m9JK7Mfx32kpMb7E26O3K28Dc1prKKq16C2HWUCgvbnZeH1cEo v0hutlJdqZ5Gg6LDd+zYKfBQBc6CAqmXcGFXLQ7tEaSSJx5Zad/97vdtpNROZyn6u1SSQc3BrWLU 5Ta8aoxqyAsYZLDulE1ipNKHVIwqtc7maqsWMLVJcikTQ8/QiWW3gKG9S/tQADRp6lTLKyz0xIkA VLEM5xnD5XV1QIXeZMtYvPB8myhD+NOrn7faffstR23aDtba/q2ZVlhRYfWKYh+h2BEOUaNliC8s zFPg4W65EbfY2hdXWPW+Gpt71nk2b8ECK60YKT7S7NI5hvQjh+GPbLjwJvaBQf8PNJVeqk/yG8qN 0G+EeQ96XJjroPAqYk7xiOngReVGy4TXXjCSe8U/flJcUbuIQYYr9BX93ZcWJFQ+7M1X1Mu0IqLH ++BvGG9fp4lEfjAtt8xGV9Cjx+eI1BEdpaJgMR5xfK3xf3s1M74P89ecjp5H31jxdR13rsw9prwM czyKRg4ufUz7qP4SJ70wHutJpsVR9/sJMvQV/U5uk2oO0CdVvin2lO+PGP3jaw+G7fCZ67mdhsc+ l+R5+n0JW0b8mYe+4vcnt43ijI6mRd/zS96fqZ/bwF9OgtoSbtBJeu2B9/HWvrNXz+5GCf0vYdPo tW3wXBPvUR+gREWTuhSrkaXAPQ4p2CjIXpsn19kWRYLvVbBdY0N9wk1bJaCl/pk2rdI2btxk23bv tVnnT5aUIfV0SaUtXjTf9h3ca9NmnmXXX3ODx3n85mc/teaD+9VfgVXvVcVK2RxGy1sKQ3p+caXU V422bf0W9TnVpYjh4vydOp2i+WiVTWTj1u1e2+Pc8y+W2qlUdpWDViygmD9nju164RXrUWqMAvGz 0UqM2FKnSpUyxmfkKw28gAVwmjS+Smr3g5KUmhUBLzXbY4/axnUv27zFC232/AVSc+XrECaje4Jm RwMIzzw1r4x2w/HA43jtTn4vHcfbCn4O40tfaQqkKTD0FNDhLKhyhr7zt0aPYn6SSf3w5AcAjNqS tvAmwjvKK+9x+EpU2cPbCjCJYp0k3UmSBVs4DBwW44UXIXGUK3ajrV31OOSCi2fW7l077aU1a2zj q6/ZOfOIreixR55+2nbsqrIbr7/YRlWMsxFZct8fUWijZdu44Oob7cl7fis1c4ekGbyt5KpdNlIq pgnWpGqB7VKHlQsMJk6Z7qmHOuV2myHpvVuS957qGqnNM23+vHnWrQj2dWtXWkFJmRWNqVL6E6mq iortgNxws7SuSZWKIdq7x15au9ZGSl1WIhVXhw5A2aWFllNcrliPZo0tKWNYk9XsaLInq/fbzs2b 7SzZRConTHA1MFK4e2NysBEIcXSLClxFaZ7I5cVnOGtG6u9Uqq7BCgHH30YpwQNxDR9kk1YhKrKZ vtIUSFNgqCngp26dsDuV+iKUDB7qMd7M/sjpNEyMHH0+alnUpLjXDsPTSSoppMGonrgYob5DtUyN cFidEt3qhxRBXvav17sKO0fL4U5P6VFSqCy4RYUyfh+wV8SgVaVJyQzLbNWa5z1VzqubdljXrffZ sosusikjx9mRrGJr7cmxgvIx1q7qgT2yV2oarubMUAqRzOwC27djqx2qq5e6aoZsFfleHZDo9GGy +W3ZtkUxIYdt+hlyStF69u3fruqDe625Yb8dlEdVVk+2jPKzbPj27bZ73z7VDFkudYfUT/Lm2r52 nS06f6nNOmuebVBwYL1UsKVlldaDU4AqFeZifxGwvrj8Wdu0dbNNVVr3pUsvsIqKUa6iBhy68DDz rB9k4haICIAjNbRT0FW7IWd58MbysIdEuF6UcnHormPBQw9xdJEMp0pVLNIN8XBDN/F3VE8DUXW+ owhyeiyWMJg8xSDklY4Qcz1+NuC35Yq7O5QGRPFMAgC3ewgom5ubdWDGVhg5YnBIRTXlEfquwopO 1aguiRUDPDLEJNFldRJTJInjoErFNkhtVVtbK+YqtZLaVYt54xyzc/d22Sea5UqNe/ZwW7+jxtqf WmHnX/Vu5bySoV39tMlFlvFIiZ6j2h2Z+vxQvbwecw9aHeoueULlF+ZLrZXtRvtOeXXt3bPHtmze YjNlHMc2Vid1EzbSI3LNrTvUKPXUfiupmmalJWNtdkmptSmq/RAGXNk7slVMqji30ItPLb7wfJt+ +Rz72a9/bZsFemPV/ygZ8NuUybdDbsajpSY71NKoUrjP2pYNm23peefbosWLrUASDdUJiQchbokS u4AtjhoZAijoA0i7GzO0TmyY3lQuQ4sb3vsxOzZHWSd/98azldNFurq35Y49vSbNM8dbDZEU8Tp9 nV4UQL+PLn+kjKmnzSVmzsmXut8N8i4qKCsRky5yL6Ju5XnCWYIa4OShgt9kisHijBExQzmi+Ima +uLKdhCkD7XNVxuM5IelbiqWxJGfm2d7leF286ZNyj3VaZdffok9qYJMmyU9ZPVkWguBvurr6hve Y5dcfLl1uKQjpw45TTTJg6tohHKzybg+UnEaskZYg7y1MiWBjBo12qPUsxUjRmq/htp6O1B70KbP mC2XYeVGE3CRHLFHUemZcrElZKBCqqgCGcMbBExZep49UjllyshfVllpzTKC1+2RoV/G+n2bt9r4 CRNt6jh5WInRj1AyxnrFs+QodbtnR1BW31IBFwq/A3WH7IF77lIRqlcUH3KpjVM7kjd2K7ASzz93 RtGP58cSGOPiTHxMZF4P3DuosYY+lugY8EBEO3P+HI+WHpyx/LR5Bd4SC8mS2Nwsb5/6phYbrwhY IsPTz+Ut8WiGbBKcwkmYd7pcLj/oZNys2Iaa7ZutpbHCcpSFtrS0zMqLC9wdNUNeUhlihD3DFXyZ lesnaIADWwYV+lDPDMdNXMx4u1xmd0gVhAqmWqlADsuYvGDBfKmT8uz+e+51p5Xf+/3fs6svv8jq a5UxefNGpQEpFGOVh6d+l2rsLdt3WKXSqiPdVI4eY3Pnn2k71z0vCUTZdkePl3SQb4RWlI2U+krA kUspWuW5Amw6NCfsDyVFigtRfEdOQaEdLimRtFLrUlBRbpFNHDdWHltZtlPR6ZVjKjV+jjxOG929 f9iRbOtQtPycM86wM8YpMWxjky2RWmrW4rOsWV6t9z/8qG3astHBoBDQUSp46qFTaZAE3Xu19lt+ 9hM7R1LI4iWSQhT5ztrckoEqS3TDnsQ+OtZK7Qouh5Ohvo4BD8TEXEV1pq+3BgU4Rfy/ny63V3a1 2f/5/PnafKfRCfWtQeL0LE4BBTzuolUBpwKP7EN1qtLXZIewC+hwWqKMsxRd4izcqDovuFx3KsYC ldZBpe3Yrwy1Dar2R9Af6qWRcmGtlPF5otKXL1mySHaC6PNX1q2TJFBm55x7ri1evMR+86tf2oYN 62zBmXPs0kuusvMvvMzqZdRevmKF/eu3/l2Fm8bZh2+6yaaJ0c9UcsJD216VNKNsu55FJVPZSiLv Sfewk6Tf1SkQIyW7TvOjRgoAs/JtypSp1qjAwZbaasuWJJErj61MqY0O1dVZXnGO5lqsQMHdVqWc WCXKm5UvoDmkIMUeRZzv2bFd862w7P01tqFmn2wwI+zKj3zSMisn2csvv2gbN7xqNTt3SPW2VzFU qmdERSsBQ7kKVbWIPi+sXGFbN22w+So2NW/hOQKoPEXEK54BeBDfJs0OoA1ARg6VJIsknkuWkISH 5VA+6tNQ0TqU5Hlz+yL47e+/95CCCrfbqCln2tdvfs2+9v6pNmvymDd3YunR0xQ4AQVgYllSSx2U raD61Q1KHEJOp07V9S5RcSWdxtU+X8y3TjnekKqxXeCBVVpaqloXYxXVPdsmK8YiV2ot0va0qghT fUODtSoeqUXxHnv37Pb0JectXWYXXXihvbzmJVsnb6uzFi6ysopKu+76662oZJSN1tF91uw5Sg2y yb75zW/ZIw8/YNM+/UkZ3Ydb24gCGbSH2Rmqw9EqNRZeW/mSOPDg2q9KgtmKPCe32mHiQ5SqfeT4 yVYlY/nIqialKlFm5j17FQOiyHepkchX1SzQK6uoUuxIpm3fvMFKZTsRQlhpeaEtkHfWnXfeb7+5 614FDudYKylJVN62cuxEm770IitadqFNlj3lhRXP2asrVynPXLNlyZjeJQmsSPYOtwGJaLUHqu3R B+63rVu2CzCVofeMGUqJpzLfUl1hKyLMIEqHRbQ6MWeKTdN/Qy93pLB5pN+KtwYFcFf8hx8+qtQn W6189FgFPOXage4M+7ub19vf3NRjs6dWvTUmmp5FmgIpKOB52sS4p1RNkKusDOU6CNXpdE4akQ4Z tHN1ah6pFPdjZOvJLy4V019sVeMnyDaSJ++pWnkcbbO1L6x21Uy7vNEaZDfAtTdPkgv2jtnz56uQ 00jPUos9kBTqH/3Yp6xQmShIT4SE09zUqBN5VIzpjMmTbcLYMbKXSC0mA3jJuGk2+ZwrPF9c+agK axSzH62qnrXVe9S+xRbMn2dZmuNTz6wQ2GXbkvPPtbLJU61OkecVUktNnHeO7VbSxZ4OGfU1rxFK yUS2hA659Rbp94SycmsT465tOGBdiu2YNXapLbn4AnvonvuUN6tVCRgVjLhGNT5+8j1lNJBNaMIU yy0osUuuf4/NnXu2bVb9j7UvKouB6DVc0hHZFrCzyGlZZREEbls22N1K1Dhrzjw7c8k5LlVhGyUe BUcEbCDRJbWWdFqoAYdadZWWPN6Crz51Nv7HDx+znz22RcAx3msetypNQ4EKzRzoKLdv/HK9ChuZ zZycBpC34ONLTylBAXT4OANkFgyzyXI5xZaAH1CHGCKSBMF3Da3tOvU32aMqzUr+qPyCIo/mPyLd f25xkbcpqSi16cUz3FhdoGjvHNkPcPHFFtEtd9tOue5OmTld3lntrjLKFljsU5T4XqmHNslDqla1 OGoV9V0k1dFVV1/rlTsL1Pe5cp2lNseaF56XcTzf5kxfII+ozfLUyrZSzeXmX/1a2XRH2uJzzrXR 4ybJEF7oNsd6pSgaM32ezZA77qYVj1mGDOdZ2ZqPfrdJ3ZafU6AU7WXWIhdaVF+kgq+Ryo7MvcUF SrMkL7AOue+2SsI5eKjW1r/6ss0SgOQVjfTAwarRZTbhiktsqg6IawQwO3dsswzx/izZZcaoFG69 7Cyo0kaIRi+sfNb27NphS5YutZlz56mPUtlIpcqS5OcpiBJuvTySoXa4SoPHW+xVxxPlH370uP38 8a1W4cAh+5NOEbjhNekkhbfJgY4y+/rP19nXbjpic88Y9xZbQXo6aQokKCBdSaairYntaNKJ3MtK C1BaZRBvkVpm1OjRNoLUQpJEOhW53UUqfOn4R8mgPUEV+0r0PTaDLKmSOrT/UXt1dnUoSWenM0bc VnuUPLBQ6qU2MennnnlSjHar7VL6jxIZlYvESAGQIgHBeRcskypsvhWXyOVV43epr+EqK3uorkHR 3o02a8YZsllU2Mz5xe7q++Mf/dg2b9unQmXvsxmz5igfm1xppZo6IqbcKKfH4SoSNfvci61ZAYFb X3jGihX3oXBCnfqb1b8C/2Qfae9WMKTWnieDep3Aa4YklyVnL7FXX1Giz2FFViTAIGgxQ2toPrDX RkrSaVVZBkoe68UXIM6yMQoW3CqV2xpJIgekshIhlA9rrDULdKBHoaS3+kPV9tSj98uVeIMtu+IG 2YcqncYOGKQiwvaBLWSI4SMNHm+hNx1x+x9+/LhLHBWVEkN10tDui1KDyBulWyeVFlUgy9MLBYD8 3c2v2jc+OsxmTZUXSfpKU+AtRYFh0elaqpY8HXhadfDBRgEzbdPnXstDBvHxSgkyYcworzfeJOMv YDNC6ckP6jRdvW+PXGdz5e6qtCFitNlSRaGaaVNdm0zqx5AtOz/fCyv94uc/t/3KUbXwzPl29jlL bYzUOGPkgltUVOIsE/df3IfJa0XOLFRZ5MBb+8prqtshg/zYycpuKxfg4hLbo2y6m3fX2oVX3mBV k2bZIYGBFGGKeCcdvFixvKHqlF17pGwqs5ZeYjt2brM9u7dYVVGR9bTKjVdMPWNYnrW1NNkwrT1D 8S0vr31Jma+LbcaM6aJJk+wp+VZde8C27dpq9nym7ZO6bOT2LTb3nGUqt6BaIMom3CIpp0iS2PR5 Z2oekwQOm72s7sG6A8ryrNxeJVnu0cV4OfJc27JpvbJi19r1N9xgU2XYp8ztsETetUhtNbRXGjyG lp6D7s0ljh8/oQzB21S9TP7cckPU0SjhlpsQOHWSI9d/S1ODgpgKrba9zL72s7X2d1JhzTkjDSCD Jn664ZBTAEbdKjBoEXjkSnVFUTIq+KF2amii4iPF0FTcTGVhyTFVpEzWw+XS6iqr9lZlr25TPAPF 2Y4IFHa68XqkTtzlCqrLzS/rNbg3yoj+g//8T6urPWQf+/hHFcQ3XQCU54WW+CGfFPEleHRhb/Fg RNlBhonZ7lR9DQBrxux5QhfFm+jngDLvPvjESrv8+vfaMpWSpXytp1Fxd1dPNuXz5s86xYuUjpti 51/zHlsr9VXDztcsS6qxLBnJs02R7JISDjbUqsaI4jDUhEDGLqmUCDSsnFClFCqPW822A/bEQ/d7 zZIJSrBYK7vQkquusxF5pZqv3H3VB2miMhVkOH/REpsiL7G92zbZLrkjo4nIlSq7W2qx4VKFUbBq +946u+O22+2mD97k3mmtUu25BZ0KWkN8pcFjiAk6mO7QowIcN6tOu9s4FJEa1TVmvyYF9wQAaVTt dJ1qajtKpcJ6yf77x+RVMi2twhoM/dNthpYC7Fs8f0bKvbVDxugRyhCbp4hvAu9wgSWqu5MiTFTc kwtqhtSyGVLT5IqBUvyLTLzdZMaWtECCVg5LHVJzHRGgHFJQYNnoCTZt6nQ7qLrg3/7Otz1VyRf/ 8A8URDdBpQjaFK1NBlyKpcH0qdaHq2qUzqNLoJWlOBMkol1KsDhu3HiXNtwrKTPbbrvjLtkM2m2R jNBi21I9iXFL2sF9F28wr5Ouez21DOnctY4xSklSINBY82SG1W1WhUNJKNn6KRbz7+xS3RetqUoZ eyeMH+uFp0pGlkqzUGFLl53nBm4cCLr1ebUkj3tuu8WKJoy3BcsU1Nik2JcjMnzjNiwe0XWkU0b8 Qpul+iJTBQyHpLrarTVUiyad8sxqUhryyVOm2Jw5cz0yH7uSSx4kNOk1oA/ds06Dx9DRclA9ucTx 06fsF3LHHamXwlVVSByOGf2ImgCITlEtOnnkuw2k1P7qJ6vtf356uPSqaSP6oB5EutEQU4ByBAIN 4igU8AYP7CawjSy5qJEULU6u5MNSy8ooIlUQCRS9MLPvbbyLsqieqZvzMiSFA0gCkR4Z1zuFBOsU J3HHvffafsWF/M7nPycV1Uhrlt2jC92+l5OWsZjStFIxEYDYdbhBzsJSV6lY2zDFXeyQp1KP7h9f NVJz1Fw1/oMPPWC7dm62j3z0Y1KHZXvtcurlDJdNIirwICZMske5+SL6KCGIItNli5RaOXf0JJtz wXX2kuJCGra8qsjzFk2jQ4b3XLn55th+2XQ6OiSFyWC+5+AeO6yY0AIFTFaNG6XcVnXWJpUeDgCF AtnhUmsNa6+3HPGBI0f0o+DDIwomHK6/O7olTSntS7Ey746Xl9ro8RNd/VZ3KDLKwzamTTvD1XkA IiUNvJQCmbGH+AmnwWOICXqy3f3Hb5bbzY9vl3FcBWcEHAQrRRLm8dIJRDmAyLnT0ywA0WmkprXE /s+t6+1/fKrAKsuLTnYa6fvTFBhyCqAy8lr3Ys7+n2t9otowpCJB4siUColT8nBqnWtb82/YHPUv olowykIroKFtVxexC6rrokC6Rx5/UkbnYfaeq6+2bIHDa6tXW3HlaEVfj5S3lYovqaknm5Qn1gip dLLUf7fel+HDclQArUFJDffZJKVyL5ExHeBYu/Zle+65lfaud9/oqdgblPEWI7NnkRdlvP6NM2CC 7qIaJZTtIfiOKjRkDho94QzrOvtCe1Q2kPaDhyxXa+xQhHxOdqE1KS5kh6SEyVMnqe96a2pv9HiW bKUlwZtyuOJfRkulN++c86xM9pDWQwetcNQ4RdyrD9x1h6tEbSJ9boYkpDYygJDiHYBULEzl2GKr krsv1Qc7JM2RB8zp7LnCmCsASBdDF/GRBo8hf2UG2mGPfe/2lfaDh4jjmBBF9etk4VfKtMrH9svm wGuk+UijjGwFtunQMPvGL9bY1z+6QMnWigc6kfR9aQoMKQWi9CRezSWqYQ97TaQR92yvXjiMgDZS sAssBAjdkgZC/RkqZVJfBgnE05QIOQAbjOmHZdReu+p5y9FnF1x0oU2QDaRNjL5VCQ2bdPouKK9V +pHRKtpUptcpR+2pUU7cwxHLVbzGMKmhNmzY4GONklcSQYvrN2y022671S697AqlLVmgqG3FU0gl lajpliiEBlJEdWV6hqvynNYwfBg2STIHi0Er3qNVEs+EuUvsLKmTnr7rFlUSFAOXxNCuGiRIQ5mJ FDRkAq6tr7H162REH61U7SMrbayKVZGXapuAcY+kkJEy/i++6GpJKhUKJpQCTfYYClaBij0a9zCZ dJ1PiIUrQ7CrptR+uOjonlXMX5KHp7cXQDv4DfGVBo8hJujAuuux/7ptpX3r7k2WVzZOonSwcXBc OhmviGhDACAtPfLCkuHxpb1H7Bs/W21f++jCtAQysIeRvutUUMDT6PKTYLp4/mhvw8MIYBsuaWEE +dDF5JAQSM8eCooRnY7KpUPV9rz2h5IcImW3tinSXPaMsbIXjBxVqZxSWdYg9RUsnUDBYWKyTTp1 d8n7qmPMGNXQqPJ3y4tjCqSydGLfun2b7VONDYzWZcpmu3XbNvvVr35lZ8hYvXjxoohRI00gdQjU hiWqZwYSRUWrohM9Raq8TskwGchlr0FV1iqV1oKLr7YcJUncuOIJ27F6lXUrIj6HNCaKT8nA7qNk iuXyHqvHmK42k2QEXyAvsf011fbcr25RHfZdrnfYf6Dernv3hxTFrmSMIlWHZ87VeIqKh26kvB8u 2yh0Jh2714dx0EtUbwToqI+S+H6oH3MaPIaaoifsr8e+e9tzAo7Nll8+TonbilxV5TvAqyae7BXl scFoCIBgA3lpT7f995+tsr/5+KK0BHKy5Ezf/7opEHADJuxnYvZ1ovBTVJZIualgwTopwwyjtOGJ GuZgjfNApRrnLCXAQXLgnnZJBPyMGz9aiQsLpIZqE6C0u4omW7aV4bKtDJfhvV3g0aykhTUyJI/U ib5c6qziUtyBm5UbaouNFvAAFnh93XLLLZ4f61033uhSEKq2TgEIRZZ03E/QgveyFw31LwU7Updd RUcifJSBX/XNMyRJob46LKlpzNyzLN/TisjG8corNlx2CjwlcSsuU7qSDCHa1MkTVRSq0kYUjzGF TFrR6CobK0N4i9x2CyRlvarStqNGVdnlV73H41+gGRHz0G1YIhU7ae6PCB285BbGca+VAhgDbG6l 8bxXfg2x0SMNHq/7VTmZDiRx3C7guEfAUTHeA6BcVZU4oQ3m2Qa1ALNAAmn1OJACW7O32/7upy/a 1z8mAEnbQE7mIaXvHSIKAB6uZ9cJnQqCnHIAAVRR1B5HFcXeR7qIJBJq1kdV8zjVY/Ig6SDJCrnx iNQ+2Tq5Z+ZmO1/PwRiOfYSSBfpBXUMxJLQ2vAsHZdeortnr6U8mTp2thIN7PP35JWddKu+mTvvJ T3/sNoObPvghL/jUIpUYc2Me1KZ3oamX6UZ/uKwv6/8RZbw9LIATJ9fH+pElHRAZroNgp5h55+ER Vi4byCU3lNjTctx9ec1KT7yISqyc9xHJS21ztZY6BfS1Hai1UVWjbbzsMO17ttoRxYhsVFAgsS6t chQYnofqieQkknlIWw8wCIyYIzRiXl1S0YlqfgaNqncjoWBDiqwdPRiOhvBKg8cQEvNEXX3vzlX2 7/dus7wKnTgUx4HeUrs8OnmxabUxcAcciFHLI0d10uAE1nDogJtJeNnalLunq6NVAFJkq3cNt2/8 /EX7u08sUWbOdKbkEz2f9PdDSIGE1HAEt1YM4v4DY4vq2gebB6qXSLNF4Sc8pWB8UmF1YlSP9jSV 8vgvV9IFKhkJIg5G2EKy5VVUJIM6EkqPGDo/6Pp7ZFDGLoLUk6m4kbXPPW2vvrZekebnS//TYvc/ cK+NUuT6FTe+X+peZa2VN9Rh1GUAkLzESOyRQWVDVD7qj9gOqiHynh7uUeVHfMZI/0FNDgIH3R2Y eAqkAhn5e7IcRHJGTbSz3vcxa1Wsy5qVT9tIZYxQgVZ3FDii2ibNzVKxZR6xQrniduzvVE6sQmuX q+4rMuBXjR1ls6dPVKCjytHKr6ujS8QRKJEIUU5XPjcf0kFNc3EJDpsHkhu1UYh1cWt55IQT6h4P 0WNOg8cQEfJ43XTIle4/bn3O/u3O9aprMNqGS9RuJ/+MHjibm4ddkBuVu9QWHfCMaDtaNQrKlXLh 5Refk44Y/3M2kDawRN8REuHv3j3C8/r8/ecuUgEa1QFIX2kKvEEUiOwDHH5hrqQSiVRUUanZyBzi BQT9TeCgHEkmXB7jgWpIn2UAMP4prrJILlJ8obqR6gcgalR9DGJIMqidoQ6pm56h+zKl96Lmeb2+ X7X8GTHj8TZaKqoXlaK9Sd5M737Pe/3vOrnk8g4OEziQLwq/JIzXjl4uTUSfu8uv2200LwzmzB9Y 8zTo0RwxtFM+N5KyzFrlulug4lKLLrhUqVAOWWPtHqtRSpQJI5W3S55Wh7vlnisvq/bGA7ZfgY75 cpzJkJ1mvuqYVygGpUO5rsh9NW3OEuXGkoQh4GQc5J0M6IoEknDDDbR0BwOndeSiG1UXTBvM36Bt P7TD7Np30Dauf8XOq2rTiUNlOF2mjF4HSjvXNnVKdB2rfDmTtSkG/pD9RdR/U5V7p6v6Fctu3KD0 D+hjo5f0SM8hTInWfXC/Pb+qyKaMvSza6OkrTYFTTQEHhuEyJGd7pUASGbLjg0oogQWRlM3/3OW1 z7LgNSkAAn7DrFG7+PFZO1rMcbgCQQAYj/52FRAI5GZsZ/rs8nyd9g+pAuBjTzwpr6oyO3vhQqtR YGG3AglJMLhJkgiF1oqUAZeUPzD7dgUu4jaMh9LhEZKAqHCoOXjMhCCOkrXDqH+u07zbGGJeTFFh PyQpdRQiujWnzrZW2T9KbO5ZizV+uQ3vrJd3VqM1EPcxQoqoJsVnqM8R2SqgpVK0hZrbKNlpeLef fHqFta1eZ0ubum3xeZf64bBV7sfDlGQx8sqM+EVCMdULJAkMTgB29O1QXwM/5g71yO+g/saOKra/ +ezVnj2Ulyh+UQ/5yZe22389XucnKt/1J3Eh4mOkWzR/pn1gwUyXNvrs7pExnRrHRcVl/nKcAo+9 k5ht+tZ3DgUSYoUkDozPqHai03AwJEAJ11f1ShscqgLTizywsCVEtcb9btRZHJj0N6qhHjF09a5a 5QISODfQgbsqnwmwsGs8t3yl18JYds45lilmm4NkIAmfeJGGAwessaFONpFiMesxcpsdLc+mYo8L 6ZY9o92N+byv0Uvp/9JUsDdEYR/HYci9/BpJSW1lnymQ8Xu3PL3GKY9WjgIIX1v9nAIRGxWJX6T3 NlfqqSJFkONAo+Qmkj7aZL9slr2jurbFHrjvLmkmCm3uvIUeWNkm2oWk6wPbU2nwGBid3mJ3Uae5 ckzq1CGczir2U5u8bnCnA21SXpgcvRCTp07UySg/YWDsI4KL036CG7hU8xYjYXo6bzsKRMycDAoj xKjZ59HuiwLt+M4ZMAFwibVRTjVhAIk+c0N6pLryli6hEDMizytFYwMsGN5Jdtgj22GGgvGyxGBR 5zTJk+qZZ5+1JqmsLrvsUgeNbqUkQfXD6Spbdo3hZPSVkblDLrM7G5W2XTXXyfRbUl7uOaPy8orl eRWVeT2MAV1uuN3EjEgdhiotSEw+VZ9h3/uFlBSBS+Rea9QBUR6sLfferbQoLfbxD1ynOiWt9vxT jypRZJdnys3Miew8VBAEC6vkKTZN6UZ27FquHFw7baPUV3NnzpS6otA1CklDJrD42EjySK019O9+ WvJ4A15KD4w6DuP2MpFss0EfDiKRInLJo5LY0G+UN4BM6SFOKwpE+ZQyJHVENtsIQNjjh2GmbtTt A5TAeJGkXR0bvo+9O4CFG9N1WMoS8+c+XGtdRSReTnoPAui61Oa5lc8pWWKtnb/sAuXMUi4t2Riz pXJy6UaAhc0kU/eNkCgxQhHmPdg62ppsz/ZW27t7u9RM5XKbPUNp00s9PqSDOeNX5Vq2yOE4ikBP vNux9zti1gkXZFRp+k4pGRVNXmCLl15gP/3u/7PzdiywpRdebEfkFlx/4GCUZkh2mDwNMEKSRYui 4PMlPU2WO++4jds9fXylcmI1ygV5xKhcqa0UcZ4qJiwSiXrtSxEtT4XFI11J8C3xuh5X/D2JGQ5V PycxZPrWNAX6pQCHGY+X8LTgUSCbM/9wRneAQBKQ3p8gQmISIvcq9yJyfhzhjDNs7Bt4UR1RbAMu tljbUT8hfRBJTd2QVrm4rnlpjcc9LVt2vlWp6l+HpBJ331WsBWovAM0r7KkNwMbII2R78OSBUld1 t8vNt2mH7VaUd6nK4yKNjBw1xqV7T1LYo7xcCWN+j9pQ4wNPK/JgYXMhME927cjGQ1yGBxzKS6ur xxYuOtuefHSe3fvoKhVwukI1Qa5VAaoNijAfba8q4nzzxnWqK1JsXZKcmuVWzHX2WXNUnne0PCk7 7akHHrSJqtc+RskPs1Qel8SJniLFXYtRrA36BHrSOzkteZw0yU5RgzfumZ+iBaS7TVMgiQIJv5Ag XxCBjTrHA9rcGK4fBw4YH6CRUK+6REJcAqf2yNbhyhh3g1XwoEDpCLmd6EP/PizVUqbcdetkI1gn IzjBeAuXLFJSwhKlhFeOKrLhupYHaUEMXXmeuJD3pVQTIAFqpDCRh5aSNJJza1iGYjWkDmutP2i7 mhts19aNApCRqhOi+KyyCdaDXQQ35MhNy32KPZcWoOR1NLRKqbcAqA6CHN3IrVolskleePFV9pMf /tBWr9spG8YcW/vo0yowlWHnXniV0hQVqv75Oq1PxZxkPO9Utt3xEycp3Xq+7V+/0w5UH7By2WkO ywivIh6+7g7FxFAsLnhbBWkoHCaDNnCo92caPIaaoun+0hRIU8BlBQLuMHpHahR4d0LzntCq8guJ I2jk+ZenUOcUHfF6v9xzEC8QVF+AhXtuRSlJ2mUvGCFm3yjgeOXldf79+UvPlXFZxZ5I947046ql yKMr6i8yzPvnibQoGZ6QVIxfwENeLaLbi6Qay5BkhMG7vb3DDu7eZ00HG2zstB4rHTVWKUcUrCiJ pluxFcKeyCW51ykgCoBEpUaMiAQVv7dFQYILFsy32XNn29333Kn06vOsbORku08SxfQp02zpeZd4 FP121ShvVcEpIsqJPt9RXWMdAtNyRdeXKycX8V2kJlFseySl4RWG15kqEQaVWd82PDUn0zR4pF/0 NAXSFDg1FEBigNEn7Bhw0+A55ZHgMDzcl1BMRdgQBbV5UGDiCvp7lzoimOkmqSInezFPYjkOqkb5 ho0b3Ftp/vz5Hi/VKLUPIEPZZgcLUniQqhfjN3NyIBvmthPyCmZKkugikaDsIUeIIEdC0lSUgcTV TmVy++3WHDp04t+lcq9Eqo9TMF9pxUivQ4K0cZhcXe7mG9UPp44HVyZ/i7EfltqMteHUctU119p/ fuc79sKatXb+hZfZapWZXbVmnZVdcr6dd9FVNm3GHJXQ3ePG+Xbl+Nq7Z591aL0UtaJAVaaSPCpa UDYfqds8nb1qwwtI4/bVEFcTUVKLGWJTaBo8Ts1rk+41TYF3OAUiFQ5pODAskF0Wt9pgwPWvsHlw bEaygJlHNmln9PzhXwEtCakhSC/EYETeTMOsVoF1mzdttYryUSq9Osmz9xJXgeTgBnk3asA4sZdE ueMczBAndCHl4Dk1THaUEW7cjhgt7r3YyJFEgBnsDdRSx4jdocy1bVJn7ZFqqbHuoJVUlHsVvyy5 23a6is2n7x6OnvnW404kI7hqKUPA1mgTJk22OQvOtGeefsrOkxvx+UuX2gsvLLezpG4rLMizvFGT bJoyUWSrwmKj6n1UTqjzNPHYUMrLx2o5qMkYQwCCHUi2Gi/Ni0X/mIvPTjIGYAC7Nw0eAyBS+pY0 BdIUOHkKOLtKMG9USyEjbVCi8BXmgig9T6Lqn6usUDOFdO6RN1MUxc1pnvQbGV62dfPmrbZl+3Yb rRgNCiDlKGaqW5UCOfUHby1iPbBjdAfPLMenKMW7q8IADwICE9UBMbojYRAASM4spZ/yrLTdAp5O DPWewQEDeLe1NCiXnNx/G1VK92BNvuWVVMgeolgRST4ZBPGxDgkfzP2I/kE70sx7GhNJTssuusRu +8VP7IXlD9vZi8+0da+uthdf3WBnnXO2JAwVmFIhqGZJExm5xQKPUVauSoLUX++ixgefk549oeIb Rp1bEMvTv0Q07bvSaquT373pFmkKpCnwJlEgYUBOaKUiocKt1f4vLhgeEgTMHkaOzQCPJ/5GGskQ Y/SCUvouSwAQ7BTYH3Zt3W179uyxSVIdARy06VZeN4zeOHehmiLfEwblw2L6qK6C3QRkQQXmGX9R VSVcayObSJQyiHrnRzxDLfUwVBGRVCJIR/qb3+TSGkbUufpu7VSt9toayyo8ZNkH61XWtthKSssl qeRG7sTwdDesy54j4/0IuRO3q9TtuDHjVTZ2qi1fudLOXHK2zZPK7Wn9e9qsmVK9qRJgJ0SSCk2q qfa6NncpJoNupqQXAn89CzBBkdhTlOmXNaM6CyAdPfgIeI8OzhyaLZGWPIaGjule0hRIUyBOgV6j eFQlEOZJfQzXu/PbjdYkSIzsAnyBdMLl6h25vGaobsURcVA3qcswQf6qfQf3qZjTZj/Zz5w5XdHZ I91nShw2Uk25OouDPYb3qCAShmTPPo13F5y2F77QKJHoMIqFgLnjEdZ7KbkgdzNvnxNV+/SDJ5U7 FqsJtcNRTxGY2KFUKI2HGqxVSUmblA6lQkF+ZZWjHKjaKd6EoEOyQgBT68qUBHXhRZfa937wX/bs 86tt4cKzbOXKFfbqqudUmOoyq21v1jpVwArxzAMUWRcsOypU5Rl2E27QRzwaHpDAXTeuumIFvooh 359p8BhykqY7TFMgTYFAARi7p1hPGLxhY56FVgwXxt2X503MkXgMTucJPhdKqWKfaG5qtgOqV75H sRc5ykw7c+YMKy0p9RTnqLI8LTk2BqrtJa4ov1sIOoxAo7fgVGCmseC++FOL8lNJ6iDTLjYLqYgy pcZyTyZXcWEY1ykf8ENi0ne5FHpS8pIOVQ5sVybf7iMdHtGOW2870oLcdN1nmGBeAEWuuGVKzDhf HlcPPfiQzZbEcd75y+ypp56wOfPmywurUjVHZOeQR1WOStVi4zks9RlWmEzcicOEcWfuVzPVJ+kN 9a5Mg8dQUzTdX5oCaQr0udnCsN0KHrnIcgLu0YneebZUTAlBILB7/+2uujqdw6yPyABcV1dvmzZt UvryZpsyebKNHTfOAahFAYHYK7JUojVEpsOYe6OqE9HfvUb6BHg4MCSM8FFe2kTW2QQDDhHuTJqU 8q5l0zy6FfeBlR8JBFBE6sgh0l1fdymCPb9Qbr2oyAAd5bJqUu6sTcrYmycvsOGqHDhuwkQHxm6y XmvtnRIlOpVm/dxzz7XVa1bbM888a5dceoktV1qVLVsoT13l9ELaQfJh2hkZAiiwx20ckbTE1ZuU xGkcfRL9hL9jEtUQ7c80eAwRIdPdpCmQpkBqCnjQOGorgh1waU3YGfg3RZe81KyfxjnsK+BNxmgU WJSE3aMCTq+tXy8JYIRNnzpVQXpV7grbre/ccRfbBXYED9JD309KdnhqpLYK7qrBgJz8WcrUHXgx qW+CALtwhSWaHammQzYUslZHxghPb9JNsJ7WR2Bhj6SNrMinzDKOkJ9K0oWM6Udkixkh9+Ia5BKB TUl5hUBPkfUCAKStiopRdt7S85T5epWi4pfZEtk/XnjxRZt0xnRFlpcp7Yoi4wFTxk5AQuTMHH4S dHccSVZPpbhviDZqGjyGiJDpbtIUSFMgToHIjuD1wD1WAxVQZEQ/7Kdo3GGV+wpVkAcSYpeIYjAA kVYx5X27dtk+VQMsFwMdP368173w6G8xZQzonMYJBCSWBPDxxIkJUSaAB6wzyjUVFXVyLysAh+y6 oTxr0oPz8zr3SQVGHIgXaAMoNE6XmL3bvnWP21QUAT6CJItZAjSlese+4xX/8PiSyipHY3Sp6FNX /XDbdaheEeQqyiYgKVSJ2vyCYrn9qoBbW6cA4xyp5PbaqudfsMsuv1QpVl6xFTKeUx43AspI/Yb4 wVyoPdIrMSUAJVpGGjzS72GaAmkKvK0pEEkUzqRJaOiuTZEqxT2fYMSe6wpjeJRyxFVa+q9ZNoPd O3Z6DfIxY6pswoQJbtOA2SMNRBqZCAAwovNv9zpK2BLC6dxjRwJDdQ0PtgmKOEWJAyMjegIJ3Csp Uq1FdhKqBEYGcq8jou+wMziwAHbYQgQuSEGotjrbZZfAu4o0J4nYi05JIpTMzZato0sg4xokIc/u zVukyipwT6tMZe5tUVr2UhV0mz17lj322GM2d/48u+LKK+zOu++07Vu3CjgnqOqgHAcEsMRyJLK+ HAMTb3Ruu7Tk8bZ+QdOTT1PgrUsBvKf8VI7EQSbbRKQ5rq8wWIzohzlFk9EWhu71wymlrGoVYpQz Zsy0kUpMiFsqlxva9d9h5aYKhm+Yu4NA5GLlnlN+Oifpodsw+L/IbjBM8wE4/FNUZBojOtFH9gOM 40g+biDH+4tSsXJrYv78eL+0BTASoERdEWw3AFW7YkzcGyrhTZYtoDisSoBHZBgfNiLPskcI6CRq AEat3c2284jsIcWKDSmttM4sJU2cP9tWrVppD8p4/vGPf8wmy1tr+ROP2egPfMDbDBcdumSEh16S 2SJJJHH1RpP3ri8CyFN5pcHjVFL3Deg7XaPjDSByeohBUSBiXqivYi6yfupPRH9j65DaClCI1FUw 8m5V/Suxgqw8ZY2ViorkhzBhYi90D0WeZFFwD6sIBCIG6SCi3yH1e/guGivh/puk0srAhRgASYDa YamTyOyL2y2X2xUCYCRceN2CgNE8cUcEOn2AxDxD7RwPfEyAjqc50cy9jK4kldaGFiVdrFfJ2XrV +ZDkomDD0rIKu+Hqq+wXt/zaNr62zi65+GL74Y9+qDK0r9pZyqTbKKM8I0XlZ6MrWUnVH1z041Q2 qOcaGqXB43WRbwgbJ7w//GzjpydehURqBf8sJP9JCK0JPTL3uu42uMsP4ZTSXaUpMFgKJBRUbodA VePp1pFAPLMuDDbKrOsuu57Sg0BAgUJn9F1uXm7kygvzR2rQP4gJIX0U9cQxS2M7gRHDwN1gnWDc wSge1FIAjFcYTNg5os8J/ovsE8MVM0K+LM9nlUikGOwLnkI+oebqS6wYSSABGMLnSE2Ah8OOAMUL YYnRu9pLEgM5rkgrkqGxcvRRl+bU0dxo+3dssfoclcxVFuBpkrZmTRpvzz35uH36M79r8+fNs7Wr V8t1d44i6DPlnUWFddRxvbJP4hEFiid7WwU4GXopJA0eg307hrCd61+1HTrkDniYqmiJFyxEu0ZB UAmDGZlK+S8RBYvfe0FZpQ3PjUT79JWmwFuFApEnU3R6jxyBIg8oLn73ej4BIjBpqYg6lUMKGwIu qYAEF+ouos8zZd+ABbpqyu0PUe0MT//hDBv1UqxAU2Dw+s075qqnwGoTNo9QOA3DPf8OlQtdInED BzXRo7mxiChgMeEY6we+hCknWl4UQO/30FZ3u8OAy0Ry0iKqPVMgImlL88ySikuZ373OSHdzp9Up ffyKPbttglx0V8rzaq2SJV5y0YX24gsv2H1332M3feQjqijYYh1KjphJMSjGDLJHhB3+ybFX8Lga 2p2RBo+hpeegemPjHlY0aXvX9oRONjqdBeOib9VQ1tI3YiIXkHb3wYad1la3zyYtO0Obf8Kgxk83 SlNgqCngp+OQ2RDwSHBZfuO9FE7rAAGn/cgwTXQ0wEIAXvSDXaRT+anIMYVB3EFAoBLlusJjCkN6 VIkTxhkHiABUfIPBve9yuSFhNE/U8gh2jYQGAFdaT2roeawIDUe9FRnZewt1Orq4P5d3zZ9e30MX 3lr+W9IREpYCxCWJKMWIJAeKV0VSTqYpfjzKxyVpJErervxXLfVWpuSId991h01QXMuN119vN//6 17bqueds4eLFAhtsQpGBP7V3VfLTTIPHUO/vt0x/08aW2e9fOsqL3Xv1Nd+JIQtm5OHRe/leDZ9E 1cO6u9ps3nhOYYm6xm+ZlaUn8k6mQDjoJ1hrgvFHLrKuzRJTxZUVlRISB3s5RzYNBxgxYSSPXOwP qs3RpGC74OUUBfGRdTeSNAAez4fl0kdfFHmvZIPaCEbu6uCEukn/yE4kL2xuk0Fb33sixGBDAZSY QwwIMNTTP+640RUZpf0/P/kTdxLJAvSNB1lza5sDzhFiU1yKiWJPfC20U4eZDogmUCH1iVLEK/hw 8rgxtkZpWG77za/sdz/7OdtfU2P33HmH0s4X2/RZc1W/RPaPGCgHJhGDslO+9dKSxykn8YkHkMRq L9VkSW1V6Und3EgX7cbe35EdxF+B3o3q6ix93i2gGdOl4jD9+K2feAbpO9IUGHoKREJypE5CceXF khKqK/T3ew4eUjxHu6txqImRp58M2T28HKxadCkVx6HGFtu6t9qmj6vybLWosA4fVtCcSzaR+610 QJ7rKrJTROlNQjyHAwxSBnEXCXsE3F1N7PlN2zyKfd7kCV57A0bOReZ2aouPyIrUbLxXI2RaOSLA GqFaH9gtuKLaJFHqFSQM+gUEcrW2FzZvt501h+ycmZOtQvEpwwVgnttLqqsjKh5FD92dUs9p3jke NT7cNuzaa3VNrbZ4xhmSlDJswZTxtuKRB6wsN8uuUrxHhiLzb//1L+3dH/qwTZkxXcGDXW4Hwrai FSXoAQ0id+hojtE8Qx2VoXzKafAYSmoOsq+9B+rtzhU77XBWmcAjUklFaqvIjdA3QrB5hI2RMDLi Ajkir9TGTjhs75deNV2WfpAPId1syCnQe94J9ghxVpg1xu2fPfS47VMtjrmTJ9ojL7xkVy45y67W T4uiqXF3dQ+rw+32T7+5y4ML//ZTH/LDE3U6elQEyTPJYutwtZf/ofsjCcClGozh/gepTmS49mDE CLy4YLqPrX3VFk+fojgMbCmRxBDl4SIDrz4RihzxUriRigsbhYI9ongN/U3xKFRZpEiJItx7HAAf WfOqPbdhq/89fXyljRtZZu3NHd7ea4w4mLIcDn+R0YRAx2dffs3Kla8LMG1USpZpk8dL4thnD95/ t5UqB9bsBWdZW0ub3X37rXbNu99lc2ZHEsgw5c7yUBTqqSdqlgz5w0zRYRo83ggqn2CMMcVZ9vEl GdLtHowicv3+mD41YYQL3UQeWdFf6D6P9DTamaMk1idOXW+BJaWnkKZAxMWRAlCvJDZsjvT9373n QXv65VftHz77cZukrLMlBflWWlhgzQKODsrAwuzFZCnAtGHXbvudqy6ziqJC211T66CCzaDVS8yi 6sl0wEHllCn1VaaYe6cOVHVNLeq3QN5JqnuhNp1KMxJ5fOnwL/tCUV6O/f71V0jiyfZsvp1S/QIG zC9TTD43O8P212k8V6FFxn1Ar1sHOcbvUh9UH8xXgahaFWnKVi2RwuxMW7dtt/3nvY/Z7113qV26 YJbV1DVYY1uHp3SnzSFJFrk52VYqm0a7aLJfFQlz1UeZPK0+eNH5nrGXi3EoGjXjjGm2e/de+4/v fs/OOe8CO3fRQisXrW79+S+sW9LIgoWLBR6ZtmPnHl93cXFprxdbOs7jHfAS9gzPskNd+drAEl+D NS4hdvYCBRJI3PoR1Fp60TqVjrlJOduC9/k7gGTpJb4NKIDKyO0Xrq4So83JsVe277Jbn1xuX/vE h2zCyFGulrpg3lzbrhrdf/m9n9rUsWNs/c7ddu05i6w4P8+Z9/nzZtsjL75sD7/4ktXUN9hnrrnM 7n/uRdu2v8Y+fuXFtrP6gC2dM8umVI2yTWK096x4wfIkTew6UGtXLF5go0uL7X/ffLukjKn2wsYt 9p7zz3Y7xFaN+YELz7P7V62xddt3Wr3sKjPHjxXjv8Juf/Y5260svlERqG77vWsvs2/e+WAU2Khj frYA5E/ef63d9/xL9tz6LdbU1mZ/8aHr7PGX17uarL65xR57ab29tHWntcjgf+O5i7T23QLJfAeu 8RVlGnetAx8uu2dOm2Qvbd5p77/oPNuyp9r2a533rVhl77vsQhs9dqz9/Be/lT0o1za89pptq97v 0tjd995vf//1v7HqhgZX0yExnX/R5Z7/q03zCVe8NO1Qbpu05DGU1Bx0XzppyRg3Qi4lUSQrJ7aY zcNPcAn7R0IK6eF7V/GSIygSnVN66Q16TumGaQq8Pgp4lDaus7LJkfIDyeCVbWKm7e22YNoUN3S3 Ku1Gp3T/u2UfqG1otvPnltvDUmNNHTPG7l25ys6ZNcMZ8//91e0CiBkuBbDXL198ln3pm/9ly1/Z YJ+9/iorEtC0KkfUt26718aPrLAFsyfbnctX6bvLNeYuSTEdYtq5tu9QnU0bO9rVYdhRKpXt9rdP r7Rlc2Zakxg5p/VnX91oP3noSfufn77Jvn3PwwI5FXbSXF/bsccumjdL9oxttmjGVFstm8l3JWVc sWieB/AhVew5WGcXzZ9pC6ZOlOpqm22WvaZMkkKdgOm2Z563K3Xv9eecZf9y230au9g+d93ltnH3 frtVc2hsUYp23fvilh2iRaPt2F8tCh6xagHJ5NGVdkZ5qd37whqrVOR5saSq3Xv3qwrhs/bLu+6x ydOm2Ze+9EdWOXq0qgySuDE4Bry+Z3i81mnwOHW0HXDPMyZW2l988mL5byv1wDEIEOloU16JrwCc wqKShGrgOPcPeEbpG9MUeH0U8PMPBuSEkRxBulOn+Kk6FReKiS9ft16n8EK7d/lzdtMlF9pqlZRF ZbVh5y4x+TxJIgckQayyr9z0HqmCdrrUfemZ8yJG3NwqF/Umu2rxQkkja+2jV1xsI0uKbJc8klZJ srhOUsuz6n+8mP6MCePsn39ztxXK2L56yzabMb7K9sjW8rIA5XeuvlwA87w1ySNqrOqQP/bSOvu4 TvqPyxZSVV7iKq9Xd+2xL9xwpW3as9/Vas1KflgnqWL2hLH2tIBrjO5DPfWBCxZ7v88LML5603X2 y8dXqpRsl1RfDXb+nDMEkh02acwoe0J2jXNnn2GvyTg+XSBWrWSJANOWfTX20UsvcEC6b+ULViAp DUCcOKrc/uv2++yys5fYdKmwvnPvgzZRqd3XK2X75cvOU1R6qTLvltry5SuUzv1Su+LaG2y/JLI+ f8xeDffre6ApWh8XPI5yER3yodMdBgpkqNBL6ehxr+spuxEuFgSVpu4bR4E0XB9L6+AyykkeaYHo apjpWWdMtb/82Ids+75q2ytvq/PnzrFZSnzYoJM59xRI/3/TJReJme7T7wtkcK7SKVsqXal2amXH KJXtY7tO5BVKJPghMfoJo0dq8B5r02m7sqzM/tdnP6HT/n57dPXL9oV3XStJYri9+/xzbPPufS55 nDl1sm0WEHzuuittlE7+qKY+IqY9uqzE3rfsHAehd5+32F7aMtK+/+CTtkAG/WkCvBoZsD944VI3 tH/pPdcoCnysVRQXCqy22u4DdTZStoaW9sP2qSsvcqmpVZ5Qo4qLBBwzJDWMFEg0Cvzm2qxxYwVq ZfbFG6921dQhGcCRFK4X4M2fIjoIGK9aOE+gVGoHZPPIESHfJzVbuVK2VFWU2ieuvESlap+z+dOn 27VnLxI41dtl5yyxd195mY0ryrctr6yR2mqs1wnBTXhEdg7yn7sQD/WVEjwAjR+v2G+/XLEPz7JE MMpQD53uL06B15uj6lQbx9JP61gKRBrEHqsqzrb/dtVEO3NsQZpMSRRwluXuuVEaknad5pfOmS11 1Ey/M0NqrSapfBbqVM1npBvBnDdNtg95vMowLhWMOvmIgKJD7rP0MUkqHK8aqH/PlZstTLJDTB01 2LVipN+6/R7v+1xlqeW7C2VTuWTBPH9W2CumjBnthvY2ZbpFJYWnFO2Xzpruhng8pjj5f+uO++0z V18iY3eOlUhK+rhAxmM6pCZuU2Df5NGjJElVys2XxIoj7GyVxb1w3kyBZLdLOImlS6PQbfMmytPK swIftmap4a5acqbXOCFyHW/KZVoPto/xoyrszDMmC6S6PC1Lo0D13Rec47aXdmXfff/Fy2xKWaFt lKR2cM9OmzFzls0QIGYpFmZXdbUtf/wxmzJ1ms2aO19zztf6O+VyrIJViViXodygKcGjWwN996k9 cgvrtCvmVcjvuc+7ZygHT/eVpsDbmQIwnfq2bvv+03ttY22r3f+FBVaWFxXsSV+ABj996UJClHmr bB69LrMoW8U421Qno5M6H2oSZcw9IoYeMuOaNSuqOorejlxbyWvF1dLudQoj91z9bNm7zyWdD196 kX+G6on+Qn30EFgHo+YiQNGLU/mYUeZeAA41FYb1ORPHy+CtuBJ11kLqFHf/Jd8V6UuwUbI+BfcR 76G+mjRnPLPaJGVxRbEnpFTpVL0PQCZyIGjV98E5xteb0BoQj4KUReLHHt2TK3VbJ315Xq5MSSYt Nmv2HJWiHWYrnpNqTJULp8+aI4+sPZZbUCjppMx2bN7gRvt58sSSE5hHpENPp18i7iYY0V/PobVf tRVEet/Zo+2vrp2cfg/SFEhToB8KHJJ64slt9fb82kP2r4/tsL+77ow0rQIFonDs6CfpCpIyp2/n 8lF8X3R5oKz+F3L8Bfd157F9fcGsw98wYIACtdeHJSHAmFsUgOh5sSIu7gz6GGYZYi7cezGhOdZh eZE8sy6Ql1ebgKNN/QII8ETO0cSYYJv0NSSkKj6JYkWimiR4P8UZtC9R93vQITEnJH1MfMYyo3om fdHxmXIhZk0dko5Ix5KlmiDDhnWpNnq7XPrbbY6knHZJMC9IhdUl6WzKtBkCVEkZik4fJXVa40F5 bO3aZuOmTHPprbMzAstUYDFYIOkXPDDCdijDZfpKUyBNgf4p0NElTzcxqhnjhtu/Pb7XLp9RZhdM K0+TDAyAt/pPn5N5nHmFxIkeAR6LXYoKyTqnS/wKqXqCDj3B6D1gNso3FRgzDVyCIbaEU34v2KTW +ffel2DeIQKefpA4gs3Gp+NJHRMJSnGMT8R/eJS7rhGSQFwqIcgwEVzY6yYr3k1OryjfVgLENCU+ 86h5QA7bEHmvhJqkawEc8+Q8AEa1qECWAxSAogh7pVe0hWfNtxzFjLwIgLR2JPJedboNJSM/36r3 7JA6K8tGV41Tm0SwY2JnhmDFUyJ5MMYbaTDvzdMyyNeulVz3iLOJ1MteIjJRnpIuXXTVBon/5vtQ TCZuMyCJGiUuw0ZChAypmkP/fB+SrfFvL4OZ2My0Yxy+53d8nDj6hzlyT5hHmCN98VmoW+BV1JLG 8cRxifXSb1hv/EWifZiHvwgpaBDmHspyhvWG9aQaJ8onFJ38WAdzi9OSz+M08pdLY/NShJeuP7pR HS5SJ0TPJ4zjeu7EM6VteAGgH234LNAyeW6B1tCCflhjaM/c+Hf8szgtA93CmIzBS+201EtyRNmQ P72o2O7Z2GJfvnWbPfZHhZYvvfk79fLzd5AWeCdI6unapj4foKCySZTC6I3i7uUDCYYcf1/66Nm3 73hO5IlKrhkSnmlQlaEOSmW8xd7gKi+SK8YYHqo0+g3JGEM1QVQ/XkgQxt/rSRZJFHDMyMusr346 cSHRJlEKFe1RDuUkXPQsvhSVQpKhJVIR0o36JbqdASi1G/GSiBcQQZ8t+8swxYW1tDYqp12XzZQD Qo9UZZs2rFdNkDabK4+0EjkCdKmv5oY627Jlg6fJyyigbnoEVAEwQuLIeBzIycSEDMpVt15FTNau Xesvz2RlfdyxQwgnwlBjuEEBKzNnzvRyipWVlSojOcZeVTGTecpLv2fPHn9Bp0yZYi+99JLfx0u4 ceNGW7hwof87+aJvNtSkSZOO+y4elNfEgYMHrLys3JqamhS232ijRikISRGcED5fSFxbW+tjEEBD UZni4mKrlpGpQD7T3BMSqXFfkTwlqB2MmMg66K9DJxHc4mCA9MOYXCNHjvS+ac84bGiY1IEDB1xn GcbhN2tpbm72z/nNZ9xL+4L8Am2KFp0mcrwv1kHfMC3Gr1BVNdYDrWlPGz4DOLmHIjp8Rnvmykbg e+aRI6+LbJ1SaM8cW5TamT6KioqcBqyHNoxbXl7ubaARfdEn86BNGIe10xZGyjoCDWjDDzRgP9BP YL7QfaSeSYdoSl/Mjb5ZD+OE+2jDM+GHuUFzxqVNmTxqmCff8WwCKCW34T6eE21YT3hmrJ++2Bvs 4wC0zI3nDC35YW6sEbrwfOrq6nwe7F/oxr7vBVu91JPGVNjfjc+2y3+03/750d32tWumvCOxI2I+ iZOnH6YIqsM+QW6rhCThf0VXSIHOv71+hwN5UP+kImHE4Z15k+qD+/kDhu32hyClJPpP6MQY2yUC fuIoQV/URUeKiAknvhdh8OrPD6VedbAPHKIASI3lqqwobftwRZx7yV0vrZuwxSgliufhIr28x7sw L2SrhAcUdhNPz8VBRAdNDojqM1PAMZzMvi5VRfxkuOLAALFsPKjUpkNxLVlKzT5//lwr095csXyl vLxabOmyC0gj7BHwXQcO2nbZSUZNimJkxOic14XDcDjIhd+B4vGMxP1t5EGBB8ziRz/6kS1dutRf oldeecVfyMsvv9wef/xxfwmffPJJZ/jXXHON7dq5s5dBvPjii/4S8hKvVpGTXbt2eqbIs846K+Uc d+/e7S/uicCDF/6uO++ya6+91kEKZsHLD1OAycBsYDrct2XLFp/j7NmznTnBaBALW+TZMFbRnPfc c4+deeaZzrz37t1rF1xwgfdB23HjxqlU5CpbtmyZPfTQQ85szz77bB8LBnpQjG9DAgxvu+02mzhx os2apTQF8kEPJ1baBABmnMCYYbjQhDZZOrm+9uprdv755zvtoNdO0dGNcVoTTI3++Jy/2VzMNZzs AWeY3GKlcA6AAoFZQ1Nzk22Vnzi1oc844wyfCy/9yy+/7P0C5PQbicw9Aq4GPyAwBhuPcRgTEGI8 9gNz416YMt9t3rzZLrroItu0aZPPg+95luedd54/Z4yUBw7UqO8mG63AphbNa4++nyPXzdtuvU0l SGf4IQO6bdu2zcGFi/EffPBBe/e73629s8uf5Zw5c+z222/3NlOnTvU2W1X7mfkzN/bmc0pnzdhP P/20AzHPj+9YE/eG5xwkHsAI4MnPI/IfnbFeVD0H9vf8+fNtulwley8YSFaBXTKv2H5nwSH73w/u suvmltnC8SX9vXen+eeRCZu6HNSn6S3jSo7aIIFQhAm1UgIAQilZ1Eyu/Y/s4jEShz8iVZWrw+jD 81olPuMMD3glUzcyODhzhsl75lw3teg/MdgIwPrAgzTxAZQ8z5XW0ZvqHckgqMJCCvmgcqNUrECC OiPhBI/EdcQzBMuGoUMGAElW3uGIA5S49bRcJE2UpoPiUUCLAxneZMCMJBDXMCAxqInUYQBTblau 7DuFntCxXTEkY+VOfNlll9rLa1+2xx982M5cdJaNlDdYJmtWGdzqDa/YkaIKy9J75EWwelVuqdV5 A9mggwKP6OU/7Exm9+5dznxg/rykvHS8vDBrXni+Y+G8cI8++qgzBE7bfE57GNMWMTKYC0w2+YKx 0GdQv6RaFJuJ9twHY68SIfkMBnrllVf6SXjNmjXO5INao2pMlYMSEhFMAcAAAGBACxYssLlz5voc ObVCbBgg7VesWOGMFCYF42ccQInv98k3nTbbt293hsb6AAbGYf0w8f379zudOLXTHgbO51zMbe7c uQ5Q0A4xM9AKZgfjY34wvNeUpgDm+Oq6dT7WfoEgTBvgQfoDGDn5B6ABLArlIw9DhylmKh8OY3Mv DBmgpA3PLbSBadMHh4IXVJCGCxqxXtYPTZkPfS5fvtxpAG1gzjBj6A8w81wYC1oWqb860YgNv337 Dpc+AZVDotFegT5rYS/xfJAklyxZ4n1CV+hGnwAbki/rAKSgLbQG+Nl7ACZzB/AvVeAUbeiD77mX tQYph36hGRIyYMizAmC5nz2wTvQdOWqkf8eY9A/tL774Yt9X0YULqH7llNufXjzGHlGqiz/9rYK9 /mCeXvJBv2IDeX/fUvccZXjVaXnUvDMtf+x4uaBGOvxO7Rt+EwzL+8yP1wz3Kn4RU4zSpkfgc7SA 0IckJEZ05h/d5vSPfjsi9OnbE0DihmkKRw2X728QTGK3HmtEj7pytS2ZHUYE4zcg0+dBFSw5EZbw RWL4hEE9mktCWgEWEFSo/sTdCQCKvtXaBYChFkjfd32Mne+51fOEkSk4kY6+JyPbOnXQBAizxpfb xJKRER8qLFXir8h1nHt7BGpE+OOiDP8IB8E4iCQbzk9kDxnUzoZJfOxjH3Nmz8kdpsoPp8BzzjnH mcSNStqFhAEjQjrh4nN+YALjx493xnLjje/yFzXck/w2wHhgWDA5VAmpLjYhL/x73vOeiBGLwPVi ApzamRPzQHKB8cM8QHVSIXN6hLHAqPk3QBLULJz8uYfNPk2h/0gEzz77rG+o97///c7AGBNacHpf uXKlrxWJBgCAgTIvGAztOflyH6ABuMCwmCtzA5xgTLTjO/5mfPqDTvyGOTNHVHyc7quUomDdOtU2 XrTIGsQA2QTMf/369b7WJgUY8WIy5jPPPGOj5dsO7QEgwJGLuXEvfTNH5sz6GIf7WAttnnjiCf8M hgzQ0CfjMF8u6MqhAKYKsADefBdoxHoAQZ7jeIFIo5g3DHyR5o700CYmP16ASclN2kC3PEXXTima 4vNgbIAAQGLTv/e973V6wdBvuOEGZ/j4xQOmzIP1Amr0w79hTOwNgIJxuVgDzzPMDbovXrRYtGxw egNAWzZvsQkTJ/gzY+28TFdddZWATqk09OxYZ++VYHizJo+1v7mk0T596wH7ztN77E8unZhyz57O H7ptQz/F4yZajqriQc826eMB+8NtrRJ/26xb7w6eRBR6chAhrblABukgah+3kSRR60SH5ZjE0mvX SrQJcslReeJO8DCiNvEWUWdhGgHDuCOqK5K4esGNv8Ok4q2iXpI/STWdY5bsJIrS0nskoa4OfZZZ WWBTxk5wyZ4QC7dnwk/Ey7L17nBQDuARfofCWyfrdTUo8IChXHHFFT5hmH5g/DCMwFDiYMCJluuy yy7rpQvMM1ww0P4uXmKYTNAvp7oPInAShNEHYzXkzNDnMDMu2nPK5eIUHAznnDjdKyPhbREMrXyP 1MNJmM3M6TpILcmIzPdXX331UXPks7gRl3GCnpHTNEwY8HXDou5lbmx0aBXGmaZgH9YEIAfjc6Ar gHfWWQu9bdzQS3vogSGQjUyfAHkwZgMwfAaTDXYRAIrP4l4rAGQwcDMH+mTscFJBamLufBefW6gK x33BYyQY3Jkb/+ZZhSt8FoypyXTjWQW60YZ58De0izsvxJ0UAEL6iTsrBHtWeEH4jmcW1h3ocqlE /9AXz4TxGIf1hrH5G0A5+kowh+xCe+/CsXb/xmb7+r077cqZpTanKvnefrf72/KL3pNyTFRwBwVi FXBMwFlFjC6TjLj6vIeiRzoc+WfaQ92yLfTaI9woENGyz8A+eLJQpc8vFxni/aRCoKNuiN2c/HmK +xJqtAwdyPrrZfCrGHjL8CyGSSIJhnueBe8/+zfYJIPkwefB3ht3IBnIiIMCj4F0PFT3sLATXRAJ Y/EbeXGaCsw2qLXi48M4kcpg8kgKyVcwwKJ358QM0MQvJK1mnZJLJZ2lciRAQmLdAHkymHHC4+TH vDo0j2SJDdAIxvbkccMcUK/xHWq35AvmyfeotFKtDQmD9fNd8vNDWmvTDy8zKrLkgwMSBqohpIpU fbM2pBPa0T75AkiRoGDuyWtj3XGPKcaIX/QdjPCsLVV71p1qXfF+ispH2V9c2mBP/3CXfeWO7XbH 5+Z66o3T/YqfXAPjCqda9gH09IC4xAWzCp6NATz4KtzzesADWwpFku54crvtUOLB7EyKJcV0VpFf VJ+6i4GT7SXBtuHzPfreXuhJ3NMt+0VR7ghlwV1ghfm5nn79zbh6wQMHAvcAiw7OATygN88BEIlL HoOxgZyYM78ZFHgbjIle8Y477nDGzSkdO0X8gnnee++9rj6Jn7TDPdgLYFAADI4HqPDiF2quVc8/ b9dLLcOpOH7xcj3wwANu8EUdg3opfjG3YGSGwSY7I9TV1/ncPvjBDx7DIOlnw4YN7iHHBkNa7NPt Ry82c8cpAeklSJphfJg39iMY+Ac+8AGX3uIX6qGnnnrKNzPOFEepfnQjwEJ7bBgAY/KFUR/bGXYY VKXJF84b0A6aQ/v4BWDixEB+oqtkC0u2sWE4R5WFxHqj6J4MnHzP3JFIkIaTwad3LOnWF0wZa391 UaP9wT3V9oPlpfb5ZePfBrv69U8xgEbwYgsSbxwcgqTPd8G9OhzE4uDy+sBjmDUqT5QVT7Hu5mKp o/clKm1GHlrBYB6hh34SrlbOfPtuSCiV+MANGQkVU+LfvfchtauUbluTj1Go5I1UQXwzrjh4MH4A hQAgcQkEEAmSR1z6SGUHSbWWNHgM8gmD2sGzKdXpHVsIBtpUp2eGhAHByLDBpFLbuTuxpJb+bEGc ojmBx1+2sBRUgjBZTsnYB5Iv3HaZF7YmVFZxqY3+AB5sIQBisrqQNSP1IA1xH2qnuFufuxgL1NjE 0CD5Aog2yw5VLMkgeFDF7ykQoDKn49m3AM1j1UZRL9hPkCBS0SWo4bgHgEi+eI4AJ6CRam5IXDwP pCfsJ/2CBx3nFtmHl4y1hzZvsr+5e7tdOr3Uzhh1+ue+iksfgQnBmNz4rJ+gGglMK4rTiOwcQyFx hGeKkZicUgUqsjStcKztoICUnlu0V/sqCkbSRgQGETokXI39zwSoeOh7ZCyPJI7o39EfiX8f7rQc HZzYNwVKExKVhn3zrv6kwED3uO0juO7G1cMnMpazsjR4DPL5cmLCII/RKthV4l3BwJAqkC5SXZzI JyXsRakeFO0AllSqGV4ymBgAFIII42MAbFOnTHWX3FQMjhcWAEA6AODiFy8X+n2M4Mwr+fQdnAsw RCN5pPIHH6c+Ya6p6AJoXSKpIMSYJNMmeGpxHx5dyRd0AdRgBKmuAqmisC8VyUCffPHMgr0Jl83k CwkO7yxongr4gjcZUlF/h4K+PqVKrVCq/Usb7bof77a/uHOb/fozc2Kqk0FuvLdJs2BjCvr2IEUE QAmxUPwOwBK3e7HM1yN5EPXfrlohIzL1Y/mWnV9qrd1RIB5BEpGgEYFF5IIVIUMkeUTI0Ku1cnVX 4rPQBrWQf8T/ydBPMbYjqsOuQxWSB5UL34wrzkuSASS46AbpI4BGkDriNpKBzP20AQ901cHYPZCF v957YB6BgbDJk5kZLwmnfh5IKkbH55decom/IKm+x1Ggv+/4HCM6myF4miWvZ/qMKA4hVd+c/pkb c+QEknwPktCFF17o/adqj6oJIzxAkup7GDBzBMSSv+czVE5czB1JJn4xH9RdzC1V33hJIRX1NzcA B2BNNTbrQsoKTCm5f+iCazeXu5YmzQ3Ah27uRj0AW5xCipUtdqz9+bIG+/JD1fazBeUqNxzz0Hq9 m/At0j7OsIJ0Ed7F5NMszzU4UMQzHwQAiYPG6wWPXJV/Ha7MgMN7cuUiK5viCNUqJ66EwL8gOjhm 9IFHJF5E8SJ+YRpxlAj3JEsnfK6DyAgFQh7J1N7IdQDJeAuCR1yFFWxR4ffJGsshzaDAA7UB/vVc MBLUI7x4AelgAM9L7zx9xkx5No13F05Oa+i7OTXjQYPeHBdMdOec0C8RI02l/sF4yiZK1uvH3xu+ R5/NaT/VSfhUvGNhrWGzJ2/0oNeN63qT5xFOZ6lekvAweQlTXWGd8Zcufl/cqyi5fZgbbfvr3138 YqqE5L6Dl1KquQdVV1BHpBo/ziSS+6Z9f3SLn1xTjR1OT6nWFWiSfMJNHv94c2N8nBmQ2PpzNoj3 NyKv2D5x7jh7UOqrv5Dx/NJpJTa29NhMCqdij74ZfULjACCBjslG3OTnmwo4+nsGA11ThiLKc1pR TxJ0mCtbhGIh/Ef2CaWT8X2UkDIitVUCFIJho08vFYFJUFslwKVXa0WAIXEaGQoMlORBPfK3CnhA q8AnUqkTA5AHXpNs66D98dRXgwIPdO3f/va3HRBwd0TFEbxriEO47rrrXDwEYHbu3OExAQTx4YXD aQ+3V+IvACH05vje81mqi/5QgVx//fXH3TeBaQSChQ0ZTjlxZhoYX/JnJ9smvCi0C+OEh9XnetiX XZPPkgGDtqnmFmeM8TZhnECM8KLSd7yfMDfui9MgvJRhfv3RIABHfD2BbnHAjM8tfB/XXaeidXxu 4fuB0i3ed9jYcfrHmU6qucXXm2pv9De3sDdS2VKOz9CUImZUpf31ZQ12/U/22V/L/vGDj0Uu2qfz Fd7HsI+CBBKeSfxwcDwwHyyNUFvl6BArvJDkoXQeAIcHCY5QfQ7K35JuRPFepCaJgUevYcNtIYln lFBb9R4YE15bkeYrAo9hI+SSrHQiWVnZlkt6oRFvjtqqv4NaAII4UIRnFP99MvtyUODBRuCUTwxE OPGjTiD4bO3La13Pj34YMR/Jgo2Cvjn+AvIZ/vjozX/605960Fcq7xlOeJz0QuK9/jYTJ02MzCHn URDHQiBfUEFwWgy5rZhDyFWE2gvCoo6It2HOSFWnog19Rvn6O502xxtnIOuJonW7vU/WE3ScA10P 8wn6z/jcoHmcbvFxUrUJ8SPHtjnsJ7P+xmHjosrge1RDyeOEpIZhbvFxWpVaJkd9B++doFLznECJ lC5OawWlEaEb1FrcRxvG4nv6DhJFqnHY96lcp4/L5ORzf+6Msfbl8xvtbx7fZ9fPK7P3nXm0F9pg meRbqV0A3jgDSj7QxA8eyUD8etRUyXQAPPzZKzpcb7WYu4z2irJuU3W791+g2CEx/Z89vkOFmxQs m6H4E7nyRsbyhM3jKPDoM5j3qbTiwEIeEfJjjfAx2T89ykP1VrhSPYtUEklcQjmRxBHWNSjwgDjo fnEhJeoX9RPGYySED3/oww4IXBgu0T+jZ8a1Ee8eLl4+/h2SCOJWCfikugAfXCSJi0gVcxAWiqEV CQdbAPej3+Z+XE6RkFCNwQxwz0SNxpxhGkhEzM3baJ4ViTZ8ltwmRC2HNkhPIWqecWiDCg+mhjH7 NX02Q78BByKpsWNwH265zC+0gYbMhf6ZG22ZK58zdyQ41hLa0A90geGxDtqwrlba6PPeNkqrUay8 Ya++uk5jL/E2vKCANmMD/jDDMA55qAB8PJn4HuMyqUO4aMM4tEFSZJ24AIc2HBhCG8Zh02J/ePW1 Vz3NBweAmpoDanOmR8lzKGAf0CfrgT6AHfslJNIkch615ZkaZ8PGDTZu7Dhn8DznkNGgt43GYT8i FfOD0Z+5hVQvtGE9O5VLjRccjzTGwSmB+5GKaYO3Fd9xD//2NtojADvqVuaLe/LJqkczCkrss0ur 7KFNW+yrt22z86eU2OiiKF/X6XTFJbewrrgUEgePVDQcKgBBbUW682Fi4oIRAQP/Rj2Fi8sIm6LA zc9fO90272uxl7c32p5D7QIQeQhSPSkUnTpK8kh4ZCXbRFwKIc0u4BPZcxg34xSUfR3MPulPkohr auJqxZMZY1DgASMLLqCknQj+8nGXT5gNFwBBYkGuuF99PMI82eMnvgAYFAwrlddRuI8Nx5x40dmQ MJFw4oHJBAYT/ywQDJdQ/g0TiaxjwxyA6AcQDGoh+gntaUOfMJsghodxgocQn5+vfFRcAEMAvjA3 2p977rneDwAQVFphHAAGxsfnSHRh7DA3XGSDSiCsG6ZfKUM+fS4k+lwvCllBzznnXJ8nAB02DWBP 3zB97El8Dq3DOCQRpA1zi9ONz2iDOy3jx9sEGoSMAnzvn+lExvPDPsbcwnwZn+/pE+CMz41/5wtc QgaARQsXHfU9fYc23Hv2OVE/jINBne8B0fCcw9xCxgA+D7QExNiDzI3PuOJzC+uhf3KMpWKQJ37p hjswf03qq3f/rNq+cd92+4+boowHp9uVLIHEVbMBPOK/k9c/FADiuZ8wjgdjd8JukZc93B5cU20P v1RjVy+qUm7CYXbN4jF2oLHTXtnZZAcaiEhPqKyCajFmXA+2kV6Deq9nVmQFicaUPYVcVG/ylQo4 kiWRMMX+Pj/eEgYFHm8kTQCf4/rT88j0AIPnU2DCYXMmb+S43YF7+H4wbZAm3Kis/8jJ46Jqwn5B v6jDsOlwD8w2eZygSmpvR02S7ffF54baiR/WHtQooX9+IzE4g01ESYcXjs+COod/I52EdOdhgzD3 kPwQNVXy3Jg/khzfBRVNfGy+R5LgNI4kEB+bNdA362fdwfAeaB3SmQQ1XYgBiM8tZLsl5sMdIWO2 ojB31hRiMeJzox9oy9xSjR107wB68jODbsF1lL7jzyQ8U6QuAArJ5KSvzFy7aPZY++Nzm+x/PbnH 3jWv3K6afWwE/0n3+xZsEAfY8Gzj+yTsh1RTHwrw8OSBCTUUNg2fg37Iwlvfoho3+l3T0GU7alrt sgWj7Ys3VtnmvU32Zz9+xXbVSm2aTX7bSI3VEVW89RTn0aX+BDqdZMGVhJOp9Cqh3G4kTb11wSOZ 3skAkwpw+tteb3nwONn3Ii4KB0LECZKs2/OtkAjjj2/oE7VBnfPIww/T2K5WsjxO4vE2MLBbfvlL eZzN8NiB5HGIgkaC2bNnt07f57hKKj43nBDIZEsivhBhHn8JicIGXHBOCNJToFVIfw5jh0HGT+Dc g5rm7rvv9sj4IC3GaYBXHNmJaY9bbfCkC/2TaRbVEyd/TvLxdcPo77zzTldhEv3OaTv+Paq+5xU5 T/oIotdHJ3KLhb4BrVtuucVVgEhmcbrRD7YxEjXiShxsZPHnTIQ5/SPtIv3Gx0Y1RWQ+c0TyQj2Y am6UBL1SdEdajNMF1SbR7UiCzC8eeT/QfZpVWGa/v6zKHlaW46/cttWWTCyysvyQnXegvbw97jsZ RhRf0WDbHU2VRHoON2gn3GwFKK2qjnr1orE2fWyRQGOMlRZkWnvHYfv107vskZcP2KHmrl77B+CB x+2cCYX6XCrug6i2AAq8FCX5Vim9jfbk9pqWqGIhYJXgJSer1nyznujrofVpBx5v1EOAKZMGHeKn ikZGhUQG2eT0G2F+6PapBwKDSxUtzekbJpeqPWPyPWlIUgUJooKBiWLLoL5J8gUooKrC2YGTf1wl yKkP+wDqKlRGyS8BgIV9AlsPdg9UkcngCziRWwuvk+SL0zy2hsJ+Tu+AGSrN/lyzkQ4Apv7UmEgG /CBZpBobG0qof5LqFEZkPmtL5YZLnzwvpC6CLJNT0gxo70k3Pm7sGPuacl+995cH7H89vNP+8V3v jLrnqRjVUEgZ/dI9ivvrvVAkdXbJUaeq0D59+VRbtbnWfvnUDntMKqzqBjmtIMnLE4uDTVA6tSpK fb4A/sYllba7FieUSPpg3uMrcu3bD+y213Y3WWFUgvwtf70esEheXBo8Bvm4YUDh5Bsq6cW7goHB ZFH7hGy+8e9hPMF2EOIi4t/zGSf7VPmdQiU8mHtI5Bdvy5ic+GFyqVKfwICRnDiJAy5xRszmAjiI wwG8kp0UOG0jZSEZsYbkzUgbAABjNwb84qSElawHacXVkSkSGzJnnCm4L1VqFpg6YBtSqx+zoRNg mEoqYN3YqQDMVNHvjImUx/xJDZMKfDDCYx/rz3ljQNspM88unzfO/mBzk/2/h3fZDbNV9/yMd2bd 86FkZsccBnojyCP1U5eAo12ixNa9zfaVH66x25bv9josedmZVpIvt15XS1FPPURxRHUz2jsP2y5J HXvrOlRjJ7qH5L8t7apT0k3Klb77U2k7BrQn3oY3pcFjkA8NxhaM/qlEVBj4hz70oX4jkQGHEEmd agohSjvVdzA/1FkhsVyqe1D59Heqwxj/4Q9/uNcek9weRwEYaaooatYK88fzKJXEhC0AdRUAl0o6 oN+Pf/zj/VKdPj/ykY/0G4CHgR5QTZU+hE75Hm+oVN8jxSWr0eITwW72yU9+st+5IXUgEQ3a5hHr Oae43L50obyvtmyzP5H31RPv8Lrng3wNB9ysU4kKz59dqYy32dYiNVW71FfXymBOeVrUhi/vaLQd B2XrwNsqdmVov0tDJQljp63YWG/FApkeqcJaFCfyofMr/f5TCYADXuCbcGMaPAZJ9BOlp+D7E6WJ P55eNJUqLEyVzRrUKv1FOXNPf5t6IHPDi66/i377S0xIm5OOg4gNBPgcr74L3x9vbiHxW3+gO8jH 7c3o+3hzO6m+pb6aMm6M/Z28r2769SH7p0d2299cG7m4p6+hpQByQZsAY+ms0fbupROU8bZHEgT2 DDntUmVPKqg//M81XvEwV88l7ieFbYP9/slLxllzxxFr1Q9Sx+IpRfaxC8bYdx7aG1U+PL1jPlM+ kDR4DO0+TfeWpsDAKZBdYNeeOc4+s6nF/kF1z6+S+uqcSSUDb5++c0AUAAywZdz7/G777bO77KK5 o626vsOeeLnGiguVS+38CR7agdHb61nFgAAPqydeqbXrF42yn//xAm+HF9fEkTn25Gv1tnp7k+XK /deOTtE2oHm93W9Kg8fb/Qmm5/+2pkBeSYX96UUN9tjWHQoe3Gr3f4G654NwA35bU+HUTx5JY91O lSFuO2LnTK+wC+ZUSH3VbeMq8mzWuCJ7TJ5WfeVk++aTnTlcxvQO+/OfbbAPy0tu8qg8qbF67MG1 tfbr5dXW0dVjBTlSbZ36JbzlRkiDx1vukaQn9I6igCKfZ0yqsq9LffWJ3x60byr+46uXT3pHkeCN WiwSQ0FehoCi2hZOK7c/unGGVFA9du+q/bZeHlO5WX1eVmFOqLIWTC6y3Qc77G9/tTmKQJfNA0P5 nPEKfC3NkK2kZXAZZt+ohZ+icU4b8EjlmhkP2ksOJItHvYakgtA43oa/0XemSjoYfx7HGyfefqD3 0SbcGx87vobk9YT5xMcL6wlR8OGeEDWfHNwX7CRxesTXGeaVTJf42Kn6TP4+2GJS0T0VjZJpnWo9 cftOMs3DfPt7Zqnokoq+cbqFYMOheC+Hqe75u84aZx/d0Gp/f99Ou3Z2qc2t6t/mNBRjvtP6wE5R WaoSAlIvHWhot7/52VorK8x2EOhRwF9RrsoHyKsq+WqVreQsgcc3bhptOw7IVRf9FvZE3Ti+Isf+ Q6666xVcWHj6Vxk+hjaDAo9QA5toXAyIjXKvpDJbeGnx5iEfE0ZV3FGJB8AzCR977iGojUA2vF8w DJNZF7fP/jxoQr1smA33pDJWk/sqRD3HQQBQYUxedv4dXnoYQTKAhAI1yffRPkQeMzaxFXHmwffx cfg+lN9kDIy88c9CxHRggtzDZ6GeM3/HI6/5Lswt7kEVn29YY2DIIWtp8MjytAlE2OI9oueWbEwP zy6MHV9jmHtokwwQoU0YO/59qBmezPBDX+H7QENoEK8FwdjxuQdaBPqESPFweAhR5fFny35InkcY j+/oP55hl88YJ/4M47TmftykB5KSfaBMurBspH310np7/Ee77Mu3b7O7Pz9PUdBvk+CBgS7yTboP Rt/c1mWfuniSXarAQDylkDjcvqErW9LE//zNelurHFeFeUdLH0greGYRJIjHlju5KEhQ/3P33Q65 /yYq2L5Jq3vzhh0UeAAC//Zv/+a5kq644gp79JFHXF9IgjsqzL373e+2n/3sZ+6nf97S8+zxJx73 WAdewA0b1iv690KPnsY1kjgFXtR4rqs4OV566SUHF3IO0TfR0iHxYvzESDI+oqJ5oUlo6LmlFEVM tHRefp7yJOV7orxpZ0yz+rp6BzCC5F54YZWilS9yZkrcAy6oxEAAkMQSEJBGuviDtQc9DUnFyArb t3efexRtUJQ10cjkgdqm6OOCImUTVjEYgvPo59ChWgeoioqRnoIeIKUdQEe+JKKliRlgHBLuEdwX ynIyLusmUhr6AIz8JsCOCGfiDEIbGCPfM2fGJv8Sn9WpD6r6ETcBXWjDGgHq++67zxMXZmZmKChw Q+84gPokgF5BcJywKuRay1xg6gQeTpo0UbQd4RHmFyuhJelCGJOLuBbceBmDQEFqtBDISNR4W1u7 0wM3WhIOcmjgmUIXDiAwavYVMSQ8P9Kv8G9oAF0YhzWwT1auXOmHCA4prI3vQ1ZkgvdYA5H3/Jt5 8z37qEhJIokSJyUMEersGeYBXZgHAY9E7tMvayNSnT3NGsLcOMgwV0oRDCV4mNKFz50yzr5+cZN9 9q4D9v1n99rvXfDOqHt+6thfZPmGN2H43nmg2e57YY9NGV3k3lev7hZY5GTamVNK3QMLoEg2mGMr OSyx5X/eutlWbmqQq262x4Hg7vuBpQlX3VO3gLd0z4MCD14eGOzlV1yuiM1Ohfd3uP87Lx2MA2YB E4SZZedke0AYPvKBESBxwAQBD1JNhKjl5LKjBOIBMgR8cQKFCaQK7uI7gAGmyrgwGtrAzHCXhYns 37ffGQbfPfboYx7HQMDYmDFVztgoYM/8SRsC6GSq5vFrytSapX5on5WdZZ1HOm3dK+ucycDgYHp5 YmIwK9pWi/nVdNU4uK15aY1NmzrNx4NxkeaD9UMb2sFwV69e7fPlb+I6XnzxRWeKABlMDzqR5oR7 oCGgw4kX+tOeNgAmQAiQrxcAcS9gBGhRJ5zvWU9RcZGtWL7CxyD+hHgHsghnyjjLvwl0pF+A8qkn n7QFog30hzkH0GGcsrJyB+YQhEibpQLPLZI0GRc6AFzMnz1CG549gNHTc8S/h/asE7qxB0JGXdYb GDZSK88egIEed9xxh7tEQg8At6GxQRmEIxoQsIj7LrQGDJgb9HpS6+Az9gzzgPb0W1JS7IDAHMh1 xHN59tlnnbbMgXsAL/ZCiMCHBjyvGarQ2Nzc4rQ5Uc61k33zh+UU2QcWj7X7NrbYX921wy6dUWLT R6UuY3yyfb/T78dWce+qPXawscs+e9UZChY8Yr95do9VleVaRZF4lLyxkEaAm2RXXYIAP3xBlUsf bTKQAzDzxufbRy4YbT96fP9R97+T6Dwo8IBBLV261Mh0umXrFn8JOX2HEy4vFplTyfAa0o3zUiMF TPQT+SE/9cPU3vWudxkpIVIFlKFKADAAJE6/nBoBg3h2Xh4WLzhMiH6IEOblh+HAtDilhlMsp2UY SSS5kFwwSlw4bdpUP8UjCcB4tm3XabdqrJhmhbXt3OVSE0ytuqbaJk+abOR2cpWcIqQ5fZLFlXHa Wtv8ZAyTgZkhDbB+1sDcmCNzWacU6T06zZy95GyvMw548j0ADA0BK9YBQwcUGI9TP+AIA+REDmNm HNpwGuYaQ1VHgRoR4vSH6hCGSJ/QH5AliI7+oRnp57OzcwS8m70NY8DkSavCb2gBADGOp3wX44YJ AwwwXObGOBtpozkB4PxmPdCZYD4i1dkvzIN58kx4jkhh9A/d+J523OsgrDW0d7Rb5ehK2yCpiCR3 IbgPgNqyZbMAqMKluDUCZuhLn9CGdQAYIbqe50sbngPzBriYH/cBDtAiSEFBUmFu0JcMAqw5S+2g Jc+vulqpLDS/kK9sqJlFcfko+4tLGuzpH++xP1flwd/87hzPjJy+Xh8F3JMK20ZeltKMtNqff2Cu feryKYoul8FbyRF//NgOT5aIbUSso/fKVK2Pp149ZDcsrrRfyFW3TkkVkVBGFmfZSzuabc22yNBu Xa9vfm/H1oMCD17WL37xi564GGYCE4RZczpDzIcxoV7iQtUSUl9/9KMf9b9DinROsNzLi5zqgjGj goEpMA7AAQNINmrTDwweaQMQQiXEOJzoAahgJ0H1QJ8wdr6HMYwfH0VKc5qF2TEOzIFxYMyjR49x Rse6QspvwIy+aR/GIaKbkyjtJk2e5IwGpkUCPT6HeTF/TraME+Ya+ghrDMn4+J4+GJu5sT7WxmfM n/EBYObLZ5z2GQdQpw30R0UUmDH0DZHZjAWAhmy7qMZoAzgBWKybPpkD9BovQERKAcBDtlnaMA/A CECkPaoeaETfqO2YI9IdFxIozxLGDS1DoCGfhYBD2jEuhwvoSv8B6Pg3zx2gaW1t8VrRgDY0oA10 CAGC7E/mTuJFriB9MEf+DYhCl5B+nWcG7aBL2J+0g948H8alLgtjMDf6PlEA6KCZgSrenXVGlf35 hY32pw9U209Xltknzx076O7SDfsoACjkK1vu8vW19qfffdFmykUXCWTlhjrPbVWQl2nZScF+WXLV JU37392yyT520TiP7wCIVqw6aN9/ZI+1ShIpxFU3DR4D22qpjK20TJWmGmaSSjecKp9TqtHjKdlh SP1dvNgwPZhLiNyGEYR6ELQLdR74nCsYYoNRljkF9Rj3BMM5/+ZkzEX/zCNuUOaUHWpvcC+2nmCw DsZx2oe62iHVN6drGF3w4gnj8Tf/Ro1H3zDFYPCHwQbjfBgnvt5wX9xjK4wRDPMAWPg398edAOiL tcWTIoY+oV+wyYT++Y42odJjqBgZvg+1WgJThnkHry7mAF34jn8H+jO/YNBOfmbxddEGSSb+nILj QXimPLPgKBB3agDE4nVkaMe4h9kbibmE5xL2CveEhI2nMmvqiLwS+8Q5VfagJMI/v3O7XTS91CaV nb51zwfGdYbgLgEDHlXXSjU4rjzfaps6pa7KtPedP85zVpVJffXo2hp7cWuDFcj7yvcOpWpl99hW 3WZ//5tNnlVXeKPqgyPsqgUVspu02A5JMu/EyJxBSR5D8BiHvIsARnFQ4uSPPpwXnVNx8JAKHjmk 14ahcCJF7RYHQNrwPSdeTvPhCp5eSBJIMoBbV2eXbAQLfJzAVGBOqEW4aB8AIPSDigeVDaqRkDgx 9A3j4ztUYKj6QtGo8D2/UTFh5EWyAji54mvH1oHqhXUFAA1MFJXO7bff7uPGT99hbkgYZPwFvJAS uMLYjMG6yLwb0p7Hv2cM2nJCv/LKK3sTCIa5AT6kbIcm4TAQZ8QcQB5WqntAAeAIzD+0R3341FNP uRQTElOGuQFMrJt+UdUxv/hBB4kRdRuqK9YYL3tM/6hb75RtBXVekFriGxUpJBjrocuQGsyPeiOG WfnI0fZXyrx7g+qe/+3d2+xHn5jtrCx9vT4KdCvdyGi57F61cIwDCSoot3XgUSmd1UMqFBW/jugz 0rbXtxy2xrZuSSo6QFLLQ5xzkqQQggQ37m82FSF8x12nDXikenLo6kM52iBtxO+DwWDMhsmlumBk tEMtk2wcpV/6h2EF4In3AXMFmGgPI4WBJzMiTrrMAX1+XA0CM4ShPv30064CSuWajKcQBuegHoz3 DeAAEHyXShpEHYOqCNVNqgsmikEZhorqK3ntACfA1J/BGPsA80+V2ZaXNDhAALDJObxg0IA29pEA HvE5QossGflT0QRmDr0Bl1D9L96WgwBOBwBIHDjCPcylRM+1P5UUTh7BhoJ6rz/6DQkXUd3zpTPG 2VeXNdlfPkbd83J7/1mnX93zIaHVQDuRvqkgZ4Q98lK13fLkTo82x55GVl0kiia58OK2W5CreucJ QAFgrl882iZVyrtyT4tlJ2qdd8s7iwDCCIAGOoHT677TGjxgzhh+YXLJjIwTMCd2XC77qwoXPKXY SJx04xfMN9S0SFXXAUAAGGC0qRgZfcLkOf0nx7fAeLFPrH15rduDUqlIYJ4wu1RMlHkh2QAwweYQ nzvgAHNmjqlqx8PgYY7YWvoDiJmaXzIgMgbrgonjspsqeSLfA2xIF3igJXvYIVHNnDnD+wlzjM8d qWL16vyUwBI5P0T12UP53Hhb6MyasZOEMsnx73nejBmPpYl/T9tgZMch5FRfI1T3/HeWjrUHBMZf UebdZVOKbXRx7qke9rTuv006p/nKHzZvUqm1KX4D+0WeAOOhlw7IhTffXtzSYDtVSdCLPulCUskT 4Fxz1khbOLnYKwdG+zwqdf7yzhYdWPTBO9Cn4bQBj1SSBQwE5gpwhKDA+JuB6oTvsCukao/HEzp5 QCjV96guUDGl+o42MBgYGkwn+Z5gsKb/cGKOzw3J5kM3fcgZcKr+AQWABwBM/p62GOpDfEaq9rjk BseBZG4B+JCaHHBI1RZVWbCZpOI01AjBEypV2xB/g1SGzSH5HlR1gBYAF2xD8TEATNRR/E7VP8Zz XJEBilTfA+QAVqr9wGeoCNkTqQIpg32GtZ1SqaN3wcPlcaa65woevEF1z//2vh32nQ+dnnXP3xDE ErMnS+7I4hylHCmV55RihxT/0djabRlCgjnjiyVdNPs9wYiRIxDZVt1qX/3Jetu4r1Up2CWVaLLE hVw2X0XD9H0kebz5NcvfEBrGBhkUePBiocqBcaIC4UWPR+Py0uI6ycvGS4ZtAGYKM+NCLYDaA+Nj qMrGC92fDpl7YBYhEjjVSRx9NvNI/g57BvPhFJ58hehrTtqpvkcigfGjXkn1fTC4M79UF+3pm7Um XzBGPKtCIGKq9swPCaC/7/g+uOmmWluIcUk+SQfPOJ5jf+uCQeLplOoUHtaVqi3z4Dlyiu/v++BK zTNL7p81oeYLEe/JtOVz1sU9qebG9yEOJhXd+B7a41mV6mK/sl9C4GPyPcFDjb0/qDrmJ/uGZ+TY hbPG2X9b2mR//9Re1T0vs2vmjDrZXtL3J/g7KqlblVn318/sssLcLC8GVSNvqiwZwFdva3DJIk8e WQEKcuSGu3JTvcACm+IwSStyZlGbgtwRtkhp2R9+ue4dCBvRdhoUeKAP//73v+8eRgTeoWPmAkhg hujasQcQ/AVAhMAvdM0wFU7kiP8ABrYBIn6/+MUvpdzgGIWJc+AkTT+4hiZHo8NE6DdEGcc7SlVp b6Bv0utpyxivt/1A5zmY+wDawV4nWtfr/f5E83o9cz9R3yeaezigDFldjxNNSN9nFpba55XR9cHN 2+zLUl8tmVhsFQWnZ93zAZDjdd3SLc6fnT/cvvahuapNrtRKrV1213P77KeP7/D4Do8yj43gXoCk rxGI8D2Hjyw5LpC+/b8e2m2NqiaI+286JfsAHwsnt/WyJcDIg2snunFUAoAKHjwYOzmZofeHsRMt 3KXfnKQJOOP0yAmU2IIHH3zQbRPJwX+8yEQJhxMe6pT+GAdzCjEgQQriBBmkiyAlhOjnuNtsOEXG 81fFcy7xeVxKCS6lwaAeHyfuVUSbME5wZw1tgmtqGAfSh37ic4u7oXJPcJsd6DjJNIiPkyofV1BH hfUmj5Pc5lSuJ7j09vfMwtyS1xj2ZNgHgW4hR1fyGoM0Et8H/bVJpUob4Gsz+NtUoGisMiFQ9/x9 Nx+wf3xIdc/f886oez54oqVoiauujOK/e+54xXgUS/rYaVv2tdgFs0fa9LGFStnelCgz29cWwKBo FC7cWQoYRPog4hx33X0qS5spiYVkiZHz/zvrGpTkwcs8WwCAhAE48DeAASMh8hbgQC2AZIF0wvcY nInwPiJGnCuVCJ5CweiISiuV4ZdHAWBg4ESFgvoH8MGYHHfB5N+oxOifOREtDjBhDyBqGdsFagiA h7ZIRdgcYNL0iY49tGG80CbkuMJ2QhuMrDAY1DH0SRvUHAAhbQDC0AZDNJ/RJuR/YhykKNpgbyA6 m89oQ7/cG9pgh0HCYxzaMK94G+gO0/RUKBqHdeGphBortGH9SIMhOp02XDwfvMyYI21QK+JVFaLg QxvsKhj1Yba0CeOgsuR50IaofKRL1FzQnzZImDwTJETGYW7sB55jaIM60POD6dAA3RgHph8izTlI oLKiDcZ35kYb1EY4A3BwQSqFmdOGcbABcT8eVbRhbthtsGFwL+Pwm70WxuHAw/3xfGPYYlC9hTZ4 j/E3+xQaMM6pjPNIyYIyc+2yuePsD89usX9+dLddPUcpbVSXIn2dBAUwcktIwCX36XUH7B9uedUm VhbYuxWEmSvbReSye7T1olv3jirO9iSVlKnt6uiRR5ZUswoepNYHDZSw5CQmcfrcOijw4CX66le+ 4nmfeNEAAV4umHNwrwzuqzAWPuMlD9/BtCfrs+AB9YlPfCKlvQNGgXEWhsDLTh/9Zd7lcxgFfWNL YD4wMOYXoplJkMj3zJ/vYYrBKAyjZT4wheBFhGoiBMUFhsIcWBOMO0Rh81kwqsPgaRPGAVDpMwQw VoyqsBylBKENwMoc4tHTIXdV3NBO2zA3xuEKahPmwdwCbcI4zC1E1tMn44Q2/Dush764l/kGEIC5 hrnF2wSQR8oMElC8TaAB4BiC+Ribe0MbxgnAEegW5hYOBGE98TaME9YTDO3xcRg7ZAAIEgdtgkda eM6AcJhbvE3I5st9Ib9YaMM4ASwYO0hbbzQboO75F5RP6cHN2+0rt26zR/+oyIqlt09fA6dAvtKR 3PLUDjt3xkjPa1WSn6lsug22tbrFa3UkJ0bEI2vBpCIvQ7tZBvNVW5vsha2Ntr9eanKpwHIVki7h 4x0JH4MCD176oDLgsQVDd3+MPX4v9/P38Wpgx7cCLzs/XJyo+7tgdvxwgg/R3tyL9AOD5QcmhRTE 9zCxADB8Fo+65sRMPzBsGA3qsyBBBRUH7bkv9M2/kTBYWzD2EgEej7imzzAO9zC3EHHNXLk3RKKH WI+4VxJj0SdtAGL64N+0SVYnMR/Wyzy5N9Al/hlt45HdgS6u1xW4hmj7MLcQWR8AMfQZ1H1hveGQ wPdhbnG1YaBVkJyYRwArP1hojbQNEd7xcUKwZaBLWA9zC+rFoCL0iHH1xz1hbnG6hPWE4E7G4fsA /kE9GSL0oUOI8E/e0wNnX6/jTqmvJo+rsr9V4agP3lKruue77BvXT30dHb4DmiaVlUXqGFmSLY+r bA8WHD8y37bsbXbbh8dwJF0Yz59+7ZDKz3baoqnFdqFqrdy4WI4ubYfthW2NcvGV1CqvrXegp+7g DOZvxS0Xj74O80O9Qhr34B4K0wv2E15+jPYhLiE52I7+Hn/8cY8+x1jPFVetoR5C1cHpGHBB/REH TxjR8uXLnRERkMa48faodoiGRmoLzDbMjTmR/RaGitMBKpq4JxrjoEpB1YO7MGqzeN/8GzUO6jDU iSHvU6ALKqS77rrL1WRh3XH64clEtmMYJaoerjjdUOGh0mHuMNv42NAaBwpog0stp/b49yHCHJqG 9CDJhw7oBk2CBBifG+ororxZV/JhAppDNwArqEXjYzMnHDRKS0s0v3pXscVBAECCLkhbzD35mQcb HNIMdOtP1XpK34+sfLt6/jj7/OZW+78P77Lr5lL3vPSUDnnadC6VVJtsHpfNH2MfuWiSTasq8qWV Ky3JBtk+9h5S0CqVAmMXYR3kv1q1pdGe29zgAYWTFTC4ZJrstROL7JVdrcqL1W7KhX3akGmgCxmU 5DHQzt/s+0KKc6ScYCwNc+J0jS0gRJinitTG7gDTDLUk4uuB4cH8YfTYLZIvAtXwPKM9untUafEL RkYf2AlgsHFJDAaMbQcmCuNPpV+HedMWe0xyRDTARHJHJJtgfI+Pja2BefcnKTI2rtaoIekjOePx VvUPE08VKIc0wXfQDJVj8gXdoSvPI5W7K59RawRg+MAHPnBMe2w00I6DQfIV0bo+qvGRUO8lPzPs VWTlxQ6TfAHQ0Lo/l3H2S4jrYR4DlZ6H+j2g7vkfXdRoD27d7t5XD32hIF33fCBElhRCnqodNS12 x4rd1iBpo0kpR5A4xkgK2XGg1XIl3R3tbSVNiUehR95WvDcbBTTrlNMqP1uJVtUW6eSIbCHvtOu0 Bg+kBozO5WLOyRHmnDJhuhjy+/PXh/HiJcaGSY4wR5WG1IEEkhwlzSaCscDgOf2jMkkGD5gscQ7J J3fachqGuf3qllucAadSkYQ8VamAxfNtiQkDAiGhY3xjw9hxMADcUl2sty5RzClVhHm3+mbNqQp4 BTUSzD/k3IqPwboBpccee+yo3FjhnmDkRjrCkI89Jn4xLg4EqTIxIwlMm3aG5+2iSFncqYI+AEGe G+A2axa5oo6+2BPQJVValfBMAzBjkH/TruHKRD1B6qtL6u3jqnv+b0/stj+7YvKbNp23zcAECUpt RazH+5dN8MqA2QoS3F/Xbv/tR2s9UNCRIyZEABidCgbBhRfgwdMqV0kUc1EZSyLhR8JI2tvqbbMJ BjhRJAIPaEtkfo03g7EQTczpuz/ffhgUKozkyoWhH9qnKk7F9wAG4MMcUmUDDhlqGQNJIPnC2HuT IqVTMWDuhTkzL4zPyRcMF3UT4JRKtQKDRxWWDGihHxjshz7yERWzmnoMA+aeUKAp1WMA6Ej50l9+ KObD3ELm3lRz//gnPm7NTUo2p2eXfAWVUXJOrHAfqrCbbropZX0Y7uF5AECpABm6oH4EMPl3Mvig 5gP8UEP291wGuDVf/23Z+VHd801R3fNrZpfZ/LHpuufHJayAgYjy6vp2+497NqqMbJu72u5ROpLt iiLPJ6dVUgcEmyOV1KqIVG2zAkO1v20YNlSTwT1bBvNMZedtfwcqrQYZJPj6d/4b0wOn8v5OiDCP eEruVDOCWaTKgRTuRbLhp7/reG1hPsdjQMwvVe6oMNbxvuOe4ECQam4wx1SJAcO9nNDnHudknSph YWgLzfurz8I9AEKwo6SaW5CUCvILUpKVuaXK1xVupv/j0QagTgXWtEfiSKW+jK8tZEB+Y3bw8UYZ ZgXUPb+4wZ7cvsv+m+qe3/m5eUY6jfQVUQApIfki8eHy1w7Y+l2NkhgyPFp8TGmuTRyV72orKgrG L+JCzj+n1BZPLbFtNW1+oCBoEBFlunJh3fb8AXv4YIsVvAOzI57Waqv0S5SmwGlNAeqeTx5rX7uk 0T57Z43qnu+xL1zUf82b05oWKRZXXJgryVsehcpD5ZewpEU2juuWjLMv3TjDqwbyg7vuzgNt9m93 bbY1ctsNSRFpQuxHptRVZ00uEshkW3lhlttJ3KVXF6qv3sOF+i9UpcJ3ypUGj3fKk06v87SkwLDc QvvAonH2gOqef/2eHXb5rFKbcRrWPV++ZqOt27RbjgGRNDGM0rwYJGIXhZsCSCAheJBp+2TLGRm5 +qOTOiyuj3suhaD+7c6NBq7Mn1iiz83qmlV4LZE1N3RL7MdrMo5/9tsv24a9rapbXqVYj0Z7YUuT ve/cSleDIXRgVG9TevZbHlxjlRrPi4olKqInz7J3ylpDS3unLZg+xhbOnPi2259p8HjbPbL0hNMU OJplFleMsj+/tM6e+tEe+6q8r27/3NyIuZ4uF/FZne32nduft71NIyx7xBHrUD48artTj0P/53xa 5uwEeOhz/ddDBdDJLTZvkVKpy9bGBRg8+Uq1rdvRoNrkBzz1yDZ5T5FupF7ZdZFCYPbB9kFKkjVK mCiTubcvkl0EAMnPqbH3Lx1tv11R4/eiImsaXm7//mi9pJUosWcEHiFXVgA2zUzf8Xwa5JwxrbjV /s8fXCJJRrVF3mbPLA0ep8sLll7HO5cCUl+dNXWc/dWFTfal+6rthyvL7XdOo7rnMOez502xb3xq qf3rvTusKaPSRhxut9bmJjFqmG7EpCNphG0QSSV83tpx2NatXWM5BYVKTTLcc1stnFZmF80dZR+/ dFJ0nwb41TN77OzpZXbviwKWnY2Wq/K0XKinMly6AJDMHn/1kP3dB6fZu35/jj289pDHf+QqTUln T4ZlFsiOWTTc26QCj+gzJTORrqyh/qDNHVNvf3zdbJs5aaQM8JRhfntt4UGDB14neMzgE49XUYjq DdHnuInyHd41uGaGYDq+x6jZou/zZfzkwi0Tr6cTpbhOFW8RPeCe3nTvITYjxBPglRPiCZgL34d6 DayBf9fVHVKOpyidO/fgYcV3IZo81JYIKTn4zZjcy+8wZog2D+OECHb6CXQIrrXcy5pDhHn4nr7j SRRDhDR94Eoa0qrEkyhGJ5noZAMNmW8YM8S3ME5YX6BB2KphvvwdvLOYR4iY5zNiK2hHv9AMR4F2 /d2usULdjJDOJR61jnE6RIuHFDYhtT79hziakH4FzzfGC2vi38RUBO+oOA1CNH+qNiH7baBleFap klgSFMlF38TchPoqzI2+w7Nm/SEWBMP9mxIk2A9/GZ5bbB89m8JRm+wv79hul56huuflp0fdc9/L 2Xl2wZLZkjha7T8f2W8d+ROtXE4VzeIdhw8rX3riNB+JIAFMhqk8rFxquw9bt9zSh1EmmqA/qZd2 1LTawcZOj/HokN2iur7DXXbbBDbJhnZn+QIE0rPvqGm3L/94oxeIylB/ZYUqi1Avu0hGpquu4mP3 SR4JCeSIKot2t4tXHbAxJvvUFePtnAUzLDefIlNvM+SAVwwG64htoA417phEChOMx0uFSypJ6y6+ +GK7+eab/W/iFYjkxkUS11HyVOEts0rp1c+QmyovKLEY+OWnuoizgAHgVko/7toqpksE8YUqaBSY McwN/39cLZkfTCIkzMPziJgLdKC40OKrz9wBND6vr6/TPKIaFOXlZRprlLt6cj+xEMy3uqbamhqb PLaBJIswRdbDxibZH/3wGf0SK4CnFZHYMB6uvVrjAtEgpBHhc4LOmA8Bb7TB0wdaALyMQ6Ae6w7M FLdcYhSIIWF+jMl9obYKayY4kHFg7DU1qo42ZbJ/hocUa2FNU+SquloJ/ngjACe+5/nAHKEd66iu 3q/nF/XNMwPgoTGMfJTmNEPJAQmEZA4wXOZJOpBQ3ArmzTx5fiG/GHRjHPqgT1yNGZvvSTLJ59CA QL6QPfnQoVp5Z53p30EHPNSgW3g+3IfbcaiZwjPkueDRBR2ha6BlKL/LPKBHiDhnbfQdCm+xBp4r tMC7ir3d3NyiNhN9D7Jn2eNvJfCAaZWNqozqnv94r/31Xdvsp5+cndLVejDv/JvdBg+n/KIyu+KC xVrTi/afj+6ytpxxVqg9xkG0q1vFxVNdJENUNsRgDyG31V3P7bZnXj1oU8YUeg3yV3Y0uu3jVXlg 5eh7PNZCjiuP8xC48DtT0gdJEHfWttvS6SX2J9dPtJ8/tV9eWLWWlRdn/n0qqwAgQg073NVuDXUH rNL22u9fOdbOWzLXSioq3/gkm0P0MAcFHjA+6ky/613vSpzc6xw5AZIHHnjAI495mXkBSZ8R8hpx MoU5cmrNE+PmpaVGBy91qOCWvC5OpASLwWhgHKF2dKMYIYwCyYJxYCJ33323M2MYGlHGn/nMZ+yR Rx7xAD8Yxa7du1yqIOUHJ8qiwiIHO5hFeXmF5rxLzKZB8yvyOXMfTAsJgaSKzBvmjSso/TFGSLwX TtOkDAE0+Js5MX/6gR5kIt6g9BgHxNyg1fbtO7zPkD0Wpl0gukAPguUAPdqTyRXGTxvWykkZOjJv 0pTQBwxul8Y4IFrlqx+SVtIWet3/wP32vve+z/sgxf0VzE3rog3zIkNuvtaXm5vnIECfgHNeXoE1 KmJ7t5h5c0uzXXXlVf6c169/zVUA9FclWozTPGCo2VnZLmXQJwyeeA/6CRIPoABgw3ShKYz9oYce sssuu6w3G25wpcVVd8PGDc7A58yZ6zQA6ABq5gCoQX/2IilHgkQArWsFONCQz/jheUAr9hvAAtit Xv2iTRg/wYESmh48GGXv5VkUFOSLBls8/Qsgw7w5mAAYIR8YQNtfhP4QvZsn382IbDvH65432p89 us/ePb/M3r9wzMn38xZtwT7KL66wyy8gXdAq+84ju60jd5zla/83S4V1mIpNCQm8vyW0dR1WHY8S 1fOYr2JQkYS7emud/e/fblAwYGT49uNewkRBVt0plfmSUrptt9KX4NL71cvG2Q3Kb0UNc1KXnOjq OdJpR7o6rL62xkYP32d/eM0EW7porhWXv32Bw7UUJ1p4qu89wGv0GA8Wg9Hwwl111VX+ksGIAmPj JBqd7Ov95b311ltdGmmTsYvPST8BI4AxcE+quAdO6pwUCVyjTcjWyxicXjm1wlQ4uXIyJx8VbWCc RBoDFpxuQ+I8TrYhKpxAvL379orBZIoh1/pSt23f5tIHgBVO6zBx1jZyQlT5D6bFpuN7GAgnVhgN tOBz/oahsR4AYtq0KT4GQHMoof6B6U2YMN5P4vRNP9CLdXFSZm28LDArGCVSBWPA7PjNWmGMBARC c36mKcV6jtYN0G7SXGDigOToytEuATA3MvhuVBp0fiOBIckxrylTpjp96RcaMeb8+fO8j+F6Rjwf gIjTd25Orm3bui1KCa/2PFv2AHTerNQfPNMAXNCI9OoABnPxuVFfXf0CrjwfxmDtSG08E55P1RnK fKzc16wxgAXz9/kk0rdwUGAOzJk+mQMBgADUZElcmzZu6k0Pz/OHVrTnObEWJCvWsnHDRhtTNcYB gnsKpB8PgYzMic9ZD+0AJX6z99+K1/C8EvuU6p7fL/D7b7dtt/OmlFhVyelT9xxsQAK5fNki2TtW 2Xcf0x7PG28FOvC16N3k3T8qRDzpIeEEtWhqmf3m6Z1216q9ApBM+/glk72exyrVLy/UoSgeKIjN ZPEZJXbxnHLFgbSpemCxp2P/wWN7ZHCvtzZJLqQnOSY0PYE+PaiqJHHU1R60SgHHH1w13s5fMt+K SkdpX7+9nRoGBR68YF/+8pdt9JjR/uIi2vMb5vH5z3/eGQDqKl64kPWVf3MShYlwin/ve9/rJ0Be ak7U/UUk0w6A4DeMKNhFaBf0/BjNGB+VFaoUTs8wJUCJWt0wvpbWFr8HhhXSe8PAYWacpNFZwphH SWVVKWY7fXoUrQujQtKA2cDQWVdIJQ6Q0AfME2YLXWBcrIt7AVnmEaU1j7LzAn6kZEd6CKndQ01s GCjjcDrmhI3aCnqRpI91Mx7fI0nRhu9h/syHZ1FaohTyenlKNT4ABIhBt6BO5D5oCDAyN+jkKeQT un5UXTBu2sbrdbMu6MAJnh/awbiZE6BNGySXioro86C+Yz8AoCELL/+GFoBxoZiwP1v9G1rxXLiP cVkjYMjcoD2nfOrEMAckQSSIqLZKt/5u8f0BbZg3zP2wToRlZeUCpBbvgzmRBwyQBFz4TS0T6ACY s394ZoAE97Nf+JvnwdiAKbRE2mSerP+NqWE+GHgaZqP0/lE46saf7Zf77nb77kdnDaajt2wb3ntX YS1b7BLIdx/fkwCQYu0dqaBk4+j/6pG0IAlWySTrWrrkNZVplcqyC0ikjPND7SXAKpUXFvfUKcr8 mQ0N9qPHVR9I6drLFPdBHEhSVhMfvudIl0scdYekqhq+375w1ThbdrYknpKRb3vgGLTkwcs3bvw4 J5CDQSK9BsyQn+QrvGjxaOyS4pLe2/oDDm7g1BoqDMaje0NdC+6B8XMS5EUPKSRCahDAiysYwLkn pD2HGcGkW1uvdIZBG+aIFBDSgYfTf4ha5h4YTzAK8zukDGdTMw73BKYeDPekEwlVA0PfME+YYTDM MzfALthJAEP6i6d1596QOgNdfyhwFdYYbBeAYpg77WGgXPw7pOegLwBtvuwDjB1sE/QfbAa04xlz qu/qkvhNbiAxaJ4ZDJufYIQOz5lx+Qw6hTHpE1ozDn3G58Zcw0EAWl555ZXenmfHPIKdiL6CwwUM IqJnlJYecOGiH5g9n6FSYxyeB2OEeXJYYR7QYenSpQKjBtGhw6648grlQSvvVTmixoo/M+gQVLBh vsfhUm/eVxm5dsGssfan5zbZN57eazfMK7cb559edc8xfheUlNuVsoGYvWDfe1Kq6NwJcsKRBNIi CUQAkYqjU6v8oTX7bdb4EvvCdWc4kNy+Yo9t2NMkN95j05PkygayWnEdD62pte2SPKrK8pSVt9x+ 74pxriGjvseqrXL+0X3RFYzjqKpkHK+rtfzuGvudqyfYhefMk6pqlNq9vSWOsLEHJXm8eW9F/yPH 062Hu0IFuFB7gxc/JL2DKTz62KO2fdt2B45PfepTftIMF5IEKg5O3dXVNWKE044anJNxsIfAwFPV Vee0y5gAWvBSCp0gXZAuHkmGkzhXPCEf/VNlj+9T5aDitI46L1XeLdfzy4khU6qyuXPnHdUvY8BE UfPADP8/e+cBn1WR9eEDJLSEEnrvHRUEFQUUsGJD7L33uuq6tnXVdXVdy7q6rrv23nvv2BuKvdB7 74RQQyDf/5n3PfFyuW8IUQT5uP5iyL13Zs6cmXv6OeNFHauojV/0i++AEiZOJKMwoPHQHkYVxZm3 J4CCMdxHE50XsOHn8mOL40UIeQ7euO8ML/oOzA5/Cuvidb28zhUMw01602WO7Nix02prBgPDl8S8 EUQ8wsXb0/dHH30UmGMS7OAc2IArqabYxvRdZOXWsVP6NLa3tVYXPT9O5iudrJlbdWMC8RfDEjQQ HZC1S5+tRbO/trvfTzGQ3NyUBrIyQQPBp0Fi3y0vjtTvSqE8CWG4dXIVFKEwXo6ZjV5UexkxdVF4 p560jEXLipTbMdPaN65uZwxsbmMVfVUkTTd6oXEUwzgUjlttxWw7Y/dmtsv2XaxGXv1NhnEw302G eSTtRJzbMAAIe7w4IZLnU08+FRy2+BkGDBiwWgVXd8RCjNBE4swDCZly7hCipMq1SOo4p9FkGD+p zDcEOFPRRQg451a4Pyke2cPcOHPjTzrRMV6rCdiGKKChRo3c4GyOS8mYXzhzA+0hqaovzBTY/MyK eHvmjUkQIpt07jxt/dS/eB0qCDxBDDAjNKv4BWwffPiBNVTkkB94FX0HBzztCcSIE3DWbIzGxpcD vtq377BaJAvmqU8++SQwfUxocS15lsxslMFHg0LriDvEPcqQSsd77733xh3JJGLXVH6cy3deaIMe nWV/f3OS3XQAmuDqxPEXU/AN3AF7s4ZK1O/aWwykWAzkA3wgMBCisPCBrG7CWrRshR0hH8dePZuE MiMkGVaW7+G6Z0bZt0ocrFl9dZ8HUVcwG3JHME2RNKizQW3MjKV27bMcnawaY9U80krvBB/HUluo 8P+qK2bZqbs2sT16d7a8eo1+l+G4pS3vJs08II4wBmzkSXHUHk6aJNlDGNEIcMCffPJJa+AQiRtt B7v+nnvumYjjpMqs/mKITpJ0nSncE8kdk5Cbn6IDICFDRPlwkKSJVItezPX4448vMbHEgXOzUqaN AaODub5DpJr8LfGy7MDMvUymG9cCOa8+ftH25JNPzhie6PkdUfNctA838SWtJ/jEXPiCwsh9/qu1 FeH0PJmkueN/gWnUF2PJVLWXeTM/P7VwA9PO0ofPri5Hr+o4bVdgN+vc87271rFdOm56556zn/Ej 7Na3h/Dxld394WRFYYmB1EADcSd6ClXZYhRT5yxRuO40m52/3Hq2r2Md5Syfp9IkwXeR5LyIYRlz FU7y/MUp5pPNWeZqV7xSPg7lceQvmGvVpXFg2tprx65Ws46SGn+HeRxr29ubNPPwyrJJCwcR2X// A0J+iR9DG0cWNnuISE6GCq+YNnDuJhFRpFZ8Ejhgk7QOGAARZKnokDUvzDKEsEIMPZfF34KwMzYB CJi/kpiDH92b1LfDhvM6iXkxZyTz2nqeFI6KtoH/IukZBByNAOa3ZcIhWcylNNjQororryPTIVi0 xZzmJq34/AgbhpmD9/gFwSdggQirpD0RAg8EO22T1hSNhHLvzDF+uNjaPrQN9bxKjTp2Vt8m9taY 8Xa+zj3/4NxN89xziHiuNJBgwir+yu79WNF8VZsrjBcNZHUTViVR/ywxEfI3pqgce482eSpLUtmm KhS3rBc8JltaCKVRiosphSJTVdFy5XHMtWpFYhy7N7e9d0z5OMgz2RSvX515+GFASPuYbJDSIJCe 4QsS+TA96xsiAwFGovsl3BnzDkQ1Smg9Sogx40QWGHbbbdcS57MfzuTObP8NA0oi0PQJU4DIJT2n f8wyEKyk5+Bl1113DY7dpOfgA+aDCckd6L4BmaNHQ+HkzgRfpg0LbDAAn3P8PbQumCrPiQrjfT+R kLWEgPu6onk5zp3gEhzAv9kDcdjX9hGtDW/sEfpn/2RinJgok/BG39Gz0j3Jk768akBYs/RBXXFY YZauhWU6MGpt8/vNn4twtdS551dw7vnjc+2GIZPs6n1W99/95jCtpwFZXxjIzn26a/99a/d8JAaS 1kCCCUuZ6DCM5srVOHTHlqGQIWa8kVN08JjO+EArKc/l4bgL04zjDDnHB/buEsJxN1XGAZ7KxTxw 5pIkyMfEh0yIo5thIDJEJmFTx1GM3ZrjWpH4cDbynA8U2zK/sY/zoR999NGJ60bfECekPrJ7O8mB TIIhuRGegAiB8jBWJwLOpLxTJ2JRc4gzq3dlmiIngOJkaBtEPHmUjvcTNUH5vzPdi4/N39E2ZYEt ioykcdb2/NeCzSPIcO7DKPwME8KF8X389NOPivhaFpgozBDNIXr07S/BW9KaxecdX59MbZJMiOxZ AgPYVwgwCDhEXxFE4Id8+X7xcWCo7Bu0s0zH1ZaHAK3XNpWr69zzpnbK6EV2w1uYr+raDq0JH9/0 LjLRIdq79t1a3/C3wYS1RD6QlAZSoNDcYnvzq+n2ssxWhNris1iqI2RhIynfRtmulOcopXGsKiq0 AhiHfBxn7NFCpqqtrJac4+RHbcpXuZgHkhrZ3IRU8sHhSOQeJhbOnz7qqKOCWYEPEMaB05pyJoX6 u0AfKTHzfIBIfhAa/BJIuEm+B/olygUtgg92+ozpYkitA/Mg2sdt0561zPseUUTfbr/3XAPPSnez A0SlSKUN6CdVmyrVxomEa0leI4u/vRZU0jhOUBwOfrudnrHX1iY6jteXog1zAabofNiY9F/WNnHY vN5VaeMgIBB5Rh4HpjY0ndrKJ6ENJUxwOjdSwiiBBZ5J7kx5bbCB+1DbanmhZSlM0ufj+UH04yG9 jgNv43WmaOP1rrwWV2ltGC+15kXB4Q/ToB2h3lQYAM+uVTmu3U9CG/CRdC78xk4kqikz+7z+C+1d RRf+6blx9tZZW22y556z/rnygezcu7u0jS/tvk/lA6lODlANq6BKCZN1eJPOiQwRVMTbVtK55RQ/ LIO7Y7VlDhpH8HHMk49DzvHdpXHsqMzx/weMA0SUm3kgYRKNQ9gmTGCnnXYKEU2e6Q1DQfOA8PNv NBQITM1aKcZBljZ2e6Q8QlL5O4l58CHTB2NQ1mPbbbcpKYmCxuIRNx5ai6ZDpBIfOcSByBtMFTAn iBnEDjiQlCEaMCHyARo3ahLitpcp+91DZJ25eRsYmJ9z7VnnmDHABeNgSgJW3uFdxom24bmX6AA+ b+PjJLVhHJgvc4mOg/YHEQRn9AMemA+mIgg8bdASYCw+Dm24mLu3IWgg2sYTC3nOepJIR7/UyUIF 9/pW9eqlzkigf5g499EiWVOEARhmdBwYzyIxoaYKNEDad18Q+AAvjOMaJmOjvRIVhUbJfLwN+8Hb oAmxl9BKvQ3MgHbehqAJmH28Df4e9q4zdPYG+GGOBCnwN/sI2Hwc2vg4cT/Uxs48TOeet9O55yQP HvH0XPuXMrMv3SOV+7MpXiUmrB22ktD1jd332QQrzG0V8kBUPF1MJWWy4qMvOQekTIhI6RzFMoEV pxkHPo5T5Rzfs29X1apqtEmbqqIoKhfzwOZ93nnnBcLPR07kER8cRPDII48MWcSEM0LsuA8R4mNO 2cJZr1T1WggVBPDwww9PPOcbQF3ChCBUl6OT2G0IUdVqVcOHz8VGKdTHDuGgPxgJHzcE2pPYaOOm CO55YiJ9zJ07LxASLuZSVeMg5dPGK8LShnnBGDyznHG8FEd0HK9/xD0IG30AGxdtmDvSrLeBgHv1 XO6BX/qItuF9pG8IPbDRht/Ml/eAiza093FoA7FdWJDyPdCG396GMcGJj8NvxmBOPkfwjjkPLSMv r24gzBBizId5eXVCtNfw4SOCLwDN08dxcxf9wOCWFy4PBey4GIe9wRpF5+NRYLSBkQIb+HJ4WU/6 9Tl6tWOPTIu2cRx4GLPPkTbgnzb4yZhvKr/jw5Lz7MEjuPFxmDN4jI6zrr6cMtGl9f1S5Vzbt3sz O3bUIrtG554P7JpnPZrVXt+jbrD+2StEOu0qH0jhyq/t/qETbGWtNladMF7tsZWyMpTrEuNA41iY L42jaI6dLlPVHn0ocqhw3E3UOZ6Ep3IxD6Rgz/aGOHpmcTRuPppN7meFp8p0pC6cwX6VVuoB7cbP lY62iSbl8SE3l4SOBgERxRfCPYgE70EMXKvhOfZ6iAOEA8cxkuViqbOUtUCSro+GIYLvUUMQDW8D zJ6tDIN0og/TSVXlrVviYCZaivFgHi7NEink2e74VyCOXtOLdylF4gEGMFueY1JJmdRWBebGOMDm NZ+8DR9LqmzHiqAJOpMB/w4b8AMzsPEeP8DBb0J+eUa/9OPMj35btmxVwmRgvF5TiwxwcO11tugH eLkH0QUO7jWqgESWyvYmp4Y5QrSR7B022gAzznrueXY37fFF0BZYgJe27CfacJ9xeB9BxfuhjUez cd/n6LB5uRpMrO7bAL/ACePyvcO+c58Jmq2Xey8X4dnAjXLz6tmf+qsGnM49/5MOjnr1dCWRpg9K 2sCgrZfh2cu16jW2ffpjlvrKHho6zlbWbmu5VOOlFhYaSFlSX8I7+l/I41BUlcJxc6RxnL5nq5SP Q0UOf0nAz3qZ/HrutFzMYz3DtM7dBxU1fTZItDHmExgIxAXGFg2/hEiRMIa5BQIzYMDO0kZ+Du+E OGHqgkBhHnMG6P1zD6kZBgShSSrLgoTOBUGKh37SnkQ7iFqSuQ6pGBOg16iKI8UDBJLG5V2vixVP juQZhBDYIJJJGeKY3jB7ISC4eQYt0S/P5KZtUqY15ivGQBNJuijACN48sz76jsPGuiX1DQMANhhY VBihD54hCMDAWTv6j+KdvqN48X0TxT+mKxhhkkADzgn6QNv+3RIKHRzVReeeXzmgwE54YY7d/uFU +8OA398RqOtCJCqSSCgn+qABqkqtWlgPfS4GUksMJFTjTQmNa7sC7yjxccy36ithHC1tTxjHJprH sTacbBLMI9MkiejClg7hJ/Y/mtOARP/SSy8HJynlLiAgaBdRAkklWggURCnOPGAc3ynaqEo6JyJO xGEOb775ZjDP7L///mtE5sBwiGBCQ0tiHvhL3nrzLdtiyy1CFFM8H4NIJ+b3hz/8YY2+YYZPP/10 YKhnnHHGGuiBYQIbBJiy+nFCCNMl0IHSKEkXpipgR3sh3yN6MS+ilzwwIFqPjPdgPI8//niY8ymn nJIIG2X9eT5o0KA1nuMbe+WVV4JvJbpevIiQQOHGcFCVmH+cOcE8qCgAjJhK0Z7iF31XV2n6Qw49 ZI1nJGYCO5GDVJH+3fk90jOqULWGHagM6zcUffVXncy3R5c61qlhjbXRit/185BIKAayz4BULayH v5hgRTJh5daoaItKTFgJKgh29jTjCD4OZY7DOM4Y2Nr23qnbJpsAWJbF3qSZB8QRKdUP+4kiBEIC 0YRQIo3GTzFE0kbyhUhS9yp+IdFDRJHg++uch6TLzSxJ9nGvpJukMYW9Sv6LTGkwpTiRgjACM0yA MiUQ0uiFRE0ym4ctx7UeN/W4zyQOO74F2jJ3+o5nmCeFvXof9BnOJVFpFLSn+EW/+MU86ikJNo7p 5Eoax+/F2/E+JkfMbR7xl/ROilFGi27/DOFcgjIUGEAZE4I84poP/fkPa/t7ZR6YX2rIzHLhgHx7 n3PPnx9vz52sc1JEYDflK/hAYCD9eyjS6mt74PPxVlS7TTi/J/gNM5mw5BvhIKeFOjQuZ6V8HNI4 MFVtqpnjZd0DmzTzwJeAPyDpI8c0gWSdr8OOMEMknSVCQADEMOq/iSIWnwSMKen4XPrHz4H5IymL m3ZsZnfkxhcM5oXvhnIZcfjRmoCduWFiihNZCGS8UGO0f7QCP1wryfzi46FxJeUyYBZCo0gymfE+ zGaVTAHgJ4l54DfIdMEAOIsDwp1E/FkLxk6qJ0afaBtoBnGTFs+YD7W2MoXboi3uvc/eYc1Znzjz YF5oajB8tLukdS/rh7fB35P5qpvOPb+sX4Gd+cpMu/fTOnZyn1SBzk35Yk+hgey5U3cd5vSlPfpV 2gciBoJZcqVMU6vtOzEOquMSjpsj5/gpe7S0gX3wcWx6tarWdd03aeZBCGlpROrwww+T+eKwQJyT iCiEv7RDf0oj0EjfXiY8CQb8BUjgmaJ2YFxe8TbeHuLtJT4ylekobSNA/DA5Zbros7R+YTyZCjqC R/J/yntBoEuDDYJeWkVbmEu81pfDAtPklMtMV1tpLaVdrHdpa17eOW+odhWr1bTDtm1ir4waY5e9 PEF1r/KsTb2cDQXObzYu3ztawz79tpYO9rU99vX4lBNde4dy7iGPR0ymWIwjVXJEjEMax2kkAMpU FaKqVJH3//u1STOPtS3uhswQdukmSbpeG9ybn/8+MbCxhfey9+qIEP5l5wW274PTde75BHvkuM4h lH5jg/XXXHHmDQOpHaKw9G8xkEe+HmerZMIK1XjDeSDLpT0r9B1TlTSO0wYqqkraSp0GPwdLbMo4 Kg3fHpn4/5p5/JobcnNfmzHwe8NAMHdmVbZt2jXVuecFduHb022fLfLsCGkjm/LlRD+lgTSwgdIm Vtm39tg30kBqcRJmjuXPK9DPHMtdNS+E4+4RTFWpWlX/X5lGfE9sZh6b8leyeW4bFANxIpMp0GBD EiNCByrl1LJjtmtsr48eZ5e8MMH6ta1pTevkBt/PpnyBd5hBTfkv9umHNvKtPfq1EglrtggJrdVW zLQz9u4YmEstMZlUkMemjZO1rXfUUrKZeawNW5ufb8bAOmIgiWl4F2UhyL81M4Eg1KvfwP7cb4Ht 99hs+/MrE+3+ozpQ/UkO5OTItHVEyUb9OnkguXKi7957CzHMH+z+z0db5cI5dvLurWw3ZY7XVK0q fHm/x5pmvxTxSdGQG53ZqrTwz7UhgLZk/XIRBcNC8xM9c8HtnMT486wEAUpGI/eAv7nv7WnrjnSe 4x/xbHKip7jHbx/HN5ff83Hog778ACFgjMLm2dD+XnQc/h0978MLPXq2OWN5Fjb3vDBhdD7RApD+ jkdR+Xzi43ihQT87fG2wMR/6Bh4v5+KweSCCH54U/QB9HMd1UhvaM59oQUPg9TZR2BxXjkOHC9ho Txtfe9bHE0hZE19TL6Dpa+Y4Y394G8ZkjLWF6joTiP6O30va2xuCeVSoVNm279DYzu9VYH/7eIbt 17W27d+joUJUy1nCY20f7Ub23KOwdtVxsauKf9B+bmL8u1YdVcdNV0b4rddlY0BRkk/2FzEP4vd/ UH4BJYeJPiF5ikgWImUId6TkByXbPTKGTGkinyhuR9kPolpI5uI9opLI2iWfIOlwIZLCWDz6oh8S u/jAySCmTIVfoXCisoOJkCLkjlBL3gUeRwD5EfTDc2cIhL2SkAaxYF5eVwq4uOfVV+mPMFJgoewG OSQL8xeGulHRNowHkWEc+qMPwkaBz2t5OWzU1GIu1atXKxkH2BgHIkeuAW0Y02t1kZfCc3BFn8zX S614kUNCaIHBxwFXjOMhqqwTz7y+FOMQpeTM0utucY9+6J82wEYb8EkmNzjgGTikb8KOmSuwAxt4 5R4EmEKIrA/zcUYNTDznGbADZwNJwAUqnU2/vMs6AYeXTOdc9sWLFodwWWDzvBLm46cbAhvPvSYV e5O1AF6vV1ZXhR2XqZQ8cBen65jV0nNyZ4CF0G3CoJ2xchZEo4aNSs4QIeQ38UyPcBRdqt4aFwQn iWFECVFpmspvRUDCmlSvZcdtV9/eGjfFLnhxsvVqUd2a1K5uS1f8PzHVoIHUrqvKuKlyNNTAIngg 04Ftv9XabMhx4swjuq/LZbaCiNx9zz0hnp64espsrBKyd1MmNOdq+3kexPOT2Q1zCYX9RPS++uor yxPB4yP9Wu0miTlAHDKFUJKEB3Hievfdd0OMP2GiXtqDD5gJUQ33pZdesr322isk7kG0+fghPhAD 7kFgqEflh0ZBiCmVQTguBBniBTEaOvQz1UrqF/rgHPITTzwxlKAnMZDxKS+/51572rSp08I82Gif ffZZmAOJg1RjZRwviOgwQlDZiBA1khdTEm+2xq6iczF+smOPPbZkHJgCsMEIGAOYyeamqiuEEThh VDBv2oJrCCSZ4WReu3bDnMAf+OeHisGcnfLCCy+EhDpwz/oQFkziIfBRW+rhhx8OOQ3ADKMnUZJ5 t1ebHI0P7hy/MAHeA47uWysiRQUTGZOxg7SenapqyzoQAjxixIgAHzWuyNgmpJm50B8CBs+cObCf GJtsf5jbgJ0H2COPPGIHH3RweJfzXgh5fu6550JODOsI/sEx84KZwdxZF2qk8Qx8HnrYofb2kLdD 3kcdlZgnsXCg9uqYsWNCqW4qE6xAu9TcqECwQmX7e+/QO+wh+qb0Sgnz4AjS9BfOb2cY4NL/Hf8d tEcYTYS5bEgikeZ4llertl3Qa44d8fwCu+bNqXbL4GYqOkrS6qZvvnL8V65aPfwTAcYtGht8bTYC ANx644VFy8U83NTiHyPMBM2Bj2W2Pjo/NIgPGaLAWdbdpHkMkTbSRsQHSXO+7lNwbqEIHkQLohgv ZQG+IJ5oJl6J1SVSCAkEig8YeCjnMWfO7EA8YV68B8GAMKGBQLD48CGgbAgILfeRViHUEDqK6wHL lClTA1ECSRCRL774IhBHGBEfPe9+PvTzwDhpM2bMmEDI6Adtyo9QZf4ceAVMEGn6hEjvuGNfMaUP A8FHQxmis8I5p4T3nNiTBAd+mCelSCBYwA4xpHYUxJVDq4CLsSHSJBXCsMCvl6DnXcqbcI9xIJ6M AwGFKELMgQ38sG7MEcbMuoE/rxflbZgDDIvxYRZt27QNeKV/kgKbN2seNAyqi/Iu92AcXrTwRx0e NWP6jLBmjAMcMAbWDIbLPZ6R7Y3WyTwYG9iWL1tu337zrS2Yn6oLxp5Aa0Ig4T3gpYwMDIF1Ym+w JuTUsFdgvsDN+q8QRYT5cyQt71DuHzgaNGxg8+fND4wMBsFvNNxsMXlwjPZCP6WFefORUaJlntpy cJmf5R4YSEodSWklaUazEdCFEhDQl6otmmODGq6w/32qhE2bYn2bVLSCFWWpHrgxzWQzLL82BqBF 0PqWolsIkeViHpgukF4h9hAKqpf62R7b698QT+oSQVAgRmgKfDiYMYKpQ2XVW4kAQQh5D+KXKfnK zVEQZd6BOEA0+KhhAHz4KWl+mQ0efICIyNxAcHmGZgQBcrMKbSCWEBuHB+LlVWfRHrgOOOCAwBAg FoccckjQPsjmBnFIswcfnJJ66QMiAaOifhVjeilzCA7jOMOAASAZo2l88smnIkztxajGBwkevECQ KAcCzIzLnDDTQYhoB7FyaR6GgzTN2KjVMAfMMcwFognjcTMQCXNjx40NxBxmyTgUhEQ7gSHRP4wC JkGFXKR+YKW8CaVPIMDMjZMhwQEwuNkKuPj3PCVRwQgZH7jAC8wITQyiDhPlOZoU8/IqyTCv/Q/Y PzAT5ketLrQh1myJCDxMDfwDL0wYDeaH738IsME8YATsH6+z5SXUwTsZ+Nlpn1QwTQkm5oJAwP5g X6EVIxywL1hzGCt70yszAy/zcUGFOmNDhw4NeMuUwAljQKPIEh5hYpjegoYRuUrIsNdN+rW/8l/Q H7BVUERRu86TbewT0+zuUbl25K6drVYOh6VpHpt5yC/A7u+7Kd8Bwtoc0fxgUSjPdPigIFhcSO5e bgLC5IXyoiUoXKPATOFXi5YtSv6dVErCH0Jo3L4MUXTHNCYeL/vB7wED+pec7+Elz92x6jWmvFwG cIAICB9MKUSbiOG5c5lnECt3vEOIomYHnnPPHeypkL+KJWXTgZ2//Rxw+oeBuv2ccSBk7dt3CIzH Ha/0ybuuHrpj3J+7xucE0M8zSZ2TnCpN7jZJpHjvy1VvzEs+Zy+tAaF0Z7bb3tFgvHyL94kU7n27 Exy43DnPnL2QYlRrgqn5OrEP6Ndrbvkxwp06dgr4BRbwEsc3hNrnst222wX/De847vi348jXgWfs QV+3gw46KKwPzJTfPPczOnz92AtRJzjw+n7zdzCL8u+kkjPgwMerqnkgPKF5aLDyfGYbro3WtX3L 5nb5Tovs4GcL7D+fzbdrBrVJqUr/j8xXG24BNtKRKW8vYQjr0lK+640UzBKwovWDnGg5UfeXICx8 qPGLDxnileSI513MLWgu/HZHbrQPiC5SJu39UKHoc6RXiI2XComP71J6UluI1xxJvDUlXSfBh3aF JA1TS6qhBNGm30SnrQBhbH6AzQ++cvjcyQ0T8/NHorBz32FPqvgLbEge4DzuUFspx3KqXleFAFt8 XYJJSvOmXVJVW+aFJgTMSaYhh409kFQ23X0SzCuONx8bvMWLPTJ/N0nyLNOeccf9GpFWaeWCoooo GoFBcViZmOXvjnkE6aey7d65kZ3WbbHd+PZk27NDjvXtpNMjC1OlOzZf/z8xsFK0gW9/CYfabcoo gNA8+OBDqnrbb43y4hBQzCENGzW06dOmB00qTqxwEGPWGDx48BrMA8Zx7733Bsn05JNPDswnekH4 cUpDqPbZZ1/1nb3ac/qlf45l3UUO6moy7fgFkXv99ddtmGzwB0tijlfN5T3s+5huTjjhhDVCRiGg mLQwI2E6ihcixAfxxBNPBLPjwIED1yCymKso2Y4/BzNa/HrvvfeCH2rfffddLeKN94ggI7jAD17C FBbHC854tE1MUnEijTnw+eefD9pmUo0rTFI40furkjEHa0Uv8PaygiZ+kK+Fvukj/px5oakk4RR8 Pfroo8HsB17isGGiDWsm0yn1u5LCGFcr2JviIqmf39slBlGtZp79Yft6NmTi9BB9NaRJjuVUFTMs +h3O5/eG/40RXu1jxAYEPITqTZp5QCRHjRop23luIHJRaRGij3391ddetV123iVRyg1VNsVkksxq 2NsJP6afJCmVdmg9Kel3zUgV2hEs0EyEKIkIYf5jkZIKFCLVjpVP5icRSRzi8XM3sEtCSDGbZTKv IN2jFSQ990iuTCc80rf7V+J7HFxAZGGuEPj45f4Dgg2SNCru4Ttic3qORbQP10ySqiDzXhf5YZCM W7RY84AjxnbnOXsjfkYLuEDjYt2TcjhYUz9ieI2JpYVxXOL4BooxVTnj+D0yDyZYIcvaNmloV/bO t0NfXmD/en+aXbanzM1kWf//Cb7aGMn4hoEJ5qGfcHT1pq55EA57qA71WbAgv8SZG8U6ET6tdLxq UnlvCCQMByLveQPRtjiBIXQQnExEENMJjCcTAa8hbaWbpGPs49ELZuJmlSTzSjDrqN9DDzssEOo4 84Dh4IhHsyIiK37R/wARdjQtiHR8DMxNSNaZCDhzQitIIrAwD/wKEOCk6reMDeNwH0ccNxBonPkw BzZpnDHXENOGKaJd0UeU8fJvcmYqVsSMubom6DjA7IRDHnNcnHmgLeFjY36YLOMmQfAFXEmmPiem Qdnw8NvfPfPQZLKr2V5dGtjx4ybZ39+ZaXu1r2E9WstEvHyz9rFhKPgGHBXmob29QkLx0o1J84gT gnVFEVK+Z0R7W8wWnm3sdv44keZEuEzP3KGb9Jx+PDfF81DifbtpIylWHIJNfoJL4vH5YvPfe++9 SxIVo89hVhBYz4qOjw8RxSzjzuz4czSKPmrvDvj4c5gPWhmSfxLs4NUdyUljY+oCBvdPxOdG9Fam sSHqMJ1Mz9ulGTqwwdziV6NGjRVFtVeAO0mjI2KMYAIYQxx2BAKec9F//DmMjAgt1iy+X9NBuKsF VvzuNQ8Qobnm1Kqr3I+F9s7EufbHV6bZqycoSRWNerP5al3J1O/7/bQ2XUj1jfI6zJHeyMsgM7ex bPaYSfjwuDwkkpBGbOok1hG2CcFB4uOjRPLEZo9kT3gk7cnHSHKQ4huACCDtkYPBb4gmkq2fv+2O UD72qDTsH7lH4Hg0ka9glLgkPYs+T6pJFC29kbQrPKooqS19R8tnxNsDMz9eQiTOmNYGm7f3JMZM 7T06KPo8isO1Pc80N+8vCa+Ol2ipEn//l469Nrx5lN3a8Jo0b4/44jday5r79ecTEFdjHL9Xs1WK i8p8Vck6N21gl2+/yE54e4Hd+cksnXve+Pfpy/l9k+8NC31ak0YolE2+fD4PCNJtt90WktiQ3D+V eWS57POUbxgxcoTts/c+gfCRK0FeBMyDJD6ibJAWccTCfGBC3McEkekAIByzaBXkFOBEdoaEsxhH tn/AjOeZj1GiHa3/5MQ4WtPI7yW1cWIRr8vkIbrOLPkdHYd2HuLqYcNJ47iEGyVoDpsTL36XFbYo vPzbCXsSbK45AIP/28fxMb3OF+9EceBhq9xLauNM2+tdOS4cL65VOAP1cfy+44DnUbzRXxy2aBsv I+G4y6qUpcJ+qTDZ6Jp5P0l4cUEjuqZR/PvcMn3FJUwnbR/+3TrMV5ugHDqVq9uBXeva2xOm2RXv zrbd2+RY52a5m81XG5ac/7ajp81WlJgSwSsf8+ADguBD0GEkOE/IA8CB/N3331pN2ZtxKBOKiWZB 7GK0VAMfLyYV4vcxjzz44IOhBEY8egbMoF3AaMI55PI/wEgwu2B2wDThzIP+YUaMyzvOTDxB0B2d bq7wzHQP5S1vGw8bzjQO8EFQ6J/IKx+HdrRBY0uCDRy5zZ95em5HafOhDVIBfWZqA0494RAc+DiZ 2gBDtA3vwQxSsCWPE2/DOJ5PguknCbakcWjDD2N6nSo389GPt8GM59UGmD/whTZLFRGSTgp0vIF/ mJK34b3V2qQz+Xkn2ia+n0pLlgvaVjTS6veseTh5Ej5qqu7ThdsttHefX2QXvjXLnju8smWRY7Ry s/f8t6XiG2i0tOaxktwwfWflirbiwyPpClMUoZU4bLHB48g9TE5cDw3Fdt1G9nPs92gpaCF8WBBR /h3OuhZAaCLRIodR1MB80GDILsfBzQ9ZyxPEUOYoIslzDWAu1G3CWUtmNk5P7OeU0MAJOnPWzEC0 unTuEjQhxoPIoPng2+AecOIQ9TaY0yA2JAzyHAYJoQd2fAqMgxkNZkYb+qENRA0NKdoGPPGcjPNo G/qZPn2aiOTK0D990pZxiQjiOZnYzIU5Df9puPXcpqdNnTY1nBPOPGgDI4fY0Yb5Mg7MmxBih41n HggAbMwLhotznfVhHNbMS4/AzAk6gJDC6L0NJkOCCLZWHavvvvs+rAltgAM/ULSNw0YEFc599gwR YggFrD99MkfwA6Fn7wAvCZ20YRxvg6mIvUOfwEYGuLfhHm3YG2i4hAh/9/13imZrFhgJewPYGBvm 6TXBeC/ahux6nnkdMNqw/2CAmFt9PtS/Wv1KIKC/d4d5dILkdujc8y2b1bfLeiyxMz9aYHd/Uc1O 611Pvo9Ica8NRNc2D/sbYCCteQSTb3mZB0SJcg5cZOXywxVNtCsp3yACAWPxd32Knv3r9uNMU4ew 8IFDaIiKgnEhjZ6gYoUeDQNB9DpV9AcRcRMOzluet27VOpRW4KOHILjJBGYBAfLsc+5DmCjnAWF2 34K3AU4IOZIoBNdNMaGNtAk/25vnFFx0s4sn26GdOWw4brnatk2dnc279MNzr8nEfebvcGzXa7vw XscOqWx05gZs3IOAMw73gc3NUQ6bM2juw2S9DfXDaAORdlMReOM5DM1hcxywzqwFjN9xQDueg0uY Ehew+XyADYbh7/Gc9g67Z9czJnihLWsOY+IeDNFhoxxOwEEkI9/7oaSJ762tu6dqg3H5c9bZTUu+ PmgxMCZfM3/ubdjfbqpjbPd1Je5ZL0Xi2of//g2+7fU6BPPAjFgl147QaYNvTJptl78313ZrVc3a NlQhwcLN2sd6xf/G0HlEo8bfXS7NI9M8ok7cssy1LO9HQzWdWXiFWB+DfmACEE73MTjx8o/e3/W/ 3XTm5pqow9/t3rzj5jbgcB+CE220Ay4v1R4dm/twaC+D4W18zh7JBDN0E1oUtlAOnjIm6fLsPh+H zR3R7i+Jjs0YaEhoQEjq7pj3sd034GYxt+PHn3sWe3xsN/NE18Zhd/MUbeiPtYrC5njn/SS8uUmM dh7Gy7sOG8+9Dw8xjuKN8b38ixP56HM3mfm5HXHY/MwOL+USX9PgLNSVsTwJTDPNONdbtFWakMtu mHJasw/RDH6LS+PUzqtrl/YssH1eWWIXvTvPnjxAZ5vovzVKlwAnGfZEZpFtz2/wx89vBW9ZcUK4 PDARUSQBKMAI7MC9scDr+AS+EMggeFl7/pZAqA++rLMt33tpTTqEovMNlK+Xja+VExeXNIEQQvLk k08GSdZNaf4eBIWCh0SDYbryaK9oP2RKY9Ih5Jbw1Wjf+Hruv//+QJjJ8vbzMBwzmJAo8w1j8Czu KLMkiY5s6OYan1pbTqxozzi0/VLVZA848MAg3Tsx9udEq2FCIZPa7/nYEJMJzPUAANpoSURBVEiK PFJwsHef3sEME4Ud0xpzwwwDbMwhChtmI7K4kfZda4zihdL4+KEIW43jFbyQxQ2Rpz3JjtGx8V1Q Uh18EbLrZ4o47JivXnnllaBtMbZraf4csxIFFDEBoj1F8cK7lGYHfopXep01h53foay8NErax/GG 2fXpp58OWhUBHKxdFHbMW6wLmhr7Jfos8YtYX2Yr7Q+Y2Bjt2yoicG2knQUfi2s96/vzrFjFtmlZ zy7tPsXOH5ZvT7SrYof3yBMhY+C0BhLMXBXD9zOPMjta7zn6XVdaayMJehtNyZZ0YMk4mUBhv9WF zwUiyLUldM0VvPUFb8ONBV59p+EoBMFVGWYh/LL2VChfoHtt9T0HPXt97YP0fgZPmxTzSPpesLFT Tr1yduXAJKIfOwQT4gmRxLSSFCaMvR0mALGIX0jNnkSYqQYTNns/ACreHkKWT20t9Q+TiyYaBjOb mBXtkxLtkIaJQiMJENNLvPxIOHRLffbfub9Vr5Y6myB60T9h05hwkiRoCBN9EEmXdKGR4Ndwh3X0 HQguzyC0SWe0MG8YZ6aaXcAzY+YMazG/RdAw4iYimA+wURolaV7gAriSanIxNmsJY2NvxN9hbOD2 QIJ4/37AVmmFPL1NqE67vpgH5kpJ8f+V8NJG+/q80083RRSsP6KxxuZVBGDVmna0Tht8ffJ8+9P7 +bZjM/mE8qQJ+cFRMA8R4GHyoz2uMj3nnnqq/e/OO+24ww+3RjC7tAa3vvncWvvHrCkN7gkJFZhi tpeZ/NFnn7UzVHLo5v/8x05ULlZDmVtFCNba1Xp/QXB+LcHoSQl+28r8/aP+/e/rr7fhEjJ/kk+v rYrFrtfovvR+LolwXO8T3oAD4CSlCioMACdqnFhg58b0kVQOHgKDBArBgRi67d+n40UJIThJxQlh VJh1kLCTzHMeLooPJJ5FzfseCJBEqCBwEFWSCMl9iTMP5oVTnwi2Hfumkt6iF3Pz6rLgBn9E9GJ8 kuXQIjwc15+7L2L7XqpOS5mK2AUu8BHA+OojsSWMTcAAhNiPeo2+gimwe7fuJRnm8aKSnsgH8Yf5 R5kLOHe8JRWrBHbgonYXOI/vB8ZmnfE3ob3F14X+2S9xfCVucY+2Wh8agQhvZQV3tJeA0Vo4CBfm lt/KFJQ2m9UTni7bWuartxbbXz5YYPfukyUQJBFTeRdCwzck+FqJwbVXEEhr7ctWEGIYx/qSjteV 3kjIqihG3EbaeZFgbqnoz+ZibltqD7fW99/C4XUz0br2/2u9D74EawvhE4FhkGrxTdE3zoFl1bWX +0oADsIxZrb1daX3spvMNxmzVRK+0Cj42CEKSU5OtAKiw5KkbxaC0h6eO5LUv5tNkp7RNyfxoVEk lS9B8j7ppJMyEiI0jn322SexLQQSkxGEOinLmjljqiOSKqm8CUQXRzRMImnuRG65YznO+PgbZ3oI XFAF3STmwRkbmS6YKTgHv0nVhmHkaImMk7RmMFv3+ySZjWiPdpHJpIS5CcaVVLcLhgNDdj9SfA4e KBI3Z2WcbDRc99f+oMmxUZ8Vo2P8VsyDuTBWpSq2Qytln3eZYZd/v9j2bVvVDuiqsjCeeZ7OdanE u2IYrGk4GMth/rVxUt7+wKVgCrZ8/TuLCgJkUaPhReH9LfEbn0saZ2izwNZIe7yKvsGfFAm4RPSt KdYRMZf1WoQzvZ7uXdukmYcTTneGx9cjE/FMfRuqKopDspQrXkk3/moS4fZ3INpJZeT9OTBngjvK kDKNAeyZ4M/E0KJjlzZv7zeT07i0thDm0sw+pZ3QR7+ZStD7mKXN2zW6TPAxn9LmRPsyaR0+QDTi qryELVM7CF36J9HfUSldxTkw+PUQCZXWPrJ07vlJXQvs7WmL7cIPs61Pk2xrWFPVJgopnigY04md q8GKFL+xaB7g13HpZpkIzCW43dDwutQvcMmzyBZ9aCgB83tVmUYDrcuRFOtbo3M8pffkJs08fu3v dXN/mzFQZgxEGcevTXjS/XFSIomzqzMPMQrlYxQtnhdAzZJvYr0R6sBAKlrjenXtzzr3Y793F9vV n1W2W3eFrEg+xWclYSFbMAJn+I30vhEyD+ALTmCHlYKn+jfwbxTwpvcTWhHrzrWFcq8efuYZ6yxT W2WixWRqXa+mS8FAYcT/F5pHmT/0zS9uxsD6wMD60jxEgDloaqwCB4JZ0ZkTv7OqWOGcCbZ4zEe2 clmB1dxioFWupxynovUUxsmYqrw7oHVdO2/abLvu28U2qHUV262dAjUE2ywFR4yTbX6GatSNV5Lq bPnrMJuuN4ZWnnUUM5uoZGRMaq0UJDNRcE7V73HCL/C2lik0XL+2ELCusIpxzBQ+RyjScbF8dx0V NQisQYCAya1v+GL9b9Y81nUBN7+/GQNrw4CIJhLaejN5EKor4tFVkWV15Tgv5iz6AJNs9CuW2/KZ oyy3084paxVEZSUOaoIb1lMuCPwjp7ad1nWRvTl9sZ33YWX7oGGW1aldaLkibDsoXHupiHFP/Q44 cT/C2vD4WzzHD6Mw11ZKfGbNKkl6305+tfliJtsrXDwY/9a3Oais85TAUE0w9hIeF6cDgC5RpF07 nPpoHeubwcWEoU2GeXgyn68DEpknl0WTzKL/Dp9bOs7b/+2/3UYb7Se1NqufIeH3PNHOx08aMxMc cTg9msHHju6taJ5KfI5R2KP/jvaTFPkVx0FpeEuCLQlHDrPjJdpndD7u/I7PK7qO8cq98TnE+07C m48TH9vnE1/bTOvsY8dzYxK///WleVDvS0T52EMPTZlU3FyhqgjFhUutovwdWTUb2eIR71lWrYaW XaN+2pEaYx6/pgNYUVYt6te1K7eaYgd8uMSu+zzbruunKgsqYdOLEx/l1N2KUyVJZPstkxrXRpjT ppgDFJUZLuF22zS83YGX6KWNBV7BsZ2qQGyn8PwQOixc9uMIAeD7LRIZ0/v5F5mtCLEkoYrfOH0X L1pslbK1cRWiR2gnUSuEyVIriuga6lNRtoMEFz46olaoS0RUDU5h/o0qG4++4QOOnhPO355hzNjR DGPeI4rGCYeHmEYJTSai6IQlmm/hRMWJn1eGxaHKOF7wsLQ+naHRR7T6LHuUe8zBo4r4N/fovySO Wv/2M0ocDv72aCB+87e38cq3zvg8T8Jxwn0Pj43jhb68THlStBF9+X36cVx5G5zw4IV3/Ceakc94 jO1EN4lp06/PyfES78PH9jHiRN/n7JV6fZwShsIY2oPRfqN9+Ho6vPEsd++fiK5Snft8aOsrz8MJ ouceOJNCGMpSRr8YyMqCOVahag2rWKjz5AnFXiE5UbXQQkSOS/4O46/BROgju7rt2rq2nT51nt30 Tbbt3SrLdmolzWdROnw0nG0fJLD1b2JZG9OIPA/E0CV3/u05KKXBGzUXrsNYv/hVmBk/bkJiD0TN lr94gFI68P2cfqVcmgcZyrfeemtIkiMTd8jbQ1Tyv4Jt03Mb++ijj0LmMGdBwzAIZ+XMaxgIhIZC eOQQfKnzuclRIJ6eD5LquvGLHARyFbxkO/H5MAyYEmdZEwrLB8yHvnjxIntbcFBkkYxxfgg3JRmO 2H364WwQQj2/V8G8Bg0alhQA9DpOMEQuxiGrG4ZGIT1CfikBX7CoQHHrzUOxPmCmPy+Yx3NqOgEr TJKscXJLeA8m6YX73njjjZC0SOb3hAnjxVxrhjnQhvwIcEKYLjkIH3/8cchuBx6iVtoKR5yTApP1 isX9dSIgGd/kehB+SvY1mdkkEVIIkSxr+mTe5IewdsBMEUTggujD6HfSmrA+E2Wf9jbAw3gwZsJv vaAh7Zkv48H8WVtyYsgL8VphzJ1aVmSLs08o9khWPDhlHD+kizmCa3AJ/pkPuChYWGBLly0NRSP3 UBb8gvkLwjozDlnmRLp5WX8SBpkP+w142FskOA5TgmiOCCdJjVQToO8c4Y75NBDxp8Q/ewN4yIuh thfrREQVGejMl1yWObPnlBSUHKaELOq2cZDXWq/1pXn4wHEbt+ZRQT6PKnVbW8G3L1l1zWNV0572 tb6V5YuV3a3Cmk0kuOVIoAuOVUxa/EZy9dIW5WUkwKK2VWW++oPMV+/OWmR/+jjL3qlXyXKqqMxH eSvvpvstYToOn88d57GbwsIBVWKO0TbOrJzYM2d/L5obU1Z/Ae9xdhF9kJj5W+bX+FyiG6+scK91 s5bhhRjTLxfzQHrkY4OwIeEtL1we8gbQOPgwIaAQTfIr+Jj5GGEOEDGIB0SF6rAQGj5q3oPYe1FB nwYEhoQ3wi8hLO+8806owApR4x5EwaW/OXPmGh82hBXmAqGAmFGmg80EQUbyTR0NW6dEK4IIMz4E BMYE7BBufpgjxJMxIJQdO3W0oZ8NLTlmlfGBg2eEn/LbJWvwwL+RXJkb2eBIq8FZqI0MU6PNtGnT w3TBCYQdogyBhNgDO4Sc9qHCrz5wiJ0zli+/HBYYJGeZw2jJzwAH4ByNDxzMnDEz9MP8HEaYiFf2 hXkAV4GkLKR5mJ4fYQuT8HwQ3oMo8wxYYbgQV3CHMMD8eJe/gfXHH39QiZBDwrusP5VpyYbnojQK +4acCz+qF1wCNwwPOCn8+ONPPwZtJjcn1z54/4OwfvTPviHZj375QVtg3rwL7mCgXol3qd5nTuCM sWAy/BxwwIFh3qwZuCEnxmGBMbFXYXhc3634LozhOAO+qLkr6bML0uz6Zh5JA69YZpXrtrLsOo1s snB5zmX/sLc+Eu6E71rCFUlvbYWjZpp7+LcYYR/ttTr6Dn5xljrzrZhlbRrUtb90nW6HDV0qDSTL /rJ9yEhZd20Dgk8Ukecv8DfOYX4jBevZfAlyfGM19M3PlgBSX2sTalLBDIHH6z6hTXBUgdZ5poSd PK0x+FjnvAiEEwkv3yq7+0idJ1SF/mEg/x+uX4N5wBioLgqBGy/pGYKNhjFx0sSSczYg8hBmiI2f yQDBRNqFEcybP8/6NO4TJFok0qR8BQgKxJsPnFpHbHQ+dIgfhAtiCfHgHh87MEEEIHSYwpB+kWq9 WB/EkLIfSPIQAggKUjeSMRqRlwKnDwg/pceRQP00PogXJb6Bl4quEBneo080IQglBBgGBJGH2EJI 2dwk7XlmOAwHIsfcAsFr0TzAwbjMid9ocEjPaBUQS5gv/dI//QDL9tvvYM8//7x1prS6NC/aQMgh rIw5dsxYmz1ndiDaSPGMBREHNpgN/brZkHuUcQcO8BbaSCtkXcA/83DtEALuZe9hkqwF68oa8DfM G+I9e3ZKM4Nxk8xI38DvVXzBK4wZhspYrCNwoFnwHsyIvcK8gYE5sSZkl4N31pAjMacLNpgsc2Id OOP81VdfVRmMRlZXfgD6qFGzRsrkqQ9giy26Cs7ZYZ94uZJJkyeFdURjA37MsV4en3EYF+2Ocjfs 67Xlo5Qkwm0IE00FmSeza9gFN//Phnz6sR0tIldbe3WMvr8ftVbvfv65LdO3FXAu+LbVnrvnuutC VnWwpZdX+yiR+nJs79Y17MTpBfaPryvbwGZZtm0z5UytS+XdtM+SaKIGWosQNqu98p5gr6x166H1 nqF9UKi9znpNUxWIESLoO2rfLtOeaKL5olkVaD7z9dOUPay9uUxzHvLhh7at6q5tTfXndHHTMtH+ tBn5kptusrekMbdSFNbOsnRoc5Sp+e/+pV+DeaANnHnmmSX+i+22TZURhxj17NEzfJQUxeOC0cBI +PCPOOKIQMj58LzWFP+GECddEFm0G/pAkqYMvJf1gOkwnl/UUWJc1yIgJGQbIyXykUC80Gx4DqOD qPE+Zi4YEBI8hItxICgQVcw/wEBbGJlrLpitaAPBchs8Uj59wkDqaqNCfIAJeJk770PU6Ye/gQuG wn1w17ZN2zCmHxgFAwHPMEzeoW+IP7DQJ1IxsMH4gHfZ8mXB98S/mTtw0UfLVi0DLN4OXPOxQVBp z9hoEcwbBg2RhIgCH+3BHYQaYg7zcD8Oc6EfYKQN47IeXvGYucAcWrZsFcbhB9MUOAceZ7JeYoS1 ATcQahgP8LsGRZ+7qhyD+yFYQ3DiJU5CGXgRPubNPZgVeAM+YIf5wKzBYT+tN/0yf/agCy19evcJ bVkz2oAPxmU92BesPfChxdAmqbTKGnt4Q2geAKF5fiki++7HH9oDN96YOj4BO7nmN0/znit8FEgA mSri+70Y/v8eesguueEGe/aOO6wykjSSfnmvoH2oekDNOnZ+lyX2zuxFdsFnWfbG3llWtTJ9lzFh UbgfKUb3skzeJMG1SFs2hkhAaikmTiHAORJyuujZPO3FjyVwVNXe+kBa9iiFsh4jhsk+eFsaMd/L NDH8DyTMddG+qK71D5rhuuabCK/fSfCcoBDe5up7iDTcnVWFYr2HyJZ3LX7tdrH9XC6zFR9xNBPX na+l1XjyeXipjlLPREi/7MULvW1UO4lmd/OeEzbvN1P0jn/0zoR43x257qyFeLqDOGV9+DnCCuIJ U4rWfPI+3Znt/UCwvD3vQ2jdcUv/wYSly/tyRznvuIOcD8BhjTuyGc99CP7MHejRfeNwcc8d414P y8eO4iA+ZxcCHA/04ZfjiTEgxn7Rb3R+tE2qIcb7Uee2z8nHjEZJ0Ud03zg8cfzwdxLeomvqawOc XPQbxR3/9jNLWA9+omu+NrPVr/3drlN/msvnIqYdxZAHyycpTpliHlq3OpLI62DaEQHuob/31d9b ShA5/8orbbzMtB21938R83CirIivTo3q2uWdZ9ixXy6zW7+vZH/aliKdZQwX1hqiKQyW8IiZCGEl T4JFGwlngzSnH6XFLhMTX651wqx7mMrKfCWLwLfyWZF9XSChpzqFSfXv/tJE73n4YVssAaBAwhe7 t4xQ/Ix2CKfw+rWYRxt9x1sLZyNl3SiJxPotfQ/rtBnW38vlYh7rD5xf1nO8tAQmGkxlSJpoGxAI Z14Qpc8lnWFmoXiiX94H0jT+BxgikrIfeOXPIUSU/0ZKdnNOdHyk2Lvvvjs40dFu4syWsTG/IOFS Q4vLI4z4N+YXN815aXGHEcKF3R6fDPOKFgFkHCT+Z5R5WlWw7y+pM24SpC3zQiLHNOSHbHn/mGvQ rsAbwQLRyCbeoeQ6Ji7qQHnBSJ8fBBaTETCijblpz/uGCBC8AP6YFyagKG5gYvi20CzQiLiizAqc 4WQH546X6HNMgRATzJXxYpZuYuN9mAtCQpQZobkAO2Oj8QJXtG8KZA4ZMiRoNZgHk8KeV9vBG0Lz wOSkNZggWFtRohtNwivuwiijWgXw6W98IMFMS3SRO5Z/2aeYksZ1cNT+bXPtjRkL7eqvsmyv5pWs awM5m1eUQfsQHNnSPr6RKQrY8gXbx/JrYYYaL8kffw0MZIm+05r6hr7Unp4uzbaL9kVtmaMxdZEd vkDvoy00l2aM8Eap9R/1LiU+wlVWop825Y0Ww2isvdNJ2ugX+gYKOQrbHfC/FGcbe/tfw2y1sc/R 4cO8gc8A044ToijsmFIgojAKNx/5c/6G0eDAdcdptC0bGuIKk/Cz06PP49Vo4ziDkPmZGUn4hFDB vDCTJLXFBwHhx38DkY5eEDXOeaBkQTxHgvcw53wuIsvck+aGqQq8QZzjxR9hCphzaJtUB8rLtMM0 gM1PS3T4gI15sTb4d+IX5jWYIkwlKdcCcxMCQVLJdfqC4eLvonBk/GLejAuT8JMjo+8wHgIHAkGS Zkw7/DbgLMpUNrrvAZMlVYGJCopGJ/Fv6rV5hBJmGxFZzDBcOJHX2YFc2uQ1Xg2Zry6W+erDDxfb BUOz7MU9KFPCYUZrwZoYXRdpR8DWV2ZvMr1/0rr2lzAzH7+mmrcUM8BsBfF+X8LWljLJNhbj+EoM Z5W0rhxpWFTynaFveDuZpT/UOzU0xz7qj4rA61QWHtyJ4UwRg2oippyrvpcIx0sjQTsb3T5YzwBt UppHHFcQTqRqGIHH50ffgUji/MaWHSc2zhwgGBCdpL6R3N8e8rbtusuuaxBCNIqTdSZAJvMGki8+ An4nESIYGwRuxozpgZBGLz8jBOaDBJxEJGtrc6NxAEf8wnw0VLZhNJak4o5ucoI5xgm4h8tCwN30 E+0fhoJ2ARNIOs8DcxDjRk8cjLZ3/0r0cKzoc3BVWmFH1gq/DuHD8bm5k5v1TipwiNYD3mGaSYwR vMC0/JjdtX6bG0LzACjMe+QRoWl4bD7ET1I3wtAYEeQcIvK0P6ZIS71UZ0K00XfSkkxlj1Ja6+TK 8EKIdqpsWzSua5d1nGWnflvF7v6pop3ejXpRgqc0BURrlKfv9kiF40O0W0pQ2kZMvSQUV31vjfCR 9lscSSVnxtOc24rphHno2+3BO2ltbLDMVyUn8IGbdUmsw2ypPtGAenJ0tQQoP1EzYKKsGkwZ0LbR voL5np80gJsM83C7dxTx2PX93GxPMIw+x2wBgYWIu+07+hziSJSPJ/BFn9Ef2oyHh8bbR00aSX0j 3cIc3AcR3zAeZEDbeHuIINoUzIs5ZuofApj0DNj2lKkOIpz0nL49bJrncfMM+IJpJeEU4o+Zjnbu G4rODeLsjBpndHx81mPgngPDuiTBxnoOJnpITCLpuZeLT8IbcKDtrPbRR4CD0XICIcwtqW9wzcmN zCFJK4rOs8Smvq5O2V+JcmCyXISvA6IG8RQ+n1GI9CX//KeNlmaHYzxH85jPKX/C5X/l88jC/LIe sqlJVjy03SJ7Xearv3yZbTs3rWQd6yoEd23mKwh8NHkvflZF9ECpTP+OtkkKBCgr0dd7hWpP+XP8 RoFf+FptoDX+RVulPObJX8NsxYeF+u+SmkcQhVBIIZIfz+ngQyTKBhOL53/gQyCEFykOkxHPIVZJ 4Y8LlSxWqVLqEJ4Ug1fd/fQY7r/gHmYgpN2oFO9SLO2QROMXxBWpHikYiSx+0T+EAhNRXIOAoPIM AkjobJJ5qLTFjWZhJ7X1yDHGBUfxC62ACCTmnAS7Z8AnPaOvaFZ6vG/HG2Mn4Y3nrAd+kSTNygMn GDv+nHm7SSgJb+CVuRM5lr8gf4150979OkkEPoo39lvSmro5Mv6MvsErmhOwJeGFuYUkQ+2bpHNa StpEtY6yEqhfRA0ijYXDXO1NwlyLRTwrSILHx3bCJZdYJwlMl+gcmXztKfwHJA0eIhNfD4Xdy/6a 6uTXhDcwLw7pkvmq8xT5qxbbZV9UtCd35ejj9MFRvENuBiY1/DO/JNrr18JhQj9FYlDkDdUQnKuE 11DV2AsS/po4W49zCF276ZKwbBhfWa9fg3lA+O+5555gtkDKJL/Aw2n5YHv07BGcotiuMcsQG48k jSMTpoM5g6QuGAb5Fdw755xz1pgChPGTTz6S9rkkODCJweeDxeSA0xdHt5sXPJTSI2OSiJpHOvnv 6DGqJeUrBEVZnwO3X0nty3qPPtYVNhg2vpZo2+i/1zY32juO4mPHF6K05+XBW7T/pL6T8BodpzSc r23ea3uOKTPef3RscOaRcKV+c+5rKOuH+Wu9lyZiedKiFmp/hMOMRPSu1JGqW0ijfFFBHHUJcWfv 8owkPH6vz2NWKcqozPdtmoiBtJ9r5w+vYg+PqmhHdyH3QxPXN00I8VcKfe0tjby6JwZuKBwmrYVg gXlQebea4M0XbcKvSP5JuIAZ3K/Pk/x+jT0ixvGJ6PFY0eYjdNhcScn5svYdWZNyma2QHInIIaKF D4kPEkmUiCSYyg5KXkPFh7BjG+c5CXMQLHwIOByxR3syGSU76C9uS2Yc8gSQcJH2XnvttZA/gsmE cV3j8Q/apWnauYbCvWg9KA/HdGnfw2q9rftG3FwD4fBcDZd0k9r4OM68vE20NlU8JJc20XpPDpuP 7Sat+HyibXjXzVM+dtIcec+1snib0saJaijRcZLaJIW70iaKa8eBzzEaKs3+5b6b0+IhsvE1cw0m umYesuzzZR/w47iOrnN0zaJr6uM4bNE26+IoX+dw0LJ+wGV4r7a0ezSLYuGf862/VGTQA//4h9Xl xDlpVu4HCNrGbyE1w3Rzatox7RfbGzMX2qUyX/VvXGjNOfc8u4r9XXTjnzqT/T9//rOdefzxJjNF GWb5274SLCuaB/kk0xT1V5XAEYIP9DdZ6+zbOjDmqKnttwUx82issbTqOfJxnfzXv4bgAyw/Awnl 9v2wDrBisisX84A44VQk+5r6QvxNdjcfGyUnyJhekL8gaBaEx0HsiLohEoYFgNFMltOOSB4+bExa SSYr+iX0EtMXjAb/A8wHMw5RMcAAk+KDJgqH/mFoMCJMY7QjsodMeMwvSLTY87lHuCX9AwfJcWhA MDTakOFMG8wutMEBiyZFG+ZCJBRtyEjPozSJYPNxaAOz9HEIKYXJMT59EuLKPIAP7Yl79Acs9E8/ tKEPzGX4RXgPuLwNY8OUIXLehrBUNDUYLXhhHHwT2PGZW7QN68IcQ6b5ksU2a+asMA7RUZhjWB/G 7CYpcILWFyIOnkvaaA0ImWUcb4P5Ds0QXw4aJm3weTAfhAXWDAGANgQpoJF6G2BjH7GO5IowDm0w H3kbxmGfYFZinRmHqCoIO/kk0TaEKuPbYBzaYGpirRjH26A1s6a8h4kq2ob+vEoBbdhrSJlNtJd9 nHVhIuvwTf46r+qbqkkSZbqA3jsKjmghptGParH40LTXWJ+KRGNB6Nwv8uuMnrkXmanq5sl53nma 7f3ZYvvzlxXswYHVbcb0qfaGrBdthffn3n7bjj3wQMvF/xL1Y6xv2NbWP0KkcEeNOejcHO2Zatrz FRWYMlSh40dddFFIPrz/73+3ranGi6l5Y9KcmJ/ge/XFFwM9oqrAY/KBDSRNwE1va8MBzyOCRrmY Bx/kueeeG4gM/0YbwP6PGcXPgI6GxkJE+Bg9ScwT5CAebOKjjjoq8chUGAr9wGAg7IcffnggmLQh PNWjaXjO+F5qAqIJweA9HKzeHnhpD8zAwybg3zA0z46OtoFYe/mTpDYQWogKhITnjEMbd9YyNuPw 3H0rcHsIIGPznIs2rinRj+cX0Ia+aMP86Mfn4xFgPKcN/fEO7zJH2kbHoX9v4zhgnOrVqge8wbx8 HO77ODC6OGyhMKPGYWzGYVxvQ9+M4xob/QAbbeifcRiPNo5/2pDR7uYh5sNcWS/XcHw+0XGAzdv4 OB5iDWw+jud1+DiMy7+9nIy34R5t/IxyTzSkYgCVeLlo45pIqd/ahvR5sAZpH2GBGPBXYrw9JaRU E47vvu8+u1/5Sczh3GOPtRCBhAnrt9A+QFi2cq6a1bKL2sy3P4+qbIerQkjtqaOsmr6jq846y/56 2202geKc1BXbmExAwk/QhLUvVwq/c0lA5OhX7bPL//3vkJNSpH+fqsCD1+66y+riVPdik2Uhyuv7 HRiE4HtLpVl2VeWMXVTG5R+qKDCXOndEZJYF175H0kyxXMyDjRcNdfQzrTOd7xxNzANHfMzRxLZM eKNdNNErevY1hMMvFhUNhx+IE7+dybiG4X97BjO/nYFg5/Y2vAeT47kzILQApFE3Qbk5A2mce2gj tImbk4jmgoi52SzUxkpXlaWPKGzMhXd9HIeNsYHNgxEY08dzkyFSdNw85oya9t6GfvwCNtp41BDS iOOAfqOlSGjjGdf8hqn72A4b/dAnsPGbC60tCpubtYCH9xnT20Sz0R02N3FF8cZaMz5tnfnyHhpL HDaeexSem6gcL7SnjUfSOWw8p42vJb+Zo/uHfE2Bo7TrF5us6J+fTA7N0p7DjEUQcOZOln9yhgjE oUrovFeVrjFZtNMeXK55nfiXv1hDMfQdKCXkCYLlIWJecSATrNHngjtLlXdP6LDEXptVYJd+VdcO nD3eGufVtC2k4a9SDNMsabWyYackYq51ceqWuijCZ5qIJr5WGk7TzKOi3ikkZFfMg5ySkdJKqRn2 wL/+ZU309/bSmp6WGf7Uo4/+ZZFra5v72p6nCG3qhwAEkkAF8xgx5hNUJqqrmDOWCk5QrMshXWVh HvQZcZqXi3mUZ3+t7zbOoKIRMJh2MP1AbDA/eI4AsEBMMKlgssDUFr9gKJgovN4UZqh47D/ZyJhX PKw1+hyC9tRTTwUG4XW+HDbeI4McUxsSuWdxOww8x+wE/BArfEnRvvk3phvPMI8n7AH7Cy+8EOY9 UOXM488x4cDwMSXBxCGO0f7HyBw0X3gBXvAGoYzCToAEyXKU43fflsMOEX5bpgeIrWfWR/tmw4YS 83Kitm3bLowffQ7hpn/gI8jC18p/gzPyWyDy8Qxy+sFUhRmQZ/Ey/wtkzqICMVoEggh9RMcGb8DO 2PjVeBZ9Pk0myU/k1G0uphMOOFoboSqPNE8btBxMSjiy+fjjNnTu8RyiCsGLP9f9HEm+zJOIK4pH 1tE+u1E+heN1XMI/LrvMCmV6POCMM+y5t96yHZhLeUwsaTt6aAtMmJkgQt4Xz3Ek4xfg4hnvqFhl I637lTJfHTl8id347SrbqxqVoHN1pGpWCIcNJc+JCnIcEoX1Sy5gIm+J0HM/7zu6PunnYTzmkjAe jIP9wD6hzEk3mV7xHZBc2U0CUQ0JcfsqqZd6Wqcedti6mYN8bo4zd8SzB9BgojglMg38cMEYos+9 nzTjoJoyWhFzmiaTNnXASL6sT+6a+pyl+mBhv5XlSps3XXDaZJhH0tyRDjizAeIOEYxfEDikVT/c KSpNQnA92zkpEQ9GhGSNBEv7eF0v7kH8k5L0gAMCR+lwfAAwj/hFqPNn6dLi8WcwPHwEMB6YUBw+ 5sTcgcnDqaN9OONkDlFtxN/JF4EGbzAtfAvRC+KOeRIiHo1c8ne45xn7MN/43MA5JeIp5EgwRPyi b3xWmI9gunEJH1+LM78486AvmAeM1cu/R/sHXxTT4+NPSnCE4eMHQSBIitZbIJwS8ooZCzysF78H wR4iDP9VLab3FRVzpohQP8q0+KE/EAURg7ufeMKGCI+n6zTBnXgetbELxySxwchhHpVEJJZoXYi+ wlSFyVH2Ruutb2KKNJNAgCBO68rsRNyph3Xl//4XiNEVKpZaQzgukWL1fLIk2yv/+99AYK8QswrP IXaVq9tOLWrZGfNn2RUNVKq/hiKXViwOfoXqardY87lcRR1na5+dI0l5G7Sj8lavTTOGh1SB+kVV TjhGiYf7Yq7zUNU0M8YH8JzKzxyr82H29ucRnFQQPmEgZJaTLAgDnCn81ZH5iqRL8NhNQssT+nYK xVzKVWRS/VDT63JFx2VprL+dfXYqOg5mlp4HTu8r9Byn9V+F8/qCo+Q0STY872n9/3nvvYa/68YL L7TO8gVPFM2hTWt9W9W1x8gFyicwoTyCg/rZpJmH+yA85yFOqCCyOHl5j1Dg6EUbfCoQeWzfSYwH xkEZDw8giL4D0zhbC59U5oL3Uma3CkECTiJCSPptpLX4oUpx2IAZ6T+pxAd9Y7KBWCZlkEN0IeCY ipLMhxBRr0gbJ5Ju0vLcnDheIPZ+wJeboqLv0HfKR5Id8JbUnnuZ8MYzYIhrgd4PfhI0CvAWn1t1 PfOoq6R5e4FLgi6SinwCL3jhONX1wjggVILxPTlgL5EZBDx+Lmb4imzTXbVmgdjp+cdiYH8SYYUZ fCrt+ZXbbw9miJJw2zQjyBKxgxCF/a9/Q/zq4guBCMNchEeih0oc5uvCPCC4GufqO++0B+WE5aJI 4a3SakocsHqH5/fKxxKeS+sIz5F0depodm6endB2qb00s6r9WG1fGz13qmUV69wRfRO3yTdz04MP hmimV6VpPqfD5yi3XpKLssbOKeWGvoNvpXH+SQmS80R4KUn/otaxt1IGAi6od6Vv6QJl2oOvdyW0 veDPPfdF3XtU52IJjTAQGOIIaR7sq4poAtrbnBFCoMISzTXUvFqXi3VTm5seeMDuevrp0DJfa36f ouRCX2ghWrdbVAX5vxIeuKgufP+116YYFc9ZQ81njITL2x57zMaLedfRGjykn/GywhBIUU/4RaDA wb84Mr91AZV3N2nmAfGiHLWHb8aRg2MWydqr3cafu/M0k5RJaDHaSbSarPfBmEkEyJ9jkiGKK370 rj8nCgsixuV+CX+GbwkCiXaSNDbvYWYrLYkNc5b7quLzxhTlZVOSbPuBgJJUlnC5iRCceTHJ6Gte Zp97BArELy8UybOksYGL5MgkjYm+0DgyMRaeYwb0YIB4/zAeAj5Y96SL/cRRAJl8e+v68a3xfpog IwFvr315w+WX25FyIt8qLeT2a65JmX/0zmMvvWTdpRXedNVVdrQElJtFZO8UAQnzSTOAlSJeSMk4 dmtLkCEfgb8JL3W7NeahQHTcfr4uE1A/4xRVh4nmYRHlFSKY5wrGo4SfXmj5ImQTpHm/psPeHtBZ IZwbcv7f/mZHKrdge8yREG0dHNVM3+AB9rZdOmELu2KJigxWLA4a7TMyp133xz/a7tqnJyoH7Ey1 fV/zpGRJme3zzCdNkPFDcADWm/L7nKbIqBsllT8lbaZSOtT2WT1vKAn/ZRHmsxQufL1Ch5/Wcxhw IMrqJ/gI1eVy/Y0pEEKMRhcIO+9pjiHlTvgsl89LOJ0lAv+CtJ+bxWSp3nvE+efbEOF4T2rcUVJf mvfTKkx6w8UXWwd9p0fzXMxuT0zvHt6sOX0tobix5nveiSfavWI0MxRVOluMsxHHJoi5FKcLOnKu S3mvTZp5IF2W5piHGCRJx47M0p4jGWcioGVZDD/jItO77gzO9BzTSlJRQ38/0xkp/jxeLys6TmnP eI/ItOhZKtG2ELAkbcjfYd6ZGB7vxIMkkphLElPy99aGN3fmJ+EVRp5UMNHfRaOLBmqUus7ufC3L ZvB3tKcwd4zVwVR77NTPuikq5nw5Xm8RwVuQPmQLX8VwCQ27KPR9ayXo/vGYY+yfklQXiKiEwobB p6AcKDEGCBjMA6KIIOOScxhOhG6BpM5g+w6awDpmGovQ/SA4kLQHCs66MoXdJx8fhyT10nHU9Mlz srEHyn/UQEzigSeftNfkz9refSwwutza1qh4rlX84j57c9uTrHfLXrZi3swgvQ9SRGUnCVCPScvq L3PbG4oUOszPJikrXoWLYhHdH2TK7C9NYyulFFyimnMXiKFNkUmvJccmaKxv9XwnPd9aeL1UGfjn SdqfRvVejk1IMw8YJGY1MFUkfDE3iG9gHun1xrSZK1zn4FdZV5yqn+EyA8Lk91YIbTuZtHd5/PHA gAPzUJ8jpUFRXwrcdJCAsYtw+irPyddw4UG/F4o5k2w5QHO6X+9MUxWPCZov1YjRXlZpHxE1VpqG vzYUb9LMY22T3/x8MwY2KgyQuawTNmfPnWdtiYwTce/RUQdRiUDh56otSXKhiNMs+QHaNBUREIHo Lu2V44kxt5Bz5Od2YJNHSsYUx5nlhJQHPw43CVVeoT4XzLdtlN/jzGSdbN+VdVqniFEt9Z2LNqO/ 2yqQALu6kiFE6Crb2CmTjWTFXPwBkoY76cCzKZQJShPjQFwJmVf0VefF31nFBpVsSeNTbcbiL6xq pVT5HyX6WAf8glt1s69lWpIbet0ujbtcjHSSJPrdxBhUd966yQdKyO1smTZbcgiZcAVxhdCC826t 2wQCPlP3WkjDdyf6YknraBxI7pj7cEQvFbOnRljQ3sStx4rhNNE6ZXmplXWBVv1NTgf41FEIPYvV WTlfPymiK+BKQQVEz1Etu3ZuqlxTV1kYvhNegt/KI8kqkti80ipjtpRQQVn+LME7XP0cLk0OnHO2 CXsknO1Szmsz8ygn4jY324yBXw0DwbQi+lC1WJL5+4qIWaiKsR1EOuTzGP5jGKZ2nRpWrOdvfvy+ zZX5YdsOMhsuy9LhR2P0nnJ4wnnc4gzZRGIV248TR5dEF1LnCrNVsZ7LUiRpX1FpX31voydOsj+d pFM8IeZlvUTUrWqWLZg3w14e8rYOnGptVRrUtAWzptioiRNsJyUOW83KtkiJpy+9M8Tat2xt1Ws1 sSXT59gI2eG36aoQXDQd1KJqqvxbvERzHG5tG9azPepPtvMmdbDb51e3rJWFVqWqmJzo8icfvWdD FXyxS6+1RLitNgecxiK/1SvYmx9+ZJOmzxCj1DG7WTraeuQP4rGKQBNOTc/fe/eTcEbIdp27iwhX tW9GjpNGsdxqocnBcMGp3hs+eYxwWiFoa5il0UDytVatWkk7qZFtM8aOs/e/HGbHH3DQz9pcWZzR 4LRKJfm45ttzb7xurZs1tTrN6tnSBTOlMY0K4dTKmrRlBQvs2bdet6YNGlqDugrPn7nIfho9Vgw6 deRuuKoqD8WWyRczJiQvf/vTcGsqZobwMV2MpO/2Pa248kp77ZMPlMi9UAy9TblriW1mHmX9aDa/ txkD64IBJEWIMr9LM1+IbqxcWWz5s1fa3Ckr7M67X9X5FVta/arNbPxrc+yBR96xbbfsZFVW1bYJ by+wO+98XfWftrSaLbLt47mP2S3v3ml9O/fQAUU6xbGwQMRMRxWPrGRfvj9DZ1mIaC8TEZTkn435 RuRuwbylVmHeSnvh4R9VZqOybd2+rSJ10kmCa3OYC9Yli1ba0slV7LUhP9j3P42xc4882gpGrbJX XvjRxk+Yan855TRbOHyFvfHKCJ0pPtFOP+IQm7jqK3v6x2fsx0kj7MqTztKEleOzvNDypysPZfQi HS72hZ12wn7WtuJ8K/r4bntvy0OsR4MutmzaEpsyvtAuvvIuVbKtZgfvtmsq6mht5iDSYzSX/Bkr 9VNsd97xhk7+a2ttG7S3ae/m2/33va/jaJtbXnZ9m/7+YuH0bRWMbGWNO9a2L/OftRvev9W2aNFe h2S1F06X2cIFy2zp2Er2yWvTdKhUY2tUU0xH/RcWrdRhUwWWky3fx/Bie/GxnxTNl2+7bS8Gii/B Q6lL2zeCddmSlbZ4cmX76NOR9sGnX9lNl5xvBRMr2jtvjLBh346wmy7dxwrGFduHQ8ba+x9+a1dd cJJNqTTSXh31ir3/4yd257l/FzPWiahieAUzK9pE4fStd761ow/dWaYqBfxII71bDvhWjRpaq5pt bMpbC+0O4aRL+1ZiHsrJKgtOmYMYYQWStNPz2WSYx9oKITLfpHfi65pU6G9tNCOpaF9Z22Qaz+8n PV+XNklwlLXPTPMqDbZM8y4NR+uCv7XhJWmd16X/Ur9zfTzRYpIZ39UHlk2eBZm7mC9KI3aSagvm LLZJOuc7e0Ft27nTvrbzUe1szrAGtlQEZJdOg8Lfs76oZ0smZttOrfe2vqc0sfeavGxjK35vHQbW s+O7HGdzmuj8i4W1bdJHy6zqpIbWs9Zu1mivQrv/mYesmiTXbPn/VkkSn/yTSmoUNLSWK3vZuSfX sbqdpHkslZ8EU9NaiFxxdrHN+HSRFX7e0HJnL7Vzjj/HurbqZzPfzLMac7vaWcecaR2a9raZb+RZ 1Rnt7ZxD/2jNdq1rL+XdZRM7TrajT93f2u+xlS3KWWXLZ9e0aR/KNLMw2w7d8Xg74sT97KdvvrdW M/9jy3Y80OZ3O9XmfNna6q1qbLt0Hmy7nd7eGuGIV5VthRCWDmtWRZmTltnEt1da1Vk6PqDFntbt 0Nq28KfGtnxsVevTjL9r2vwfG9mK8dWtZ12dx3NIdfui2bs2OvtLazSgih1V70Rb0FIa3ZJaNnWo ItNGNbCu2f1sh/23tKqNFaotZrwkO8vmLlP9sDmNbNEn8oct7G4Xn3KRde2tqLAVIrHpLP9SgdWa zPy6wBZ9pCoSIvxnHHGm7bD1njZDOK02rbNCsU+3bbfY1Wa8lWeVp3aw0/f7g225X0t7UTgd12GK HXjCHtZzcG8ryCuyVfl5NuWTqrZybkXbdctBdvjRg+zG/9xp9zzwoFXOqaLz7G+zhd+2sMXaVwPa DrJdTm9t2fhAVMG6TCZLaYyVZLKrxJ6WYPSLmEc8Cil6DjbVdXHSEX1DPSoiVMiLQN3jXvT0PU+W S6pvFY80yrQQjEEYKOGzXJ4Bjd2Ue57o5pnYodSAfojM8QKL/A2MOG0Z14v0eaE87xcnk7fhHtEh 0Sx6+omelU57nkfHIQwT/ERh4x5JiV7ehOcOD33yLs+9DbDznHvMi3FoQz+OS+bh+R7gxPHiZdeB k36ic+Cej+PZ5Nzj355R7/Pxsy28vWd0ezFH3vM2tI8+dxwxHw+/LVpZJHuzolU0Xy/gGG/ja+Zt wAFw0B8Xz6PFJaOFIsEHsEULRdK/Z6AHcwTSlcYHb8yLZ743HG+EQGeK6qL+UVUR7IpyEpckc5VC QarU0mmU9UbaIvk79ut+mLXqWcdGL5po+bZYfx9qLXvk2eiCSbaweKkN7nGQtdymtr2xcKIVza9h Aw5uYVOazLUXqz1of8273Co0naUs4lHWrWVPa71FA/v3M/daNUrENNShY1VFrFtUs7E/TbA20lTa 9trerH7Zbd5InJVazbCJX8kRXrO6HdXvbKvQttBGDxsjv0o1O2Knc6xia/39hcJXa1S1w3c8zebX /8GWja0jTWq5bXnmFvbvRs9YL+tpA1fuY3NrfmdFBcV2SK9jrVH7prawoijpyuW24NkrbMlu19p9 lQrsyKKFduC2h1rHHRQunydyVUc5DWW4KpO/1WikzZg51gZ03tPabd/Qxn2uiKPRU23XLntYO/U3 7kv9PXaq7dx5d+uwQ0MbsvQuWzaphvXZo64VNi22K3Pusb/UudgqNcuycaPHWMuGLazH9gPtp6xh wXk9W/RmuZDSZrv2NmbJZJ1OWNt67XCCVWz4c/WLMoBq2fmzbern4+T7qWzHbv8Hq6ao7B+HjbOK 1bPsqB3OsuodK9r3X46zCtUq2dF9zrDiVqqfN+YDq1Fpie1w9tb2YOO3rLn+O7LSkZZf+zuZuwrt iO1OsKZd29igoxbZB199bSecdIINOvYY++yeH22h9tXArfaxzt21P+uJEdSTWayMVxbRZaLli2Q6 LRfzIGv7xZdelE0tL2QBk6gGkSCKZoyiFvopEuAxxRgTTkrIKIlVJOlR5I4fQlAp084zPtDpcqLt vscea4AfCiMqHwHisoUce7ShT6JiSMAjOc6JFDCQlU3oLQTAy0qQzQxchNSSWEcYKsyK5xAS5kIS IQUFIRpEUBEC6zkSFMVjTAgyhIQ2nuPg53zQhvf4uIgSgZgx5nj1U0cSH4SYAoxkm9OGcYCTHBKS 1YANmyT4IAGOCDHwQgY5EVUU8/P6TCTeMQeYLwwa2Jk3daMgzrQh0oo2/A2RpMgh79GG5EGS7yjg yLgtW7UMY7dTtjdzgCASbUWyHbABj89n7Lix1lD2VuYGvghpBe/MjwgrxoSo8jfPERiAh/foCzgJ j+YCD8yXfAzwS2FC8N5Gzsr5cuQyJtFu9EkbcEafZI0DLzigDUIDEVTM0euLkbvjaw6O+DfFGomU Aifst1ZqAwzsHyLHaOPhv6w9/XKPNWM8cMW+ZT6sBefOlxYSHLSNtZmB0jt+5YqVVmOxQpPzdbRv XiUrqrDcchepRlqBJN46qrysuuU8X7WosmXJn7BcfoIVNWbr93RVza1p7Yo6WV1raZVXVbLKS+VM LahnVatXFbFRJWWNwbe5aFGBTDkaZ2VNK8rPthUyuaysTOgpJ8OVLbCUdysu09kcC/N0TogYcBUJ FEsrWu18aTXK+1tZpdCyllfSc9VDK0z5HIqyCqywzlQrsgKrYrm2y8ptrHkl1ZPTnGsuqm0rlmh8 aTRFgqe99uAe+x5gwz58xxq0XmIPzSu2bYSH3uJvK0yJuOtArooKi6za4lxbkS+cNJYAU1GVv/X3 sgIJjA2yhbulVr1AeVD5chPUk5BQcakV5c5VLopwWqWptShqa3tZY8ux6rZomWrrLayr3AhViM4q UhSTcCu8chZ65SoqodS4o1X8vIZVkNmoqLLoyjrgNAikwmlN4XTlEjm6q6j4ov6uwd9YE/V3hRV6 Lq1ilf6uwHldIv+FedNtxSpVgSiuZn2Lelkd7YOVwmGO8JW1WCWEGmufiF7Vq1vPjlHE3t777K0g CQk1+arvJ22vkvxeK7PXzLNaGw9JBV2kjsEqF/PgQ37v3fdCzDsfIx8xHxJVdimvvo2iFiCMfGQQ Kv/IyA+guixEhR8+bEq1E1+/nQh6/FxqpL1GIhwwjSpiSiwY7SGEEEGYiucqkHkMoSFjm9+Mf9xx x9kQxUyT5QycEDWIIePxNwQUAuJwgRju87FB1Di3BAIGUQ3F8zTHqRqfNhBJ2qek30p6Loem2lPa A8JHvgKEhmJpwOjEyw9nIkeELO59lc3K+28prh1G8bFCHT0j/iUxaIgkGdcQMApDUhLlQNXPgZhR SoMClbQh8Q8C/qIStjgbhTbgF6bN2MBLpWPWqvqI6gEXeXm1bfas2aHU/ZnKVAU3tOE0Pe6ROMm4 MHzmD8MGN7Vq17JXXn3FBu83OODIizbC8CDwMH2iOMDTxEkTAwMD3oayubIuvMdaM9abilkPpxLq P5jMT8N/CsyLdYAhwBhgvMALkYeov/LKK3aEso7BJVWXz1QuxAcKV4RpwiB4l0rCHg5N1jjjsXe8 cCP3YNL8zRy8sOKnn36idtXDGkyYML5kbyxdtjTsG88N4cPMlCeztg8w/pxIqO9WDLWRVX6yZrPa 2EGFg+1H+9C+y/rGWszpaAeu3NuG28f2bbb+ntfBBhftZot/qG35X3S0Fa2X2W771bQtJc1XqSgh xcbakOIhljuvth295Ahr2qS5PaFwT9Z9y85bWXH95fbaymdEjbNs7zl7WQsru9QJk1mStUj9v2CF q4pstxl7qNJwXRtiz1th8QrbfbbIbRP9XfyciHOR7blAOTEiZnOfb2LLViyymf3n2sGNelk1/VeQ tdg+WfG2TSueYlvM6GFdVgwWMVxhuyiHZ+89ZXJr1sEOemi8PVZ1hGXNyLL9lg6W5lF2zFaWP2fE iq/t+8rfWIM5LezIwoNttH1vQ7M+s4bzWtqhy/a3UcU/2BfZn1uj+S3t4MJBtuS7mrbwo/a2uFmB 7TG4inW1bcQ6qtk0+8FeL37DKi6sbPVmH22NejRStFYFu1e5Itv02saqNa9sz3/6uPZ9se02Z6C1 tuQ8oUzQL5MG8d6qV2xJhaW204z+1nmLNvZ+8UtWULzYBsza3TpXbK2/X7ZFFRZZ/7l7WMsluTbv FUXeLVQGf9/ZdlyT7mKs1bWkRfZF0Xs2dtVY6zpra2s8t5++6R/Dd1y9SnWFFxfZd6s+s9GVR1qz Oe2s9VId3buuV0QgKhfzgDjwgcMsINRszD2kOUAYIDQQDYgukiDSPpI+0uUzzzwTpEA+PAgyRApi xIcMM4gzD4hOMMGI2EBwFolwkJGNtIj0z7h8wHzQxP4zLkSO+/RLfScIDsQHWCibsUBSLWUxGB/J F+LPPCD8MDkYCTBDULySK0SNeU0Sg0LyZfye2/QMhKdq1SqB2CDVe38QNfqEkELUIdzAhJaGxlM9 R2WoBSuJcGgSwM9YwAuBYqwPFdPerFmLwFTcxPKSksOQjqnJRRvwBbNgzow1X2YPyuG/JaZCeKcX /YMBwURYH5gsiXbgr3btZkFzoB+IOO/TL8QZvEFsWUevv+Ua1/hx4y03Jzf0hWTuzBg8+9qPEw4b ak5oEq7ZESbK2MyvtrTWkSNHBBywhxqJsTRu1DiM61oj+4b1Af8wc9YGbYB3yJBnzWAWLwpv4Bgc 8D5ChWuUrDN7gbWHibIPYeqsFwyekvM11DaYVeU4RgLmGW2aN28RtA2Y0VIlsLFG9Me8OU4g6Wz7 df0WeX/qZJUQabzSdum/ky0vWG5fjxlmxbVXWKedFTIq5/JPE7+3oprLreOA1tIusuzLMUOtccVO tu1ug5T8NclenjzEZtR+zC5cfKHlF0or276xVauiI2arzLTd+u9uJ550otVvUN/+euVfbf7COdZx 59bhG5xVdbLmu2bNtkxzIFpr0owJ1mXX9la7bg1brL5GjpttzbZtECTiedWmyNE72xr3qG9Vqiki K2eKzfxhoe3T4xirVCT/wJzpdunii223nD2sy4wtrGrLitZxq1ZWJXulzclXNNbo4WH92nbsbIvn LLST6kvoaajq2Nn63hdNN+lYZUbv7BmzbWXectvl2H7CaaH9MOkbW15tiXXsD04r2ojpirjS3x36 tbJqlXLsu2nDLK+olR27+242R5FZ70/40kbUe9wuLrrICpbnW/PtqKBdxaZWGGtt83ayli1ahtp1 55/3R5u/bI612bF5oAfzqnAkQ8dSE4Tjk5g4fbzgaGm169WyZfMX2I+jpEV3r2uNsvJsUdWZNmq8 NIiuNa1Jbl1bnDXThv+4wvbY8nDLKtKplsrK/9vCa6x7za1tp+k7WaVGq6xju1YK0y20pSuXqHRJ gyBc7jto3yAIZjdeFc5+X7pA4d2LpoofqzJBOa9yMQ+IzfnKbERa4weiyW8I7klKsIFQQzQh7EjV XpocDgiB5kPdT/Vl+PAxZ6CdJH2IbofuoP4ZA8Lm2cEwIZcC3S8CYWI8zhaB2WCy6i8TGoSbdyBa ZCDzG6IFEYLQ0MbLeNAvjAyCB3GBWDAXYPHkONoQLQLMbHak4++++z4QFeYGfmB6ED33nzQWbBxh ybiVpKlQAA4NAoLGBRHGvMe5JxA6cAlDRjNjzhBozD5kV1O7CQYGjLTpqyQtYIZ47rHHQBumNk3V BlgguhA9Nna1qtXCPGEIaAIQe4gp7WHgzijQQAYoKcmP9qW2TtAcNJ9VK1OlzDG7wUy4zzqzjs5A wT19p6T3CWEtYO5oEswzZZKbGGpEkZQHjKwlzI11hvmyZmiRlGDxI4rpkz0DQUezgKkx7jBppszB /V70B3wFcq6CN9aHdWQvsI6Mg7YzRXkIPcTQWVdMZsAFftkrMC7my1qDR9oxb+5nKutSzm/QFq0o kP25k7Su4dLae9rXYuidu3WR2XO8zhVXrP6CaSKyMmn++JNVldlqyWKZRZu1tg8+HGI7bruTFRWu sjbF7W2FHN+NOzSwqV9OUjJYC1tZcYXOqt/TrrjiioAn+h76+VCbMHSiNPpGVqteTe21RUEDLcu1 XGaZ3AYK+5VZZUnBEmvQqIFNHD/RttpiK/vu++9kcsNcvCz8/dVXX4pwyUS0tLotWbnIpkycokPi etu8ucpRyWljy7OWWr1GdYOgtkX/rWzugjkql1HdRs8bLa1TBqoGedatY1378uvvrcfe+9ripXLq rsO1cGm+bdGzi40cMdI6d03tvfadtbfEqNFwZuZPE8672E8/qEionMmcVtqyeVtFPH1gvbbspVIr hdawuLHMXiusbqvaNuaLFcrfaKqw42pBW0cgo0rD3nvvaZO1j2b8MCt8W21a5IXvt7TqEtFpIIhX ryOc5jYKwlo7Rb8hIPVUoiUWl6r1ZdlZMjfseZhAvQ46CkGOliJpej8M/95267e7Fcxdap1qdpQn Y5E1bdXEhis8t8euPW2OcMo+5zv5ctiX4RusIab/5bCv5FrYUea4NY+3XiuKI8mv5WIe0SxhPiov sQHTcJu2A8Ezz8qN1lmKMotMEhyEOVqYz6vT0nd8HAiElziHEEEsQbg7WyECXnYbZsA7/E2fPIOI eplwNoVL+/QBUcIkQhsWG4KH5OaF+dgse+6ZasPlJdvRUrgHc8KkBENpQUarLnfIsqBI2vxAOHmX 9u44pw/aARvaA/9mru7PAC7gow0/wHWYiuW5w9+d/dynnTvZYeTAwH3G9oOuaAdOuEffXn8KuPbU WdfMxx30mNncUc/7/hw40Lxo4/MDDuYSNK/0OS6BCeuH++7I5jn45W8YE+3doU6/HugAbNxnfNbB gzH8LI5wnGwoUKvgBiXEMQYw8DfHIPO+j0sfjEPfXrPKHe704weO0d4rKK8tcq+4LPH96Y+EENrq NarL76SwWQrloj0pz6FAYaBbbrmVmIoqAWdVkP1ajlzNJatSZZs3Z0EwI3btPM+a1WgqmVzzU8TU ygpF1qlLJx2wNEOmw7qBUeKT4xubq+RDnCA5SjDDPr5iuUqYyPyyLhdjNGveVFrEvOC3qIRWMEda bK3alqdzyqfqYKdquVXDGtN/JSWWjB8/Tgl5s7TXllmfin0DrN8XfWfNWjQN6zBl0mTroPXk+Opq 0sqHDf1MJrYONrkwV2kXtW2p/DW51VNJcWW9gBN/BHteYSJhLxSKIeQvzLfOXTrbaBFobtdUjsSS pUsCnPPnLbDxY8db6xatpQU3so7WQTkTq+Sv0Z7cakubOmVqmOd7778XBNQjjzxSgmIDGzl2lAQM mYW0d5dKe3WhtqywFq1cIYtBs7AmReBUwuW8BXMlaNYMa5ifP05rVj1YXXhHu9QmjFPF8JkzbFnR Mtuu0rYBpyNWjrD6jeob1aNZ/yaNmwRrD4IYe75ipVS4do0aOappRRDTWqLWMkwALxlXuZhHWZHy W73HYkHQuKIRW6hpfDz4KjpzPkDkOYQgZS5pVGLicKLtcCNlIu1GS3u7RAGRweTjTvZ4pBhEENMK ki+MI1oOnv6x91NVl2doKt4v73O5iYkNA/HyCymYMZGU2RRIwdFaTGg6aAxuuqM92k4UPhgIEj2/ XRMImyFdOhvJx8tZwFSd0fEO80LzQYCAwDpsUfs/JiNMQxB1iFZ0bP6NRuhMIl4nCjwhcaH1efmV aI0uiA1SJOP6oV/A5XgDdnALXqtVVyQJa65sZ7+mSaObmi7ZHq+theaE9sYFTv2QKG8LsUbDy1KI Zvt2pdcOW5e9X6tKnn3xyTBrs3ULEaIR1rBWI/vuox9tbpHKdHwtc1XzTjZK0TcLimfrjI7K1rRF Y8tfOt0OOfBwmztBJs7GH9rTFZ62i3IvstkjF9jc4hlKpZBDXFoiFxpi586dJHCl+q0polFQuDDg yfFWFngx2yydVWgTF062yrUq2fxZ+ZYjB/yXn39hOXVT0W61s+vaR+98rLBgSdTLc6xSjSXWumNL 61S4hWphqVL0Vp/aAP23RYVuqgr8jlWoIeFK2kq9OvWC9rsYoilN4NERRXbLFzl2SBN9n1Nlbmyh ZLZ1uGpXz7MP3/3Y2nZraaPGjVRNp8Y26qsxyl6fqsjkJda+WUcbMWy0zSmcoRyYytLMmtq8wml2 0P6H2txJs+3LBl/YYxUes4tqX2T54xbblCUTxJgVXSVhC+YO3oIQKua7dKYYekUl8VVYEr67dal9 hgWiUHk3I+aPsqp5lYM2nJdVzz79YKhVq1MllBBpWKOJvf/2h3Km64yhxTKT16kkDaOhtWvZ0UaP HGVft//attJ//bIHqITLG7YyZ7ktnrbUtuq6VfD3oskjhM+eNscWTl9s9RrLlK/8j1Zikr/k2iSY RyYEQPgfUqGzQw85JPEViAFmFYigS5TRFzHf4KC+9NJL1yhgyIeCw9qJXJx5wLheVoE7pD6IYLwK Kx80DnE3c8UBxK8BcznllFMSYcdHwcef9BzmwdgwRsw5cSIJU0QFhrAjmcXr2wwbNiwVgSVp3Q9P ciBgJKjXMIikMvcQV2CH4EOI41olUj7EHxjQRONnbqBtfCUiQsVXmGq8NhkEhj4Yg1Mm44UluU// rEu8vhd4oT0OavAfx4sHLqBVUFAzTgRg2Djm8Tvhyymt8OS6fJQNG4gZjFxmT332grWs3NH6nDbA pn011xZOkc1fuR2dd9jCpgybY2MnTrX2WV1sK5l5HvvhZhv6/qeW02q59Wu1v2KZ2qrWUg2ruaKO faEs55or61qDjs1EPHWImcKf3xfcNWrUtHqKdPrk46FWpaia7bBvm9IjxmKTgFA2rdXCnnziKSsu WmW79tndGnVsYJ+/86XNGV9gPfu2tkadZGN/43NpHYXWvY/ORNl2pj325KNWQc7kLfq0tV1ydrNW uOnzGlrBmEKbvUzHM9fdxhocpiCJikX2iASHxyfXs2GFen+hTFjzxtjKOttY4z1/PsisLLhtIB9P oSqlPDX0eWta3Nr6/GGAzftpkfwHOlJ4ZJ51PlumsuGf2sTh8usVt7Otevew5yb9zz577xOr3KTA dm97iNzeTa12pdpWo7iOjf/iY6u+oob1a97Geu/VyN54/Y3gjyTgpaGisz5563OrpCCE7rv0KbPJ KsxDQnzzeq3tkfseDdrmgG67WvverezzIV8pY32BSqn3tHb92ttHrwyVJr5YpVp6WsO+q+z+J+4K 0VjtejW0/jX6m6rNqVpuXeUCrbQp+TL/VtvC8vara9WbVw0CIled2jLTT6lgo+eMtRYyczYbqNIr v+DapJkHEjrSKZJCUmlxIp4eeeQRO+igg9YgoJgrPNyVsFUcpPELpgNHT5I0PEcBdTGJyKAxXHjh RRnP+4BIu08mPi7EjT7RKpLO1IAZYCrE9p+UO0N/forgmn2vCm1hHpjD4io42gn2c2zVccIf7QvG DA7iBBzYXCtKql4Lk50two7pKqmcPHNnLVmfJPMA7aNRUVGYgslLN/yMdcyE8efAnCm3CHg8SMA1 3V/w7ZU0La600vo272ddF/S06hpjZdZK69W4r3WYtpWkUZmY9Hy7xjtYu6lb6HktU+FZa9kn1xa3 /0paRF3rkNVRobrNVeFE9aUadlDlWeVErKiso2jzbNyUsWGtYcQFS8RimrS3/WseYcVLFKKcowhB mTEwg5TtKhaBqm/71TnECucqyKNmrkxUlWzfvINtxRylCxCmnVPB9qt7iK3Q80ZV69nCPAWo7K9Q 9FVTrX6NLa3/il2V2a78pKpFtnvjvUTsVqgEu6LYFCk0u1I9e35VPxu1arZd1KHAdp7YxarO38ly FFwhPapsIPpbMvP1UsJiu+ldraoiIa1SsXVvqDDh0e2tcp0chTgX29aNtrGW45QuUFmnLgp3LXop iqnFx5pDNWtVuZXtILNVVcUxtarf2g6seYySKbN17EiOak39GAJ/2OOqUmhN6ze3A/KOsKKFFa0e JkFFmhHWW9ards3aNqj+QbZ8ZrHVlZWgSk4l26vuAQr719+1a1jlatm2b72DbNn0VcJhPYUUK31g cKHNKppgDWq0tN5FfUO15FWqxbhzk90VWLTcqtZR5dyKqyd+Yvrs03iAbTV/G6ssM2kxG+kXXGWf 4S8YZEM1xVEMY4DgJZVV54OiBHdSJVaICLb/vfbaK0jZ8QsiSKx/JgKKVLubDpTJVKEW4lMaAUJb gbklnRsBcUOjoH00gdFhROpGKgfGJH8S0jqRX+7wX31uFYI2grSSifHQHk0tye7PvHF0Y/ZK0kwY C7yiUSQdlEU7nHz4IJKYbtctutq999wbNLqkUFnGzMSwGTOYs2Ry83L30bkzHqdKMq+ktcFMwRkt SaXk4/sDclxWdwKh3gVymi+rslxmChGj7Ma2pGi+Lam0OBTia6K/FxfOt6VZS6RFyIyRVdcU+WqV CmtYpQXV7JMaHyu0d4JdapcoKGOJaNxS+RIKrJnVEFGpYt8ogKJ7j57WtHFTG/3NFFuWvVyROIVW Z2V2mXM8UvOrYIuXLbIlyolYKj9AnQoyq4j9LK6w2JbIgZtXQcmqxXKmy3yzZFWh1atQ04qVaV28 rIpgzbWlyl+5od4/lCS4jfVfuZstkiMd8xbmoEeHFdkFL0+2Rtkr7IlD6lk7EcIpC2TSUumOlSvm SxMVA1iHa9Fi5TQtUzi/ck+WC5etxCCWFAkuOeqXrNDRztnKrypaEHC1VL6QJlnNbMViJYsWqjJA oU4Zzf3K7rBH7WK7UDgVPtVu2cqF1qiScoAUiPHTt8PtQNEWGO/sBQocqSScas41i+RLrVC2REaf DjhdqjDdJQpwqClmpQQd4VenFRYrwIZkGVPBSOFYuf1Wa5VMgStVp2ypcoCWyyck/N9R77/S5lra fisP0D5aKFiLFNCDcLX6kQeEwxesyLdllQu1n3QgmrJY1vWiYKS789YL80DSwYkMcchEuP18aj5U bM0QpF9SHhhzCVJ4lNjSJ1qBR8/EEYUk6lFCwBu9eIZ2QFvMFJg84s8hksw1/oz3gAMCh4QcnLfr eEHo3PGPtBuXsv2AKvAYHx+iT0ABbRgbU1Acdgghc0M7iV9oBMDvEWrx5xB4GABms6QLnOMwT4KN 9yHgmZ7xnL4z4RXV4aijjgp7JQnvCASOt6TnEH5gS+qfObsggVky3t6fw7B9/ybNH+1m8fIim79U TChTriD19kQXlml9/vrXS+yTFz+1f+1yrzVu2dxuffAWe+uZV+y63ndao5Yt7J93XW9vv/C63dD3 Tmvcurndd9+99ti7j9neN8uw0qCF1VFC2xbK13jqiefspmuusz9t+Tfr0aqPLSRIoUEzO/SYE+3l 55+166+/zoZ9rdMJu15oB2xxtBVV13eqUGAIfKmXYKUixXff/mBn/fEk2zZrR/tjn8ttmqLArrji TOu2cAc7Z4eLbfys8XbFnWfa1sv62jnbX2yzCmfZVUfdaJW2Gmf9/9jcqi9rZJ2tgWXNq2WnX3qK FY1YZpftfrPdPD3f7nxklO3fKceObL7YPn72NfurzKqrZlSyG3e+y6o3rSGznNhxulxUEqykH+D2 XLZkuT10/z323HNP2ZwpC+yf/e629h262gNPP2APPXyXXd3zNuvUcSu778l77NHH77W/b3Obdem6 tT31/NN2+3MP2sAb6lq7Dh2tlkxZ3ayOvfX6e3bt5VfZ6R0usJ3a7GWLJc3367OzbbvdAPvo/Xft sUcvso8++dAOaHakndLzfFuRu8IWCqfK9ExVMM5wQYAV5W8vPveCXX/D1cJLd/vLjjfYgsJ8u/DK Y63xpNZ2cZ+rbc6SOfaHi0+0JtPa2KV9r7VF2YvtH6feZPMafG57XNHCqi1vaG1WyWS5rKqdf+X5 Nvzd0XbDzv+1SnnKpVmlKg1K3pQLyUaNGW9XXfVnGzl0lN3Y7y4lYSriUscBi1crgvJnIFXcIZgk v3l7pnw/S2y7wU0tr4mEAuFe/nZFvYmhKwET+MvFPLAXk3yHeQDzAjZmpDaICh8VHyDnUCO9IsV6 CCqOVj5aJGrs+UiX7uCEIMQvPlJCVUOGuQh1NMMch3KIIEgTOYg/TChJUl9Hur359Y0YAx5tBWNb W8TT+pgGY7LH0F4yCTtEMM1fuMxWKMM7lLZKsLjwkVII91/X32S33HiL7bf7UZa7c30blzfZbjv+ P9az9fZWY+cGNrrmBPvfcXdYzzbbW+6A+jaj1Rz731H/1cdf0zpXPdTaLNvDWldXFvzEeTboSmW9 F+t89l5Nbfk2ioLsXNN+mDLPLv3DmfbSs48roqu2vqPuVn+b1rZs54pWqWMtmzFfJt21WITk01Vh RpXruOrv9r0K9R1yxmlWYb8ce+rFZ+yDNz+1fc883or3rWqPPfGoffzO5zb4nJOs0uDqOofidXtb lXf/MOhY67xkL2teYRf5F6raPY/ea08//qAdOOjPds6yufZu8Sw7b/ua1mjmUDv39L/LmTvN6iks dmCfwbZqBwVm9FQeVZaI4YLMSfuyhIUaXZeed5Y98eDdVrdhE+vTc4BV71PXprWZYzeddJM1qt7E 8vo1tikt59otJ95sjXOaWa1+DW3+lkvt9tNuF72voJDX/a1dwc7WskoXazun2A6+aleFES+yBr2E s22E263z7PvJ88RQLrXHH7g78Ictu/WwZtt0sqV7KK6rcy2bWQacEuj0xhsf29GiezVkttrroC0t a1CuvfLxY/bKM2/aVSfdEv5+ccg99vpzb9qVJ+vvfXPsw5Fv2nPC+wl/O9g6Ld/HmsxoZa3q9LDn X37Fbrvjdjtu3zOtuI9MUltVt3zhWgFvNlxh0scdeIAN/+EbGzzwKMvaQabRbXSKYDWZPuevjtNs MeBJ3y60+QoHrtautk2eJWYhBQXmocM/JTAWiYGsUJCBwrDL84HBAHDIEu6JlItj1ENN31BJ4aOO OjqYNdAEPlckBt5+ktn4m2MPkUwhAkh2fIzkNCBdx8NvQ26Cvj6YDhoMNnhs7TAk+sREgXnBwzyr pOtCEV1FW35gal5zizGjNZqYu9dJ4r2ytPEQXxhavE20dhU48rpO0TYeYrs22Mo6zooijrtM1ZxK auPJj0k48CRCr9WVaT7gif5DbSsSCUU8vU18Po4Xxi1pE4PN20RhYx2ibRw2LzXjdbWia8Y9D0mO rrMnCsbHicLmdcviOEgaJ1rrzDXpMn03UJYk6VP3CACbOW22CNB9dvYfL7WL/6aTAisX27QvVDJF CXVnX32pdd2xnn370ndWu1ot+/s9t1vTjo1s7MixqmG4ws49+x+2S/OdLV8Ks/IGbdTocbZcWsy/ H37attiuu9ZJayZzy3knn2AfvPumXfCXq22/gw5VfoeillSMkZP9Kko6VtJxqjy6Xw5v5J6sajZ/ zlwbO0pVcf9xox11xnEqpa6Dpu6dIRPjbnbUdUeG1uOuHm5HHXeKHXnd0TJFFdv852fadr37qPLu bTrkihIjgkmM6qcvP7YGvQ+1T3sdYQvnTrGb+zaw7Onf2vl/udBatO5ot13zL9tuh510wFQj1Y5S LTJJ0MUiXhkFeT3gaPSnH3/Wnnn0QbvwimvtsKOPs9p5jSwrt9gmjJ1kyxcutdOvudB6HtjCXv/s G1u1tMiuffg2a7tda5WrmWfLZeY658LLbVDHg23elEVWNO8nm7QilXx73a1327YDe1MM2OZqzU48 9AD7+otP7eiTTlfxwWOtdfutLKuqvo1MOI1tFlBbQRrp4/ffoRDgre32Rx63eg2ayDcjS8DLM6xH t+3txJtOpwq7jb1rpA3a7zA75eazraL2x8Iv5ygDfUu74Lg7tYxZtqhI5ZuE08+HfqI8mh3tyvv/ qex+jYDmo7VVjUi7+dqrbfbM6fbEK+/a9n372zIJAhXAKfUwQWp0/fVs8bzl1kJJiY07yEQnhl0k 7SW8E9kb1NEsN/PAeYjkTwQKpg/s/5h5yBrGzh8SXhStw7OZikfeShoKx1LSjo+RUE4S9niHUhq8 H2ceEEMvFwL+3b4Pw0hliy8IEUW8h2mGk8EI4aR2EUwHJoVzFLhw0kI8eB9HF+aNkBEqxzDOL8an DdqUt+EZBBAzDvc82c5DZGnD+5jHeI4JbO68uSEW29vwG0JFG57D9GjjJUu450yU/oGN34yLKQ7Y 0bIwAdIG5gm8tAH+Bg1TbTyhDVMSbRiH+YMr2nsb8IgjHnjBBXgDl9Fx0CBpH22DGY02xL8vi7Qh oo01jbZBM3WHf2gjExqRTGiGmABpg7+FfeCw0Qaij7Pe2zhs3gaTE20ctjXaNJFvYKHs74IP7dfH geDTBlxDDPibYAPG4T3mj2Di43gVAx+HNh6E4LCtLZYf+3L42BIYCB8sh8+NHvl9CCM+9Njjghlg WX4Fa9W8lZLvGtldt95knTrcau+//rLl1VXFVv2o4rpKkzcQ7urat19+brsO3FklJ1IEoKBgsVXV /sgTwVTxI5WjMLvp+lvs3bdfs9sffNIOPGy/UHlb/CSYMkwEpsSdGqHKRGvzEyqKo5GkicZK7UeO ZK0p57VM+4H49erV1y578ix77cW3rJVKe4/4/gfbedc9U0RpZQWFM3exl1QKfMqU6dZIayMfuUq6 r7BJTXe28cU51mvZTLta2lWLuiqyqLLiPbfvZ/+77xFr0CRP76XPtRKR45iS0i5wxztvv/qi7b3f wXbxFRcrkVKKCNbiRYoQExNq27GT3fu/W0Rgt7P3VVonRxUSGjRqIj9HBatVTacZyh/0zbChdvBR cv7LPgZhJHEwS7aausrlkH89ZKr/8bQTbcQPX9s9jz9n+xywr/wxqYrmSOYGrHEmnAB4JST4/EIx tXF24BHHW9s2TbQvtSd0rsd2wukDt99mzzzymPXtt5N99dlQG3TQwfKjaN1U+6pNmw42XzR1gqLG OnXtFHxO0AEisWC2lStXNCXEh9MANEUbPWKMvfHS83bxX6+V/7a/zcT6rrVZDaer4TdVMHbF0lX6 EcPX7yz1GZgMPzTUH+U2W/FxUQuJaBUIEMSOf/MxH3HEkeHDhEDygwYCYeLD7SpiHE3E4jmSIzWb kkJl3SZPW0xdXqCP+14plrVxjWKRiAAVTSEEECKIOoTBo3NgHrTlHsQLog5B4563gUB7G8bzNjyH oLs/x9tAVIAlOk7RilSFW/qG6CLd8tzbQLxgitFxPMqHexBQxo3CBtGkjd/DlxESILWYtPHILH/u JTa8NIfjwKOVaAMDZRzm5r4nxgC+6HzAccAbx5ZSSRQNMt2G3zAo2kRhY00c14xDmyhsrA1rxL3U 5leiFgcWpdeHPQX+o7B5cmGBksZ4z9uAO+BtUJRqEx8H+B3/tAn1ucSIuEdbnw9wcI996TjwcVwr C+MIttKpWepDK/ng4sRPf0OTZ82YGYhYTk4dU2VvOTl16FNeTTv5rPPtvFOPtq+GfaEEunH2l6tv 0l7WfpGLKU/RNz23623PPv6oHXvyWRIoRCF0zZ8n5itbWGotzMaPmWz33fEfO+2cP9qBh+xnyuOT UBOpvJ2gbXB4XaHE2Pnz8vUN14HGlDCRatVqWmVVKJgxTYUDRZggzrvuuY898/jDdsKhgwV3Hauu DvrtLL8AyeCa4zbb76T3FtkLTz1ml112vo6lXW5/e3eyvTUzz3ZrMs8u3KmtdVTC3n333WX5EgTv ffJWlVHJszmpVJuUQFyGHEYIGUQ8X6WHum6lskGCD1zRlPs1a1Wx08+50E456gAd39tLWeYT7Mzz L1WFA5X/EJOqVbtSkMgfvOe/duq5l1o95QcVL65kC+aqxIkCFKqq1Aua4h333m0fvfuWGIeY1KDd bNYIaYG1VelCOR6BsJYB1vAtcSQ62rsWaoUOpdKnEe4pJ9R679jfdt59LzvnpKOtcdMW4Tjh3QYO tuVobprLllttF/KMnn7sYfubfCWEtBfpGybBsZZomgK9Ukxf8HDA4/tDXrM6Ehb32HuQDhGLaBFJ sLJnxf3qtci1UZ/OtuHvzbL2O9SzpjJ/6liTNPNI/y6vzwMpGB8EV/RcZ3ficj8aZgnx93f9o0Nr 8SvTOeN8wGRy+oV241f0HGx3aiPhQtzp27UUNBEICsTVTSBE87hZCaYHASGZht/80I9rKW4uo42X QofRwRB20hnSXn8LCZbnUUc3Zj0IE/fx//Dbx4G4onVB6Pw8cGBiHDeteVY6Gpqb1JCO6RMYIbYQ w5123ClkHnufvEs/wOZ1ohw28Mc4lOHgHu+AA94jHDmVhZ0VTIPxNjul8QaDcdMQ60MftGOdgY1I LvAGgwNHXjPLM+/79+8f3k9Vzm2ucZaX5HPQF2VZeAacvmaME5ilKDLOfpgKQorPJ4yjDxEYUlVk F4WIMw9JZr8wH/aGw8Z+4p4HCPAusDneyHHhuUdmeYCFm7pKNmOmf6QZSGAikcv/LpRBuoIO8eGH e0GDENHb78BDw/Gmj95/t4jUIXbEsacFYg3xRyPAAf7Uo/fb3bfdbJf97bLgyBwjLaa+Kh7XrEWQ itlrL70gPGTZcaeeF47A0NSCtFgCSgQmxiWadYwSLK/585/k1/jSDjriWPvDRVeKUFFSX5qMGEMd lUOfOnlK6AM4cpQNfu2/7rAbrrnMJimL/Fy930yZ0hBkxmresontf9Dh9vB//m5Ne+xi90ysYyNH qS7ae9fY7qceppwFBU7IEf7Wqy/YnvsepMz4trJU/IyoAOJatA5eQcrGL9NYRSDHjh4RcMVhhaHg g9oT19FP+/2m/wln/73F+u+6l5169kXaYynmgja2nxIu77v93/bv6/9mN1x/vVWuXdPGqux5rdp1 1G9DWTMK7P47/2NHnnCaDRTjmD1d3/U8JSCrPlwSTkvbG8CVWyPLWuob++zjdwTLaQF+fcKWVT1b psFb9Lym/fjdN3aqmF5n4Uk8OIxTt34NO/SoE+zfYhyDDjjYtm/bwubKJjh54jgbtP/+Ae/6TML8 FVRmwz79zLbeppdOHqxrc0d/r9L8qveuKLlMeMVEldesurXsJsY6Z7mc5TmhH9+f0eUol9lqrR/N b/wCH3VS2Cdmn4kyTcDlPVHGQYMIYTpDKnYzVNwBipSJ2c1LdUenBYHBFwNB89pX0ecQdZIMkZYZ O27mgLBiroOoJYV+osW5uSo+PpIxJjPmB+GLh+NizsOsxXzAS1IeCqYuCLMz9ijsk1Vsj/pCENP4 2NzDnEOdLJLP4mHOXpiSHBkYd9K6gDfPAUnhJSU9pwjByoAX2sUTFP05da3AW1LfzGuJGAuMmTOm 4xfrCe5gjnG8sCYeYYUQEA8FxjfnprKo8JJxu7uqHyeAmJowK2gdC1WyY5W+WMJ6kfqwq2NuOeyo 422fwUeEwptIkmgloApzzhZbdrFTzrzAbr7+ShG2JtZ3p972iqKFBooA16hRSRJssb375kvSDAap lEh9y1dVkiBoJhFi3SNKab7E0gvOOEHlOUYq2qiz3XHrDaqY29yOP/U0k6Kn0hZI6HmSxucGeIAX SbmBTta77pZ7Qq23atWkGRO0qD4x3yg9RedInGHP/DDfznhouM7jlsYx/2X7bMFI21oJhlV0DO2E cSqeOGOaHX3CqYE5pqTydSMg4Rwrjdmn3y529WUX2LgxY62NvjlnYsALrHsNOsD67bJPquKA2iia NYy1VDht1aaZnXPBn+2yi862ZsrEH6wQ/mcee0CRWN2tccNq9szTb4az0I849qTAbCigWQH7U6Y1 LmUKwMt67CqN4tzTjrLXX35djGBgMH8Bc25unl113X+0D5ariKrqbsE40vYwGOMRx55or77wjJ11 4hHShh4MdGjcqOHWveeNwdfF3HBuF+QvFtObYvsdfHjK4rR4nvxH6cEzMGWYBGbJdj1Uuh8zIz41 94v5XNNz2ySYR6Z1gpBQjnofZYHGmQdEHyIFA8FP4CW5o31RwoMsUopAxgudIWGTfc59CHCckEGE qCtDvgbP4+1hDHfddZcdrVr7US3MxyeyjCi1pCg0GB/l3GESxxyj5KXYBXEkA505oenEiSTM8p13 3glMCw0mfi4FFX2x90Ig6SPK+MAbeGFsEgDjzAOGS4QcTAbiGE/04z4Z7JSHz66spLY2qexXv2C6 ZL+jPQwePLikLpo/pwoxBJwfNIs4XsHZKMF3iKoKtJeGEr1gtuAV/CUxVbQV8MZz8n/izAOmRf+Y rQ477LDSs7Nd64CuxTUP3cME0aZdZxUKnKPyHp/aIUcO1uFCqftIw4v0wWZncVjYzwcRBulPbSEg p/0BIjnSLjjrRPk6dC5FzTwbfNBhYSyK/03WeeLHnfyHQOjX5jOQHCATl4jQyJ/swadfsR2Vbf3H 8/5kLz77hOBS5BRisfrFHFu1mqRWaKZ+uFQWKkjNWVkq2BiJCK+p12bOK7J/f6uEzj460Oi9/9nY 5+630WKWh594lrXXCYZI4MCJP6V1u05hrmXVNlZbWPxFIuh9+u0W/D7PP/mwXfLXKwIhdtxDM/k7 m+AScJz257hpEY3vqBNOkeYy0q658hL7141/Dzkwl8t5zzvfUThU1bhbtekSGHiQeUTRM5om18L/ WEPMU3123MVOPfoA+/yTc+Xj2M169RkQ1gtpPztb5WCE0+j+YZ6Yp6779x120hH728ABvbXGKn8/ 6GDbqnvPlJ9HsMHsF6jKdoFqeaGRwZg5wL4EvxmYB+2KtQEfv/9p27L7Ntqj7YNZbTUz7P8H5hEi miR9QgTiSYJI5fhRKKtMhd94QhrMwcOIqWYbLcoI7iCobqJJkoDdxIIJJ6nCJkSXczfiZeh9z0HA IL5JiXLut/Cotfg+xayExoOknJTo53kKSaGu3MM8MXPmrBAZF9eY6A9G/NHHH4UCc/ELkw6mHhgy zuU40wbvMBjs8252ivbBeF4aJSkJ0H0OzA1GFMdtyPHgawtf9+qXm8JgIn4wWPQNYHN/SVIYrgdT oO2tLcPcCX0SDQnOcUpLtO+o5L1t7YqL/6B1qmq9eu8UCuxJIVSyIMRahD8dERO1/4v+qm5Xtl19 43+seavWcvR+YUedeLq179glaChjR/8gvFSVP6Fr+Lu0C/NGwcKVkn6fC+aQHfvJTKzBtu+zqw39 +ENbpJDjvDq5WtNVKv8927r1lBY9erKtku+jQsfuIVkFwpS2EIXonhpiHN/IzHPZq2Ns9NQ5dnpP VTZu2tdeqqkCinUb2R8uuDxItUjH+FDY43VVOpx75b2YZ6NGebb/wUfLvPRvG3zwUdZR55aHWpAg LxD7lGkoXNHtoX9zH038kiuvk/O8mX30wTuhr22220GZ+So3P2d28ANVzlaiZEjbgkLDVMvg6IBQ o00hqoOotCaZo3Cqv93wH7voDyfbf2/+h36utVNkTrvwsr9p+3Ly6Jp+H0YryFeulCKu7n74ebvt pmvFvCvbHy/5m+BXYVR8E3opaKni5ivkrMhRXPAqOBIcEw2mFM2OyLqCxQvtnv/9004+8xzrsgXF Wn/+nILywf/K6/Mo7wL/1u2Qejmwis2JOSSeA4KvAX9CPMoLOCE0rWV2wdaelGzGOyQBZsowh7gg 9SeV4KAthKi08h5I/e5DgKBHiThz8XMmsP27z8TxC4F3O31S4TsILmYbTDNxnDAWkjV9ZiKQaCp1 9CHhrI9fMAQYBgzXqw5H36F/5saJhPQRvyDaaGsw6yTmgR/ojjsU4qjovaS5MXaSGZFxmBc4x5wY L5vCc2Bzv09SvhA4Q1P0RMRS93OwE0R+Yi/DHCpUqSQJ+Xo77dgD7dhD9rSuW/ZUiOqO1rpte0ni XXTKY1uZnZRcJ0c2Zhe+fYgCBIQK5ZWr5Nr5F18RCB/SPxJxLbmBRo0YLt9HHa2hoolCFFAypBAB CbcyHY1XFdYpds6AK4IEzwAFYrAwIPCAD2Xq1BnhnUPbd9aJhku09goNl0nEVOMLYsh0q+g9fp74 ZqZd+eYYq1NcYH/rnWs76IjZvCa9bY/9jwzwE66LRE0N0BnTp0kLrKU56qREMUpF5pbJzxGfkWtk R8n89fzTj9iF55xo9zzyrEJg60gC/zlyrITUx7Yu9zFjoZkQZHDCaX8M8wbP/K4pLX3UiPzA0Knq ITe6VWzUTa3EAWEIpV0QayY8d5qcxIqGU5AD88TEB6P6333P2nfffG6vvvi0/Fg36pTLdnbMCScp IivdaYKWsHCBWYdOOtb3rkeCpoKG+bNGlMIhZ/ogSOHwL1YkmGUL4aoAEPZDBs2DZ6tkOw0lnbCh +j4GQb6f02Bt0marpAiu6BojnVPmI+nCpLODzCJcEI34BWHDtJHpInhgn332WcuuyvwYxpTpgjmQ JZ3pgjiXZpNHY9lll10Sm0Ms4lpW/EV8EUn+CN6DyUGYk4gzz+mfkveZLvC6vxx/mS6Y2lk6OTDT eQlJZUe8L2CDMXm13vgYMNNMwRu8C9PIpClG+0oLuWs1h2O6aK2jV+965EVJy7eqCuyb9sj9t0vi RHzEn9DUemzb2w4/5hTZ6ncNJi0ky6BU6QdzgixJwWEeTAu6ByGZpBMQcZ5XVU0kTElROkGIMBd9 cR+mM33qxODjokQ6/fEOoZ9o7VkyLRKF9dF770hj1MmU3be1QoihTpMs9k40LjkJBYrUuu6diXbX ZxNsxwZFdlYPlRmRqadKzTqh3yCt6j3JLiGMlHn8qLDXpgqayMkhWq9cfKME9ZhsGjSsLyf+nXbS kfva0QftY1dee7Ntva0ilCRRyy0TtJtgykvK/Bc8irkIzA2NzE2G4LTrlt3sqcfv0xkrI0P5+IUL ZdTKhihn3Ko/P0BBmSPGMVFHVWMf67ClJk9pGMKBiYqqZjsN6CczVj+tS6E99ch9dsAhR2tt8Dtm 7p+26ULYP5vhSjY7ARYprgZDhGdUbNxNv1MmyExXUJKkqgXNm4hJ/e2vx/n6Js08yrCsm1/5HWKg LLWlNoppudRWyse6SLSkadOWdsXfb1To7nwR/nE2aeJo+R9+sB++/dqGvP6SvfHy0wrfvcj+dOnf RHizAqMoscSIPqRpRDDPIL3PmT0jSLRkXeOA9gtJf+lShavrRlUltSEM02aebDuE/FbP0bnpwdeC 07amzJaco5Gt58vtzv/cEOzzLdu1tkXvvB1sF8VbbqeqS5LK5XAfNXuJ/eX1MfbZmBl2UsdKduhW Ta1+4xaWpUq/MAmq48M4Zs9eoDyJ723c2B/t62Gf28vPPWp/v/HuYKorEyEuZWHdpLNjvx3t5tsf sT+eeYwdtPeOiqQ60nbbcz9FLengr7p5OjMkJzAw5grDgQe6lTMwfkyGaabA3yoXpvDoPjJZZdsD d/3Hbrz11kC00UISrKNrQsgaKJy3QteeQsB0dagFFGNnIegf7XCehAIdN2577TvYvlTCH2ayho1U bwvTVYm6lOra/wZnMEHvh2e+1appTajvhSkrJ7d2YJgV1sI4QucBptR/q2iUxD3Sg2xmHhsFldkM xCaHAf/oIh9fiCJKWwICkUoTD0wjCHp5imZqsJ1MV9uLyEC0RNjGjfne7lEI6Z3/+UcgNJcqe1o1 DYNPJH7BCAqXK1dl4SJJyvVTY2Ee030V47XPPhqqxMHLgnZ42VU3W6fOXVLmE3GwLFH2KpKAoRcQ xfYdOgVn/v9uud6++epz+SYm2y13Pq4BxDRU2tvk7K/CEcwy7776wY/21+9kIlleYFdtV9X6d2pu uXWb6KAoFUTUvCjDMn7sRHv84Xvt7Teet5HDfxDoVI/ItcEHHmMD994/mFxKk4jLuj/Aaf58sz32 VMHT598PfoRXXnjCnnniPmljjaXltJKG1cY6dt7SeslE2G3rXioPQoRamnnFCDXjogg2bFDXTjr9 T/JPnalyJD1lVjouREGxRixxqUwkcAgxjK++kaQgMx8RCjHTEa/gL8IHVJHD4KrklDAGnNjUwYJh he2U3lNhD+jfPA9g63/BrKl+FsxbbI8/dGfwX5LYm0piLAMWA2NIIaHYzVZrqB6pG5uZRxnwufmV zRhYdwysqW7gU6EqaSp6BsrOl55iHHz0wSyVjqnnb+5TiuKW2+9S+Gwnu/6aS2wHRePsovwhuSTW lEiD+WqpTFtLFX1Vu0SSl+vPhun42VOP3y9ENi1TxtkNV19ktz/wjMxFqZIznDJXCfuXwIIgdtFR sn0V+nqd3sOZ/89bH5CfqbMIsyhQo1YyU1WRKarY/vnZFPvfh/Ote5UFdvo2eSp62cmqqEw8BBBi B5186tFH7R9/u0ghuVPkxO5mp551oRy+PRS5pLP6OnUJ0VyYiH6tC/ziL+jSVT4BaSDfffOVDf30 Pf18oGCC4fbj91+rUOQjYdy+/Qba2ef/WQEC24ccG/crxWHBRHTE0SfYt199Zhede5JMfVPsxNPO VfZ/btBMwro5cY4zIKf4OgvEWnNmOCFNqRGAFaavdBKbNXuh3X/3fwV3N2khecGkFc6G03NOOPzx +28kTPykYJZp8sWoEq9OLaSjqlIzquoI36pCNqbGpYqv/eqLz3Vs8Zd23b/uE/OuHPZLWS7AqiRu hHl5VVRtjTT2nb2ZeZQFo5vf2YyBdcUAvCHyU0V+g+/e0OFYjarq1D194Cow17yLyrrIegHTCNE+ +hqVSB6uUPJCZhUcoxDg08853z5WBND9d90i+/iugdCHcNPIBc0KzEM/NcQxsNVTuXf+vIV26R9P lxmkqT305DOqjjvc/nzB6SpdMVwZzd3keE+dCgljoSI4v7IrZ8lMdr1t3aOvtRXj2r6PqvQGAlTR atWvbVPnL7er3ptor34z3g5vmG9HNVxmTVr3sOy8BqF0CSYVHP133HarXX35OdKEtrErr/m3iPXu CjXNCc8Zh0ie4K/5Na+g1kmjEjOAgXXX8bY9t+1hJ5x6vvCZb7NmTpZpcJy9N+QNOamfsOMP38uu /ecdCnU+OBDZeGg1oMHcKkk1+Kt8KPT9r+v/Yu+89Yodf8q51m/AHgpOqB2IfAi1JvoMx3NaQwja Xw1xB2l2UscCftAO8MOwPviYxqtUyaUXnGWTJ421f9x0d9A6KKo5QcmXt996nQ1R3s4cTF66YOb4 qCpjewtrvlwCAAm/qcoWaJEtWra1y6+61Q44+JjgmE+aUxLKAwOU5BKiFsPZNj+3LQlLTjfcKJgH ElmQythR5byiZce9Hy9USJdeFgVEEy3E355l7mG8Hn7Lc39GX7TBgeQVfD1T2vMjogX36CPat5cd 8QKMPOPfhLR6McDUgqfu+TndjM892nvBw6Q2noUdHTNaJNHbeOhw0jjxAo6Z2gRpJGSgp85Lj54t Hm/jJWOSiiAynmeOe6FB1p8+gT2Kg7LC5qG1Xio9XgTRiyjG94bjKjoO7zj+M+HNz0ovbbuGyCG/ 9O/lS1bYjNGF1riizrlQ7Y/8/Ln2okp3jJAZBxNRZUU3NVewQ9+d9hBRx3maIlrY5atVq2BHqujg 1Zf/KRAUInKQTKPmkqC9KGYVQpI6iiBFwB994CGVOVHO0wvvKjy4lYhVvZDwN1LMo2//booIbCSi qvNDZLtp3qJ2cFxztWhZXwT3xEDcQ9a2+qe89ycTFtpf351ks5W6fvmWq2wX1aiqraq/WY1bl5jK qBr74nPP2TVXnGdHHHemXXLZ361e/Zqhb04/KCsxKxc5cLwLXvxBIXFRF5pcDQXC1K1XSzkMWyh7 f5AdpyTGa674k11wznFWXwmPO/Tpm2KSCX4GfETVqueKuN9hW/XYzv5941WqAnyY1qKTSojsa9v2 2snaddxSoc11pfnlBqZQcuWmzYhoGroJc8nPX2QTfxprQ954zh6497aQk3HrnU+I2XUPaz9p3Bg7 5bj9dd76DzZgl31tB5UuadO2q9arsUyGlKHJDgoMmmOR7FIhFF2RCdWlrjRU3a6GDeumfDrp6gJl xWUFOJs2E8woSYnyfsrFPIiT5xxqPliyiClAx8fn2cWUWn/33XdDmCphsCTjUc6ExDiIDOGU3373 rXVU3Xxq+4wePSoxNJMPl1wLCAIhmhzKRP4ADlN+E3bpIawkvlGkkZwLkOghp4TZopKDZZgAUVC0 BQ7CSsk4JsLH2xDNQ6YxkVj0GW3jDIXwWLK6yQngIgKHcZwQ0jdhwiTSeeluxiRU1Otc0YZ8Boga IbG057nXWwI2EuEYh5DYhdKpec57fpAU/6Yfr7sVbeN1mmjDHCF28XF4h/59HK/1FR2HdrQnCon5 Mx/GYz6sr9efAg4fx0vzV6+eIxwVhDasB+8yHniF2dOGaso8BzbaMzb7i/cdNubF2Ixbv57GUfFJ 2rDnwCFtgMeT/2Ac7EXWB/zyw95hDPDPPKPrTDuee32wKGyea8M4wAts7Dmi4TJFfLEnUlKaBKL0 v8nSrd1IuJu3wuZNXWZtt6iv2lWv2F8vO1t7rYYKH6pQp+B67cWpdudtN9g5518uc8qlQTyFkOAX 6dZtBxENVZkePkIlZdqlwvUjDIoPHSfnSv1kK/Yfx/fC/OWy+T9p+x1wqLSIrWQ6SkXfVNd3t0D1 sPCfdOjYLUR43XbLtSKo+6k8yfAgAffuu5vtvtegEOFVNZjWiu2h7+fZDe+Pt/lv3mvdcyfbACUr Nmy0p61s2U4fGACk7PNzZs8P0vnAvQ6wa1WgsXhVJVOaSMouvyZtLitd+0XvsQb84MMABnwFXbdU 6LeOgD3uCMF51UX26FNvCT/VU0702Gj8TQ2y7MqV7PgTT7EBOw+0F555zF5/5Rm7+/ab7K7/3RDW sWmz1iE7v169Bqor1TAwnGoyK7FvFsvctDB/jqocTLaJKm44csT3wczYczudkXLh32zH/v0Cs4Pp 33PnLXqmMjVPD1EO0M7ByY9G4pFi7jNzXwfgIkBwH60OnwzaT3yflIZEBB53mAfBlT7DvdTvqAO9 XMwDAnfPPfeEHAhCQjk3mo+bk/Pef//9wDD4TYgrJ/GRxc2HzsfLGdIQovnz5hvZwmSBQ2iTQiwB HqJAZi8E4LPPPgthliwCWczkQfhpemPGjAlMDKLC+SJIj4SzQnCWSGSYopo8wN1H6nc4xF7/kWjm 0j5HzdIvZ1eTZUxyH7kK9EmdKAifV2cFZo6fJdEMAkyGOEQFWIAVogWzBC+U96imnfCjmG1vjQ0e IG6zZ88Rk1pSkktBG/BEH8DMPJg/DBFCyD2eAwOwwNz4DSwpgr4o2DxpA1w8pw3ww+RhiPQDYeQe +OQ57xHS5+MAB8/BH/3ThjUokhf1hx9+DAUsIfKsI/WkXMOACdCfV+odoerKZMc/99wzqqi8laJ/ GuvM9pdszz33DMmDYb4qg4J9demSpYoIyQnjMUfOGF/ksCXMhzEh3Ow58A9hZ14IDsDAWTLHH398 2IPgG2EFnLDWk6dM1ge53A45+JAg4BBSDC4ouQIuYRaOAz4y9gr3wB948Vpn9Fka8wiERx9b9ENf JR9BvRbVbfiHsxXuX1WO1152+70vhoqudRT/v0o2g1kzJ9hTKotxyz8pPdLCjjjmWBX8S0mPNWsh 0dYSYZ+QKmcS1Wx8PIUJURyUKBtF2aqM+mgxjKkyQV0TTGMh6kbkJEvPWVMYQ9OmjezIY063G669 2B598C7tFyJtigXHvXbXAy/aoD13sXHTV9gNn021xz8fY8Xv3WYdC0fa6O9H22OqVnvZ5dcpTPdn mz/lTl57eYiEJ5U8ufTvglVFBkUQg5aEGeQXsYBfpzEwYF6aP5cop9p20WXX2knHDLbPP/1IIbO7 p5Ir49wjPTS+bxXFVXWFFnbuBRfZ0cefoZDjbxU99ol9/92Xqok1wj587w3tHYTY1ML8nKuVOokP raFlq/Z2wEHHSqtQpvlOu8rUWC1oPTxH44Sx7D34MDvowJ1twhTMj2txzKcFFWci0d9l1fTCe+67 0R7IbLYq53keIIIPF4KPNoGETW4AHydEBEkWhgAhRMqEoJHURUkMPjo+cu7THqIL4Zo4cZIOh8KZ 9PMFkSATe+q0qaEeER8w5bFhPny4EAzGoH+X4mEQMBjXJpAmYTJoPxBBCAUEYb42tmsvtKUNRIL2 EDC0GzQoCj/SBsLGPGGM9I3kCSHx6r782zOjgZOzRiBCMFCvHuznioMniBkMBs2K5xQqhCBDzLeQ k/STTz4OTAkGN0+7BqZH2RD6gyDCIMlRgUHRPnXA1mdKclPVUBFC8MtzMsHbt2wfYAUH3Pvqq6/C GqDNcSjX9r22D0QVfMAoP/jggxImDTNkbNaVd2A0W/fYukTK91L3MATwxbzA4SxlqH8lBj9PQsII lQvJV98wHcp7sB6s/QcffmBbyKnJ+lHyBNgoXQLuO6kvYAMe+oQp8Hzo0KFhvtTzYW3ZZzB55kL/ MAB+D/tyWNiHrAX9gx/erfVjLRHiFeEHPMHIYfAkB1KPa5mkQMqegGvWmHVnf4IDSpugDfkxu6WR MRfS3KwUHJGymddupNMt88S4Fy631srF2GuffQOD8XIZ7do3sz7kHslZ+eSjd6nY3eEKcVWcfvAj KApH+33RIjSzn6XMEjhEdILvIjCPrGDvHz36x6Ddt1NuQQjxTTOdQCNEHBgbv8NxJ50rk1VrMcgJ 0mo661yNBnb5RRfYy0/cZS269bY/vDzWRk6Wzf2Vv9hurXLtX3e+YY8+8oQ9+cSDdkr+xVarZl1b nq5LRd9fDftUwtsOKsveLpipyhTS+uvwhXXqBbhgzt26bycNrKvg/kQmqN1TocOZuBw41Cj4pVIm xRphzfru2Dcw6PmiEwt1NO0ipYLPk79piV5Cu4BuovHVUvHK+vXrWl49CQ15tYI5Dd93SVKg+qYs W4+evZXw+FDQcPrutGPQPGD2XvCxxDqHNocPReuNHyVY/53xxeZAjAblb9gLcZ+ZIy5eVSKK0DQv DLfKpXlA4KipxAfLB4oGAqHjgyZjGzMDmd385uPFtMXFx849NjgaCx8i7yHRtW6demc1QIVsCAch jHz8EN1cSagQfwg1xA6CDGGEKb333nsl1WBhbk4cIRB8dBBAiC9aCxIrBAziSMl4rzALMURbgjHB LOiHNhA14GY8N7UEp5L6QXpF2kVKBzcwDT+kCgme+HCyPWGEEEFwBr68MCNmF6Rk+gEXMAYq3UJo mVeuNhyElOcwG96H4EHkuQcDHy5TRseOHYJ2RhsYHG3aqzYN60IbxqcNGdiMDSz8e6gicbzqL224 B17QImgDwUZ72WXnXVKMNy0Q+BG+mM/Q8oCd57SBeQILyYjMF7MQWh1CQOqQsM+D2RLCD0PmB4LN 2DCAxcI//6bOFeZJiDhwsBbghzVjL4EPcAnDYD4wxQMPPNA++fSTEq2CtjAn2lBPq1D24dmKo+e8 cp6xjsy7tbKl+Zv9gTCBaZY2mOeADVzDYBhnbQmo7GM3zwRzkj7YZl3yggl1672aBsJE0bkS00N6 42Oe0hazgw470f507nGqUzUpJBKGTHG9vErGckp5h5DM2PcCzQgF+/QfdZGgcLOEd0wp7Esv1Z0t ClNDVVsX5i8MfRCaW0mO3MEH6ExuHNliAjKX29GHH2VXPvSGvf2Q1kiHcRxaYZi9tWiMnX3Zu9ai Q3PbZY/B9thD9wQfzLY71A3ScoBB/c2eNS0wIwhjNA9hnSj7b/QyjDlbZUeaqgQ633Zg1ELM2mqC BfCEY7QULwMD4a6lSLc6dWqHPrzIY4kQkSbmrAXaJL4kZ1Il66l30G6OP+lsHXX7ph0uzePEU85T Dsgh1rZdR2koqdyZoMilNTm+qZnT54dggNmzZkrolFA/f3YoEoopE+d6Xl59Rbh10PfUKVT0pX0o nx+7gn84DXB0D/u/w+toT+VZHyR/TFRcMAZnDmgX/MQvJFKuaFZzNEM5qcYR7yNhIwVCgJkQ7fkN B+dDdg7Jb/o79NBDS5zMriZSt8rNG0iS3Kcf+uQHBsI9mAeMgL785LiAozSD2GXXXYKJxf0vbqbj b/7NOO5o9TYU5+MZfR900EGhLRIuPxBjxuY3C48060wQONB2uOflzt2B69nuPEfb412IqzvdvYIv GpGXcXdCx1gwVMaBGbszn/aOY8ahb9bMx/Y20YAGXwckcg8S8Pc8IMGz5L2GFu8xLsSPyB7uMx82 JaGdzBfc+9hefj0KG/PiOc8QJhyH7mhnbN73dxxOnnO5mdMd/OH7T2vSgdFX3rIEL4437rOvgQ2m 4kED6/Tt6COvpBP8wglsspmHj56omzU+3JTJonr1moEJkIMRiFAwZXCOSoGEKTlf04QjDkPRilTF vywqvqb3L/TKQ1GQNnNzdehUm3Y24qevg20cl2CI7FJ0EuNUF1WYOHGlfVK1l83p1sR2rjrfLuzb 2h74ryrjbtvPtmzazOa8/ZXl6ITDbDGl2VNkRivoqDkpoSN8V0SI5cjmrg6Z58Zgp1rLYrEWZNA3 00Fbrp2t0/qmX0aTQzuIagXxfqL4yKSRoQ1i6r397qftmqv+ZHfKn3L/PbeG/BQKHTZu3DxkpuMo nzt3poQEWWem62fqJDHvn8PXCEfGAY7zuzgdS1xfpxb267+HQqYvCnQUzbA8V7mYR3kGKm+baIG6 KLOIq1aYOuKZxxAFtBM/VdAJhbeFCCAV8zx+wA/ExSOzIKLxOkq0Rdr1kwTj86M9mguEEsk1SRVE yqEfPwMk2gcSMBI+mo7b1qM1rvz0O5y4SUX80MzcMRwfmzHRFmAS8XLuwADszA0pPmneSN4eneQV e6OwuSmLecUr9gLTHM2bcyKS5u2wMeekTHLG5sc1zjjeWW8/6yPukwBGd+rTPukCL+ArXi+MdwPs BCxov8TntUZfCRTT8wBKOzOcZpgf8hfMxVIequVCkLg3c4aKVcq31VTEO9HkEExS2LN+9i9Q+mOW jiDFPFxXKcwwCV7p1WuAPfPkgwrb/cZ6bd9d80q1qSlzyei5S+2aT2bZW+99Z1vZSPvLjkdZIzmA J0yfadv27W+VF+fbYiIDF+nESJnUCsePlp2qYajbVCw7flaWStR02lL936fqyYsl9cpaECmuV15a sD7agQtCYikEOnrUj7br7ioplDbtlXu8BK0w2ldZTHi8g+OcSr633v64ffThW/a2qg0M/fR9+/D9 tyR8rShZa7RGam+1Uz20ATvvKeai7P4GzaRxNtD3W0NRcvIrKnx7npjMlEmjbZiO0H32qYfs00/e szvve045Pd2CBhSEDf2gqeB/82rKq+EhIghs9Myj3AuohjCGV155JWhGmCgCciIrh5McWz1aS9xh DwF6VMlNmN04NCheSwpCQt+Y6VyzisKKmeaRRx6xVur7AJlR4tVtMSXhg4CA0kecGBEAgI8I8w/S vUvzPgZ+C+DHD5AUbIB5CkKJluWaobfFJPfaa68FpoQGGa/nhF/phRdeCKZFfDHRAoVI8E/raFE3 vcXxynPaQsTRvKIHhDE+eHng/vsDYzr+hBPWKBcPbDjWq6uexV577b0GA2HOmJCAO2ne4AwTFSYy TH/xixL73E+qDQbjGjJkSGA+OPbjBTNh2MAG7DyPl5v/JXuVtjAIReuagnPsg/deVQJavSB9EvlD LahxY34MhL91u7bBNOR+Dx8X5lRZ5UuK9fETPUWdJs6jWCrK8N47L8sMclyw0fPTt98AhX12tov+ eKKI00PWsX0XqTZmb4xbYNd8PN3Gvv+iClr9y468+M9KJu9o85QfUVCwwFqIGa2izkijFrZyzGid La7Qd0WLVei+g1UY9b3+LhK82bZT/93sP7dcY0/K6X72eWfLlJI5Ae+X4q287cEfZjWSKP9z852B Me/Qd5dU1njap1Tevn+NdpAqIqays2Uy3m1g8H0smJ+v73q2fuakkzsr6RuRmUx0pEaNuqFGGPXK VqvdBcFPCxRohTDyL4d9bJdccIrddMMVdsc9TwdG4QJJYB5UJMfXVspENmnmgQSN/4Hf8Qvi7+eW 41fBLBEl4B52CzFLKmuOtI9GARGFmGAbj15IgIwNY0kqq46fIpwvriiwLeUgr1lLOzhyoWYiLXp+ SRx+NBOIWSYJmOd+TGu8LWYY9xcl5dYAO9oDzCP+3E1IfpxrvG+YM/PmvaSquEj8nWW6AmeZqvYy bxhbkrbm0VWYApMumH3KNyZqG7vojzUDPvAfXzOeg9NMJwUyJ7RJtLHSnIolw7rXvJQvECJFPoCi mkW0imzyhOn22itPKUzzX/anS64TYasaMp8hcu++80Y4fKm5QkHD4VAMFOmbvqqK+1QScV8m5wnv tG7TSlF+O9s//3FZcGBvsaUYgaJ2wM9lV95gJx6zrx2wRy8bNPhwW7XdCfbUZJlw377TKv70hJ2h Mu+DjzqDvLZwHO48nWXbSvbylQt1qNAU+cxktlohk0ht7eNVPwyzYupYiQMixXbu2sUOOuQYu+6a iyW8tFUI8F7BPBKq9m4kF2dCye2qUObX7T//vtZOPxNYm6fMdzHcbiiQ3SeFMx3Cn5ObsrC0U6h2 8Hnwkw64QKsM2QNrMROylwbu1UeRZv+wq/96ns2eqRB5fRehYjDmUVWQJHekipJHVyujkvaWoxFz bdLMAwIEsUg6cxqijI0dCR3Hb5wIQ5xgKDgaky6IGBIqmkucCPE+hAb7eCts+gl6Kv4AQkUJUa1G 1bjYBdfHKY5fI4nAQ3jxVST5mOgKhod/IemkQOCBeKDVJPmbYHaYw5DO46YfNAs0GfwbmQgo+PAc mfi8YCj0CV6TGB/3+DgYO0myh3BTlTeVBLd6qXrGYr1hPjCRpIv7OOTjGhHvMh/6RxNNKqXPc2DC QZ90hkt8vODUdBNSAjAQ+1CgT970B+970F5RtvMoJYSRSTxwr4PsqGNOCloC2sh0nYvx3pBXFVJ7 qpgyYdRrRjBhDiOct4Yy9KaqUm7KBFHBzj73Mvvk4yF2/FH72tX/+J/OGcfnZzq+eHtFdL1sF1x1 pT00glCdaVbl+yesR9EoO+xv/7YDjjhJ+QkpxvWIQnhrKEy4Y4ctrFChwtW262uzflJIvBz4jWVD X1mjtlVogv9KPkkRM8zu555/Waiae/rJh9h5o/5qRx59krRcMRwy6tPVa0PtvYhfpCwmnXUl5G5B ZM78EMkEThcvKrTb/3uvXfu3C61P7wF22hnn/cyU486odR30V37fmRmBEyovtkb0mmtK4b0MsDse yGqn/PxXX34SkkVza+QGTQXcg59lyi1ZLsmjhta0pF/fy5F5bTTMI4kQrAv+kbQ9G9vbQWAom+5n fcf7g0Dsq1MGIcTRDHXeg8CR6+EO1/hz4MWkw++k9hBl+s40NrBhevF8hbh2BAFzwh8fG/iAjSvp GffpG9iTngMzDvxMzyGMRxxxRCLstIWwe7Z5Uv+YylgLD6eO4p32mOFKg53Ah0ywwTA9856x4wyM M1QwZ2UaGzMf0YFJawZslNFnbknz4r6fIBg/XGyNvVoG4gNRzq5cbP+69ir777+vlhRcX2U0+tiu u+1t++53ZDDdEcJZT5FP/7v1bluk8Ky99jmkpPx6fEzMDrVr5YTif1+oMuvxJ54WmE9bVcL97x1P 2h/OOloRVLuGYoQHHXysbbPVllbUdFuzg2+1NsLlwXkzreceJ1qXHr1VPJADoBR2On+J3XPXbfbY I3fY36+/U876qpLMG+rs7lo6H/s9y5PG3KTzFraifnMdy4rnPUWEYG41ZU657Y7H7LKLzxaBviDY 2QcfeIR8LLuKQbeSqUWRkpLNIFjATt5FKJkuQgbR4nd5L/ok0gmQQghrOtsb6XrG9Bn2xecf2qMP 3SG7/xCZhAbb9coaJ5kvnrVf3vHXZ7skBrs2psteg2mSg5MvP9S1V6vY5u3X2+V//bcEyJySYAnw tkgqItpH7byGpUaclYt5oPYTIskFgcP8g6Trph4+TEIx/QhWbPt80Eh8fHS0wXaN7RnzATb2AQMG JCZdYVJC2uVdbPiYDTB9IPUjmTtx91DNeESQlxRh3PhFW4i7RyVFn3sEkd+Lt+e5m3BwTntEkb/v fXtEU9JmYmzaJcHmfXt5jHh7f07/69q3w55pbH+eNPba8AIsXl4k09yjpUSS1qS0NYuubxLeyjI2 c0Aziq+Zw14aXnz+7L0kc+a6EA0Uzu/1HTwmInbG2ZfYiSefpb3dRH6L1NlB5BHg1//2m5/sf7dd L2ZwjkKqm8sJnYqeilsnkOIhEr3l1P7PLX9X/aapwXmKyWNbMdXHnnrbbtX9V555wN588RHreMiV NrbZblY8aZid0bWq7dyqu9VR1deF8tQOGfK9fa+Cgs8/+4h98/WnduzxZ9lhRxxjS2TSqVI/z/J1 INSbr76oyMGdrFa7lvouBVAqoC1cbq+vJ6ftv2970B6TZP/wA7fJjHVRyFtp3bqDGEhb5fN0V35F Z2siX0oj+VHy8uqF2k1EGkPwQ8gsn25aOymZM38zTnqsqE0/lFSntAtZ1opOI2x46hQVFvzxB83l MxsubWjy5HGh5PmFMg2ecNJZIZHXzzxflzVcX++6Scqr5lItIOAjrT05swhaG+hJ44jwYtc+eCdd XCP4OWYoGuvjj4ZoHW5PrekJ59jRx50c9ppf5InMlik+FTQi5oEwkGGS5WIeEPDbb789mFRwthJ/ T2QSkvxIMZV9kPY1yzFyCsMwyBnAvOOZwDigiZeHCZGAhf2dbOX4hTROItc4MRBMKTAk7PAQJRLq OOPazSpOrPnwnSg7cYhKiR5m6YTHCUWUkPPvqBYTbwMBc6LtBNbbOHGLEl4nxrQpK2yuicXnEx3b 5+cMEPzFn0fHjsLGux6a7G2i/fCc/qNt/Lnfj8/H++G5/2SCLT52HDYfA/h9HMepj5MJNoc9aewk 2Jwh+Jo67pPGcWGlLEQjELb0T9L7EIOvVaW1QYNGdv4fL7ecGin/BlI7BKFOHmdtzLc/nXe8nPdN 7aRTz049S5sY4h81bdA0dt5lb7v5n1fafXf/2675x3WBcMBwmipi6vZb/2cvDjrCTn/4A/s6W2Hb Olt81RcP2y2q1nd7biohNnWM8AKt4UqZL5sog/xfIrBnK0+ErHRlZEsTuksaxbjxo+zvN98XeEai gxmHr/wf5BicfOppts+gQ5T78559piifr78cap9Jc3lnyMshuqeCwuDzFCbLOSSU9mjcWKbDRg1D Rn2uzCe5svXnyDGfJfhYA0KRU3tDVYLl38HUslS/qRcGnZkjD/3UqROUgzJGZc6nKG9IiNWVk1NT FX23tmOOP9N2H3iAcolaBSaNYzocV7uRXI5PBUsFBjBX5V6mTpshYVulYebO0nwXyR1RHM65J/Gw mkKjmRulbkgmpXrAYiWTzp07PeR8fP/tV8FJPmcOZXga2VXX3GZHH3ua1k0m0Mi5JDjbJ04YFfKA KK+CbOqMKr6Xy8U83KSAz8AlfhK6sKGTWIVJBqJOpAgZ0tEP1ok1jAETBHkJDzzwQEj8wuQQvfj4 eQfNhKQ2NgUmFZLQsE1jqnLmwYePqYGxuU9bNCHuYWdnPIiPmytcaoTpeTY6xCLaho8oapbysbCb exvGcdMU99yR62YTftPHz+MsDZENmdrQdxWJntQn8jbcA67SxvH8hWgbL0DoOHDYmDv3vAZVpnHw SzgO4hn9pY0Drpmzj+NVAEraqBxJlkSppPlE26Bxej0txwFr5PinP654G/YCY0bbMF/mE0rT6GsA N44Xxoi24ZnvcW8THScpECBOcyq4gbkUYsTHmJ+vmlliHkjbhGbysWJe0DbXRzzZzjnz2FAB9sFH X1ddr7ohGzqTiSI4O8UomjdvZKec9iflB1wgQtldGsPhwcadpb4/HrPY/jOlgVXfYjc7vcUSa7/t HjZjr61tsr7TmSIyVOStojpMFNbr2qW7ba9z1VvohEEILLDJFaby7t/bdX+/xPbb50DrXlulceSP qViz3moHT/m0gTWU8xCB4gzwwYMPUGLwAWJOS4JvZ4IEw3HjRuiEvtH69+hA3Ib/+K198tE7GjOa gJBaM/KBYMkIp0EAEp5ThQEJivlZF4OQ1tZ49es3sE4KX22n80c6q9R5585drbEO36pRAyaZyup2 e//GwDdc42CacofKQvOtPfn4/fbpx+8EPxa5KJk84lnUMwt7lwKmRNwtD7+5yO3opByRXXa9RP60 wfJbtgiMPdTwwp8BVtNa3nffDlMSbHslO2ptI1pJHD/lYh4AiNQPs8DsBIHHjo1Ggk2Y5Co+cpyS /BsHKDZ6tA8+Sj4+zFH8hqCjiSQdW8oHzXnTEAKSybwEiZc0IZKJvumTe2g4hL2izZC/gKOc9mhI hIhS46prl67hPWCmfzQjYPM2OIppwz3awIgYB9MbMEJMYWQ8R3tC88KMFm0DgeLdaBuyr/EVoDpz QEu0DWY/CBht6AdzH4SP+4wDQ2YuzMnH8TYw7Z+G/xTmhSkPTY35AhttvHwHTl6egW9MgMCGQx3t j3liViQ8GO2RNoxDG+DmAl+0wVFORJK3IeSYdYZpD/9puG2zbSrTnDVBMKAfhAzWZ5akwa27b22j VAgTsw8CQHQcmAnrzD0CAdhP5MKwzzCThjph2jOsH4KG1+3Cge9t2CP8eBuc915zLJXVPzGEIOJT og2BC7yPEMS/6Zv+YEj8mzbsEZgnWi9twEFSEMNqH5c7GNO/MxGmJspqRjqePn2yPu7mQbMoKFhi Lzz3hl191cU2fdoku1ux+L10QFSobeTZfqVQOgj98SeeIdPEUDvnrKNsnEqUHHv0yfZJfi278t0J Vn/VArtSZqrtdFZ6ncb9Q2gwjAFC4hIvDAxmxKF3EBlyIbCXv//eB3bmaUdZw2Yt7IJTL7CVkybb Kp2SV7GjzuUWA0w8cCgt0aMBhXwPkghVo75V67aKGmorIWLXYGZathwtYonKexRI45oRMqQXL16o vVMQiCYnG8IkYBYIJ0XSOjCB5WgCVJLlp7Z8MJzfXqtWvZDnUKdOrXDoVLp6eUn5+3C+hYewlgGn vyVjAe+c4/H0kw/bpTp8CtMb2tI+gw4N9bAoDppTo1r4xpZLbUjlPi1K42hRSBwkgZCy/FRMbtio sfZ0JwX28M2JaQrXRJQFE5fPXf/GXDpvzkIJBx/bcSeeHaIAoxplPPijXMwDooTDlQvC6nkO0YQz CAcXBIL6RFwQK7+iuQcQhaQLJgUz8LBPTzoDaXzIHurJRmrQsEGIGuBdz2zmPXfOerYw91zD4d3G TRqHTQSxcvMFGeA8gzD7RRt/DoPhOYTd/SW0cYJJG5579jWMwSO+unXrHrp02Pjt+Qj8m/ly4XDH N0T/0XwGHwcG42YValNxoZVByOkH2HjO2DiIfRyfg+Ml2sbH4R3WjLGdqTts/IZhu78pet55L9XV 4rlHYnlGPbDBXGgDTMyR94AtOh/Hi58rz97xcTxAAAbDc/r2s8ijsMH4WGuee5vo8y1VpNG1X8bm QruAyfCew0N7h9P3LbCDF95b27WWaMnQHMm3t3wB/1R/xx+znx1y2HEyWy0UgX5TiVwfirB2sUce f1M5EzvKR7PWCMwSkFIZ6ll2/T//a3Vyq9qtt95gT0+uZlMb97bWS36yi3fpYNtt3d1q6lyO4FMI xRJTIcNOUIPDWn/CMBDyR+sQpSefeMjuu+ffwlUrZT4/YQ1rqsqwTCYVCuQ/IniBEKbSrjTa6Jvz xPlxVKZs+VnyPdTUd1xT+VHaK9RpUpsSu34w7sfwEJGamQS0EKIYHPAewpqu5eRRXe4TyGjMX9vi rsfnwIjG8aUOc/rLn/9gW3Xbxs674DLbqrtOPMxVZV5oB5NM45JKt15GpSRqzZkiuCFwQH9TCgXh QBVpSjSt6DamCfkuzz/7vCp456tOl0oRJUfDl8y+XMxjPeJuja6jGc7RsNlo9jEfM9w4nLsrg7A7 XOkM0wR/RxmNP6edZxx76Kfb2t3MBbHi364lOfGF8CGB06+f7eB2fMb155ibPKzTbelOJJGs6c9D Un1sfqPh0D/z9HIp/pxx0IjQTmBKzMfHpj/+jUYBAfSQ1Chs/Bs/k8PmZkXHC+3QFMC3l1P3sZkX +PACk7wTbe8hzF6W3oMonOD62OAVvDi8/py+GNtL/Mdh83mDM3e8R/ECTnjHC1q6X4j+mRc4pW/m FcUba8K74I3fvr+ieKM9eGO915ZhXlLG+ufvfI29jZbRvHkTu0qRL5dceKpd+ZdzQ7916za0M8+5 1I497gxpSE2DqSpIgGX88CAK9N1ERfeOv+Cf9nrNgTZtWbZlv/0PmzjyTbvk1Sa29Xb9xHw7S/rv LBhapE3NOcGkiqlj+fLFQesbOfI7MbKP7e03XwlmpL0V7XXZFTdYqw4tbMGIqfL4f2rWuJVVbCnK sw7RUXH+G3IV+NEcQ1ZWhEn4u/E2buJJrV0KOf47ib+7aaaMaNwgr4VQYmkAryrXp23bjvbwYy9p L1YPOTL4ZRwvJVbRNPMMAQO+19IM1/ER90et4dsR7iSrSsudbbfcdLX8z7uqQkCHMF50z3n/fm+j Zx5lXUEnPhXTehh/U0qC8upIle6Q9/f4TSYyhfkwyaCtOGNgTFTB559/PjABpOt4vgUEhmxjNBKX gKOmDJIHycTGP0PdK4htVGLF5EKWOMTftasobJidKPTIuIxB3yVz1L9pi58ISThuRuFdzzAnnNgl fsclBPbll18OWiFhtW76c6YG7C+++GKQ4Pv3VzmKCOwQU/ACgUci97LsUeZA5j2MEdMmzCuKFwjS gw8+EBxyxx57bGBQ0efAxtgwlt1VGhumHsULc6bgIpntzNth5rfPG3MTIbdodFGc8/yNN94I6+1a Sdz8xH6B+eyhseunGbPjjT1B9jyMCbzGS7f4e651uJpfmqKCSWj3gXvrY/3IRo38UcJIdcHdSeG2 jYNzGkc3H2tZnbmMzdkbnFD45Ndz7Gqd9pdbr5md36bQ6m57nH0zfBvtnaEqc/GuvfziYwFkiihS cgXzD+V0OFdkiQ4Vx1QEI6Gg3k79drNDDj3OBuy6lwp9Vgq+goqi+MU6D7xie+rZiZR4+FNZP9rS 3nOiWMo7Ue0uE4P5NUD5rftgLpjkciUg1c4T45C2gHsvuHmimlYCYAEnEcT4Hoy/6gwFcx75tOPG T7Bzzzwp1FI759w/h6CMuC8o9BXpf5NhHkkLDBHAnp2pThH2eggn/gMIYTzDHAIIA3JTUnQM3qVf JFneiY+BlAoRTio9Qj+MDfGhrVeDjfYP0/JDk1x6jj5Ho2JupSXDQeCTMrEhqMANI8iUfc/Yrr1E x0XaZ0x8RE68o8+dadN3kmOZObdq1TowBdccou3BG3jnTIok2LiHzwn4ky7aAncSYQ8aqkyO9DFH Po56hA3FLjQLcFuYUJWA9qFemXDghRYzEZaymK3Cd6iPlIzsFi1aiam1CpIzZifCRsvjyM0V01gh Ef66DybbbR+p2m1eoZ3VTWeLt+lseQ37mRQH4W65pMyp8ldOsHFjR2n/T5R/YZ4VKPw2ZBbrNCdO wmsgJyums06qU9Va/okqVTnMKAWbyiVZsUKBKhIOJEctpU3KrBr91tT4dzQe60++yy6KmHvs4Xvt tlv/Y2edfVY42Cs4r38pg1Z7zIEwDRJAFy5cao88/Ixdf+0V8mNOsbvvfVYVIDqE0Ou1WWc3aebB Rw4RSSpVwTMkU+ok4SSOS6AwHo8g86ie1Yh7unyIM4E484B4ovEwRpJzlb7RLDzCK76/aQ/sSMhJ RJbnaC1J9Z1gNsCPX8mr8Mb7h/jhq0pirBBJmCNaT5wB0C/aBP0mzQu48NdAZCHC8eKGaBSYjZhb 0mFKbsbaKkP2O7ig0rJXDY7DgDnLy+In4RSGSo4R80piHjAv/DxJfjj3b3EQWFLRxtWZqMKcscFj QijN3pQ2MVC2I166gxDNslwQHMapKYIwKX+Z/fmtsfb68Gl2TNsKdvRWja1pk5ZKxqsVpFcYU1al Kqpr1Ub5FW2CBgeRgFGFoomUIyenQD/BLJT2H9DWz5sIcGGiUghtuLAzlRHWsszn//U7QjrCRL9+ O9uhhx9vl//5bJs2ZaKdceYfFcLcKPhyMEnye7X6VQlIc62DyC0YRsgV0Q/rPF2Jkh+8/7Y9rByj YV98JFrQzW781+sK8x4QNJ0kE1/Yz0H7SYlGmzTzgCkcfPDBiRIwk4dIUPzObe9R/EMA+bCi/pPo 8yzZhjn3A4KSVEYDxsFJepnKm/AccxbPk5gDmhAMJlN7zElcSW0hwJxpkckuD+E88cQTM9aWAidn nHFG4ti0HaCETs9Xie9ZxsRcBXNKYtq8j8knU7QS8z3llFMywgbhhqHGqwk4HKwZwQCZNA/GRhvL RPyPPPLIxFpk9M86n3baaRn3UxQXZfVP0GZtEt7aiGllfcVoHEPGz7eLXx+jaKV59teeVW2vzk2t hg4cyqZGUdqHADOAeIQK9REpdjXzBpFPccd0HM6ow2FdJru2yWx+HgIYVq2qaFdceV3YG7f/70Z7 5eVnxUyOU6jtoHDAVm6NnJJoqCgT8XVMRzKnS8HIlycn+CRFxo0Y8a3OyHnX3n/3TaVATAk5Hxde dLUdrbI3jZvUkzn65zyitS3FJs08IFCZCJgjJlNlVM/fyIRACHRp0mfUUZ6pj9LqI/nZ25naZioq 6O9nYjo8By+Z7PXOkDI9p21peQ7gpbS+6b+0ea8NNtdWSmOMmeADttLG5vkvwVt8rcri81jbB5rx eZq45xBOqZf+qyNi//H+WGtXbaldsWMt27pNC6tWu6F8GKmzQ9xWvlp/TvR5Tn8xW1t4vKEYg2BB YoYweta08zoS2VIHWKUYL4wwMOA0Q4tadpgTUWQQUw9F3mBzKutiax7h3PhqVeyav9+scPG+docY yI3XXy4z1nUSKruqwGVPmTk7ymrSONSngl7gq1oqtYSEySVSX+bLrD116mSlRYxSdvmUcEokp1By 1so22/S2M866UALwfrIitAiRVQRmhCXPoEXGhZxNmnmUda02v7cZA786BnAuRn5+zf4hjpgQashM NWvRCvvrkHH27NeTbb+WxXby1g2sZfNWlp2jUwtFBOKRNolwbCgGUQpSQqazkiMbKUehbp1qOtNe dnpcK2IaY8aMkh+mg3yCC4NTv127ZiGzHpMcvhjKvsAowBH5KiOGj5ZEvVBt5NfMrrYGk/w11+bX 6ot5YCrE1HToYQfJB7KnNIYh9uYbL6vI5bv29FP3h4TOn6+oJPDz3coK3crJVQh/w2Y2aL/DrPvW PWTq7mPtO7SXJs2R3DJHyn0Y9slaTI+p/eySxiZutvq1FnJzP5sxsM4YSEvxLhCvc/sMDehWBxIG /8bQyQV2/mujbZIOibqgexUb3LWJ5TVobtnVVG0w/Y1vhHyhTKiA8eG8HzP6J/u6YJ6CM7a1cbOm hmCNKlVrqFbVJOXDvB3OHS8szJc2XDuUcClaUWxffDZU1S3IkSrSz9IgdRNN1L59G5lDOX2vTCBs 8JdSUVcpjQBtftB+g1TodZDNnTdfGfnjwqmB06dPC+d74JfFWlJdEXPBz6ucN8q91FWiZJOmjcNR xLk51UMYcKjMi6aRNlGF/JgybJSSvZze25s1jw2+RTYDsKliYH1oHtX0xcI8Hvp6hv3lTVU4qLTI /tm3hu3Qvrnl1GkczvJwM9XvGa+KBpbpZaEK+b0fyrjnL1gUSpd06rSFJOWFIp46nGohRHSMzsSZ YHVVh+mEE04M56mPVQRZ1WqVQ9sVyo5rrVIbNRWoUVEUMlPo6saKK6fpaFIQfEx1tWvlKXy/p3ya qcraOM/dVMf8YLzukiqpVqx30DKiJxUEZrAOgQ4luEsDtckwDw+djCbigVjs2PFEMXfWRpPyfPPg AI8/jyaKeZ/c83+vbZxom2gyXNQZ70lspY3tc/PfpbXx+UQT6DyPxecYxUt83tHkvaRkuhLY2VGi Vknt47ji7yjOo7BlWhOHw8eLzyfeJ9JXNLdjQxEFvi8/e/yXOsR9Dpip8peutEvfG2/3Dp1oezYp srN71rN2LVpatk6Rq6QBy2Sm2lBIWYdxIWpLVJajsQol7rzLjiog+XU4sGjJ0kUyV+Urgqy59ei5 vb3w/FMqR5IT6m8x99k6sGrAzv2liVSyt99erCiijpLei0MBxfXBzNdhSr/41fSnFphIOAstYmry PRZPlowP+kv2Ypzxlot5EK3iZ2TjNPYT7fxDJ1KJOkk4o3FQUhyRWkLkPXisPfWCSKDzOldEH2Vy dHq2N+29NAgho9HMbPISCA+lDyJx+MGJFI3KgfB4xrgX7nN1L5qEx3h+7Ctz9X4gkISZOqH0kuPc i0f/ME8YGr+9uqszsigDiTK3SoqBRFLyUFlg8+KF9M+/mXeADUIhTyJw+8l33AdeJ6AOg2d5M2f+ 7fPzMh0eseXzieKCDbpC3knHAW2Yr5/vHuDXDqVQHWO7I5u5exvfwPTLGN4/7/C+Z5FHmXAcR9GP IIkBeeVdIux+aan0X/yVh4n8ej4PmFAtMY7vZy62i14da1+Mn2Fndc6yI7s3twYqY56t2k0uaf4S 4vCrzPtX6iRI0Poewv4u1Les0iesMZpFixatZXKZpXIp7+nfHWTTV16KpPEKerehwtfffvtNnc7Z Tblb3RTUouJ+iwuDA9mvTQVHUcf/GsEOZTBDretSBeaR2trhmy8X86DK7a233hoydTl0iHOfuSgi R94EoZoPP/xwyAUgJp98BrKwWXyyf8lK/vLLL0Oegh/iRK2qpIuEsG+++SbkS1CUjjbUuKJIH4ct efYzRf8oDQ/jwt7HgS8QIJgUIbkkjvEOoZwwGggoOQ70D5w8D0UQVbLhc9WVcSZHEh8x/37+A0lk JMgxL8J1J09JFQ6kn04aZ6GS12CWhLPCYGkHUaWQIFnsFISEWFO3inkRkkvuQepMk/4qCTEnMEGe U3SSaDFsmPy7pSTMBTKAAuf8BUriK1hk/fv3F1OeqTb5oc0kTslTqK0zBgoEvvrqq6EeFPAAu68Z eSDgi4xtMtUpPkjCJIUMyV8hLJbyLeCN9QEXfMy0mTFjuhyT1W241rOaSrT0Up0o2jA31mfq1Cl6 t1LAP+MAB2tO1viwYcMC02AcMrq31jgfffxxsGeTe/L111+FRELWAHyBN4op5qqOEsyBPA3ugTOI QocOHUPGPQIK4dEb/Ar+Bk455Kf8obgQhKr6QqsqWujZH+bYJfJvVJZ9//o+ObZzx2aWW7eJ8vNU tTk94fVALzYYKrHLd1UV3PbtCkNZ9q22zA1VZTurMmz9+o203+eETP8ttuipb29c2GuYaFq1bBfM WWgsDRo01j6dah10ZCuaR5XKOn0yXc5+g03sdzxw2MsRM1e5mAcfPkSB0hYQYU8cYzEhMBBYT1SD uEP8KHUBIUDDIMmMUNMGDRqqjMb7IgBLA3H0YoqOX/r45JNPAlGjRAft0DbIQ6Avr7EEceYdqtai nTA+sf4QSggzcHl9KIihS74QIYgV70P4gB1pGKbI2PQZDq769tuQVLVSmbv0g8bEnNFAGGfsmLGp M8FFNCnvANGDWVAoklwNSqBAGCGqvMdzYPIfh2fGjJmBMDM+jBAGxRxItqPyMCVHILjgDtghpjNn zgghw61bt7EvvvgiHPqTLRgoEcKYEH0IKzAXSpP5Qoxx6x5bB0bMcxgrxBwmxQ9MDwZCX8wPGCHY nJ/CXGCytOXfc+fNDfAyPuVUEBDIloeR9t6hj02TMy9fTC2c9T5zVmBSFKDkXcZmLzAOawqDhrkx Hn3yA15YP/CWNzsvaLH+nN++/n6P9zaGKxDziJRWXqKumoY60GiVXfPOZPvn++Nt+7rL7Y9961jX 1i2tqkqg/197ZwLv1Zj/8afl3rTptlFRl5LSnhTJmESpfzPRMikUZYgpihaUZsaerJEYxNgqW5aI MFn+iGGMLEPZWsz4R3UtpbS4/8/7e37f2+k4t3u71YRXxyu/3/2d8zzP93nOOZ/v/n2iXJudF027 I9eaeVVVCKqH2FZQOvQee1aLkhll/69UqZ7wop7Z8BEkuJ7vXI8Q66XGc3P3tggtcz571eAdSfgv uO9k8EeJmAcaBMDmpcyJjedvQMML5nEO0ABEAWSu4TxghmSNRF67di3THig5nhZ/D8gCbkjygCjX IUHTHmAH+GFKMDPGou4RYA/o8J1z1K+C2QD6jAnosanUMknr+0q6BchgGpjDuB6wctAkAxnQhAnw O1mZgDcMAICHKfAPzWXBwgUG0NAMfdCNZkFf/I70znUwSehFSgY4AU0YFX0CvrQBFGkzX0yLeQG0 aFqsHUwOOtGakLyRuqFxnd4Q2izUfOkfmrmGOlEwBNYrys7uEB5++GFbO8yN8+bNK9BKoB3NEAbL C8i4MGZMkAA06wdjYR6sL7TBcLi3Xv6e+fDbfO1DwHwwtcHsEDa4d2gatKuqnY6or8VzA8PxPWCY GxqKmyd9vnxyDfcXZsgn7WDitIEBwnC4zz+Fwx2XHi5bXJo8Wxwz1ad5a8PIJz8Oz7737zBw/9Lh lNa1teNebshWtribXv7bJhg3j5Rk3K1tS7Ic2oQBvz43xCJTYSJeQYZrOHAmOxPx9Y5XmXEtcGvp KM69K26fxb1uszG3k2pZorFjhESVjyPBiKNEzAOQIgPZ6zt5CQ0kP0wdMBDMFG7j5jzX9u/f38CU 7wAhn7zsaXt5OM30g0ZCX0iqXk21Z8+eJpFycA5zE0DlpcwBcBgSwIkfBAbCOdp7oUHO+x4h0AG4 YstH0veqrrkyuTBOXt5XYpal7XfAj7aU7wCAATU0A8YHPAFtwJZ5+2ZGnIcpeOl3GIbtYa46QqwF fQL4rB9tGJMigtDLvGEuADSgCg2Mwe/exsuC0AZzmu+/jiYGTTBINomprn2jMQGixQG80M93PhEK AGTA2Lf69dLn0RrkGVNhy85G+g5trkmxttxPGAlaWp7CCfne/tD29rtrjQgCXMtaQyvPEn34Bl58 sla0ZU58h4ExLm2416wbn9AJE+aeeRvW7qfAQExKi/k9igVAuohsce1TFJ5emBdGzPowrNRmUZce Uj78pqme/Zp7hbJbKHvuWcWZWA4b0mmI/1YcWtKuAXwobwFIp5T+KrJbtjilTEZRbX3tSA70ENI0 mz7zTWZXJ39LEsV66JWzpDjbJ6mkamGiY/JJvGRIYQvBHNgXBRpcS0qbF+fj94s14zdnklu6ry6s eOCEM3n6g0ZkK/Z7KclhUVyx9SoR8+DFjZeXcIdrWq0izqU5wosqae2TYxx3jMezxeOaCkBcrUa1 UKNmjc1KkwMkcWe1O8vjdYsAbY9Cikcxuc8AYOc7zIcDQPPCeD5v/82d5s40AXfOxR31Pm938LoD 2R3fTptrLB5l5JFVSNzuYOYcc/Q29OWaF79zHeAK0/LS7FwDYPMZp5vzPn/6BZCZswcH0B9/e4RW 7cz1vj70Bx1e/ym3bq459Tm8X67xPvhOW/r1e8C1hd0zd6zHaY473tGG4hFfJXk5tneb4jIPEyz1 v0p6uVmra176LFz29CehceW1YcKROaGNzDPlq6r+Gqidcpi2ohcbUARovIYVv4kHW99E57CngwNP HLS4xmomKZTTwCEu6eq7gY6QwhLxhLrr1q+Vv0vl9DPRXU4SbZNgGK8CyzO1TtsKVqSYok7Er3VQ 4jemCchBD4mB0Abt3j9F/YyetT9IYONZja6HzrX6rWxZ3ovNF8pCWc10tS4skgWB/Aec8ElG6/ei oHViPexPX59Mn9yzr776Rutf3jan2mwNMuZLfoPuJYuXyl+5Qg79VkYzJjWnFfrZPwXz2hq2G84w Gz7x1cB4KErp18GEbVviDD30D3OHKbJ29OWVA/BVfPTRIt3Db81vVJJcl6T/rkTMY3u/ZNvan0Un kZKqI87UMBVhokJLcWk0HomDCQkzEcCTViGWQABMNx3llPZSJN4/YIZfYqVMPJ3k++HvOEMEHJ97 7jn7zTcQio+NKYjgAsb1TYni5zHT4SOg8CFOdeYYn9sTT8w2LcLbxucOADNvaMdUFGfq9IEp8WU5 qGHKzC0pqaMRMDcke8xbjB2/hh0hMVuhwbjW6IyUT8xOXINJCgbqB2Oj4RBAwcHYSXMlYz/77LPG BAlu4IivC+Y7aGNdfCMqP59W52tbn60St884F30zni3149FUy75dH8578pNw/xtLQ98G+eEPbfdU trjCcMkWz5hk0vqh/Dq+qCsmTBCIrQznnvsn1Sna04DxL3+ZomdhXhgx/NzQ6sBmUZhnBmytT13z oUClYoXdrPAe5wFs6LYy4JrHiuUrIs37oAYyeb4Ypk+/M1x15ZSQU025Ezrv2gRtAUQrG8K7CCOj iJ/GoOz3w8/Mkany0XDlVZPkz6hkwAnYwRw89BRG9s8354enn5kdhpx2evjrHfdIk20YunbrasyL uULL9ZMmylT5Wji662/DsGEjRKsY7eUTwmt/fyUc0bFzOPOs0cYDXTNBo6uSE7TF7X/CsKGnhksv n6hQ39YG1MJ7+0QbKSPC2VueA03JftMn/1gPaAW8+Qdo0/83X68KY8cOV6DQ70Kv3t2DNkM0RkUb QJw2MLvs7Pww4Yo/h2ZNm8gy0CpccvFFqvPWTdp526iS8uqVYfINt8tsvDyMHj1eWwJUlG9zYbhy 4sWa8wrVVTsr/Oa3XcP/LVsRJl13m96lr8MobRS1mwJXYBSvv/6W7vcky0bv37+vBTW9/NLzomFd 6NWrr4S0mmp3Tbjzrvu1Fjn2HGyN5mXPciaHxNanxC/Hz6AhoInWg78C8I+DEFIqTmfAC9MO9vkk +GBi8S1nk3WsYA6faU+Or2VywaySrDWF6Qs7P/17Tkh8yTDV4G/BHJN20B7/AuYiADqpqZXTG47E 43OL9wFwo21g0logHwYVauMH9BKIwJ4XScYBrfhaMJGx54ib+7w9ZiX8IjAe1g0fUjKvAtMXtLN+ ceZBHzAQmCLmyLQ6UtCNnwrG5BpLnHZMZzBW353yp/oYUsUB8/CWquqaGYhscb34ryz6Jpz58Ifh 02XLw9i22aFvi71UQn3vkE22eOYozM8AYK/57uswRxs2LVn0iUmWo0adEd59b2m4ferNykT+LPT4 7bGhecvG2jf8G9tLnG1L8/VfltBy+FmnWH2jq6+5UVJrlvnN2O71gANahMpVSospXReeeebZMG3a DJmQGyrL+VgBljZBE4B++OFimR+/sL3B2bRoxYrVpgXxXK5du1r9NjTqkZIbNmwUugnss4TOy5dT 2j5Lz9hiPWu1TBAyxiXpeenST7RvygNK+jtR+6/M0q52R0gA7GpVh5UgHi4ZOTb8/bV54YILzpeE Tqj6mjBhwiVWw2nY0CFiVFSfJSyf7eEE2lqf79X5O29/Kvry9M7m2Vat2pgvfPTxCrX7UNF9DaSR a2fErzFbS0MSpyAgBFz4XM/yd+Jc9etry9zM3NhzvZLebd5NNI5u3Y6RH7SxQP47hRbzXuZp/rTR /NEKdY8XLPhY79brYejQ4ZrrxvDQzOmhwX4NJXy2NXpnTJ8ebr99igXmjB5znpUfGXveOaFebh1t Jbt/uGD8uaF5i8aKnpyj626y4JzhI0aHqnpG1qz5Xvd6SnjowenaxGl1GDiwrxj9DCtLctxxPTS/ Rlr/BmYefuP1V0N3MSH2lt8a35VXid4mn8dP9YVN0gVIAoCAmYf1+jWAGOYbpOS0qroAF2YyQCxt XwnaA+gwKHIckoeb9jiflrTmZh7fSCrZHu1hnVRs9xclz6NVwPygEwk/fuCvQDN4X1FRR3ft+iPa GJsIFRgFTCoO4tANwyCyC79KssghDJjfcVrjf0mbG+vN2vh2wHECMF0wZ9Ycv1QyQop7VlP9E5hQ 2LphivOte3+yz6JrHhm/x2Z0ZswMFZBgJZ3e9vf/CyMf/yjUK7sq3Hhk5XBY43qhYtVaUbZ4MSYY mXN+CLVr1QkHtz00zH3uqXDOOWeEZ56eFZo0bSEA219CQhmV83gu3PnXu6U53CWQeSS8Mu/l0FsS 6Vv//Lsi6OYrjLqnBKys8Pish4y57L133TDi7JHhhRee17P2Rrj11tvlWzoy/O3Z2aoI3VN9PBju uOM2aRhlBaDl7Pyrr74i6fYKC6ed//ab4YJxF4YBA/qblP5vlRafO3eOfFa/DhddOM5CzAn5rlRp 9zB16t1iIuwGijYi35kA0U3eMBu0AFmlo0N9IXzl5jaS5t1SQlqedt57OJx88hA9m3sbg6tQXvt7 CxxhHNrtPIwfP1K0zVOdLCIe80KNajnSYOeHcePG6h3OMiFw0nU3aszS4eyzh5vP7/3331MEZ1vT lt96680w/o8XKxS8X7jmmpvC0iWfhs9UHuTYY/qGQYNOCs/NfUqm4ZoKiPlI5yeqfXVFab4pjeTP 2hHyRBMi3n3nba3Tbgo/bmBFDBFIy5kKE5UMGaC+1675Kvz1r3eZMPrB+x+Hf73/Tph0/RRbm6ee bKN79W4YOKCvmO/nynO53/plX457752peZQ3xo5pkWeinMbq2PGocMrgk8y8hZZUSXWu5s173phx 3PldjMdskw8vc/EvRvNIk+5xzOIwr6y8D3fAxhcJgEKC9v3F433wnXwUbqLb8ZMLfKjCdDlwICfH Z7yuAm7au98l3t7LwXtiZbJvggQGDhxoD3GybxgGjnXMSu5XSTIPTHGMiz8h2R7wh5k6g0ueZ2yk e0xHnmAY7x+nP3ThJ0lbdwISYHpW6TPhqUUTpJS9m/mS52FcPXv1KtivI7kujA197itKnnf/VXFe hh15jZstktFWZp+WrFFFL/zK79aH0Y8vDlNeXhy61/shjDmkZthvn3qhXGWF4eJP0KXF8ec6CKyT HaLTUUcLxG8Izz3/epgnDa+rJH2k91DqBzGEby3vAVMR3xdJUu9wWDtppm1C3b3rSDvpLHv8qtBA z9XLr7wYrr76cm1ENFxMpbPA9dswavTw8L8vzlPk3vvSLBeFq66+Igw+eVDo179fOKrzkeGee6dZ ldfPxCRuvnlKmHzjjWHmzAfC8Sf0N4DLU27GgoXvaV4b9XwtlMm2RbjkkstCv36/C2/84xVtI3CM AZxLw8yd+8lzNG/eP6QtvxhatmqjSrOXmmbUqVOHcMrvT5dJpr/lFb35z9fEIF4QsK6UaWa6hEOi LIPazlchwelG31pJ6GPGjJYP5Ydw4YXjre7TDTdcpy0KhoSJEy8K54w8V5rIR5rrTRZJeeXEy8MT s58OU2+bqk2Tpuqd7GeBP0j3t9xyo3bVvC/8ru8x0mAWKCx9pQS+NWKSS81kdOstt4THHp0ZThxw YsjW/FesXCYcqhgqVMw234zHWUfmoFIS2qpnUgrwq5aSGSvaD4ddHmHQYNUGhZ1VU6RiluxgaCgV KpQLixb/R/Obpvs1SSbBiYrC/LeZzMqrQiT71z+ucu6DB58ejj/+GNOeFi1abJWKMStuzVEQbbUt zMP35+YTCdKjk0wo0NsBIDj4ADKYNwAFpAXOsSCYNJBc4erYuQG7LWUGAxZERmGKcce32/IZk2gi 36/cFwRwZAzGxL+RBjRoF6jY9J08MOlAn5uH0s7zW2F90x41Me28ay2sQ9ph55UAxnl3UsevY61g eti6oT95wDQAf+aVBGjWxffj8PnF2/PCkr/C/U2jnfasGyYk7kvautAHWl/amjM3NBDoIiw4ftA3 jJdnJm3erClzxywWPzzr/CeTYW7At+mfqxBI0JUFJO/857swbObC8MbHX4QxrcuGgQfuFWrWricz FdvubqpVVJyX2/wLAiDMJA1lBmnV8sAwUppHjoz8nTodIQB7QEwo8vxmIenqYA2zJJZXFJjhLwRo yca+6aabxFQW6b2uIIDK1jlK8CuDW9sG11KeBaBVSfaePAHhV0pUbSyf2B57VBPzqStpfLFleFMq vHnzJgZU//5Mz29mb/OyQrRI0o4qHRx0UDuZLxtZ9B3SssVXFET0RDpXxITLCCCXyBf2vL5XDEcd eXi4885bxTR6aivjE61USfXqNcKokaNsX/YDlcf07rtviQnWtvbLv1xmQNv+kHYauoxpBatWrxVG fRzaHXxoqKJdE+trp8Rnn31cGsB6YYa2hm53iBjEKtsSuF3bluHVec3FoD7Vjotfa3+NyXpGy9v8 o/dIjnu9q/b9+41mAmvVsolqau0rrWhJwfyZN4mjVrYmml2oXEmMQX9QCdjui7QgCxJSLZrKSvTB h/W9zH8bNuym95wKGpn7p/egrB6m6tUrmH/zo48+DA88cF+YJwbLff7Xe4skgJQR4+8W+vTpLSxo YLyK+l6Ma0udec6K84z5vdjmaCscrrfddptJvUj2OH4BAjgjQIbUSe4B/gJeZmLwcW5iiwc02rVt F15/43WTnLGfA7CE/qYd5DK8q/yOOorkwbmNyQLJmXYuwdIOcwd9x53K/F7YNq0+FmMXdqTtIBi/ tqjzO6JvL2dS1Ni+/WwaABfnYaH/LbXd0roWRVt8/Hh5Fv+9JH3HS5YUZ347+hpeMpfULFpG/8gU x+H74FvLw9kPKVt8w9fh+qMqhs5N64bKZIvjROBae72LfxArUkpb+wEupUqtk7bROUySQ3nYsLOV y7SHtIavBIrfh70lTCySVH3NNTfIp/CISbdlyuSbMIdp6vU35of77psuwOkq7a6+bU1LZdqcnGom jT/55LMmoOXp93322S80kZ9j6u23qWLtx/J9LAwjRowysOQ8BxsQrVmDCTOay8aN6zPvo7QgATP7 ZSOBYyIL+VHtKRzWP+Rz3XcaOwodZw+K/v2GSkPpaX6Rq66eIvBW8MU3qwxf2rc/SAB6kPwAtyuC r66YQWWF7je2CC0AEjMpQuflE7S5kv5bJL9Qjhhl165HK+9otrLS62j+fwsnnHCSaGWL5m9sfKoX QCORSdHnes3vU2kbD4VLL71E81wuKV/Cn24u88zXHPClAPgc32le69attTXmDuHbsdwkMUpKpTPO /fffK9/pJwpGwPS8Qea32bbvxs03/yX06HGsmeCuuuoyC+kH9w4+uI1Mfy+Gp5560miZPPkvpl3e Kjxeq7pfDz98v9YtX9dWVqDDF+HITl3kQD/c5sB6MPcWLZqZZsJDVpxquv4kRs9zxAA5SmS2gsMC 3r4FKiCJbZzInKlTp9q+3YRhIt3AQAATbOR8snhch8bCDcVxOmfOHEtiS4t4gjGRIDZY5grKXKBt YCeHhngtJf72LHKXqmFoSDhI0B7W6SGyLo17WK0zncLa0I+H4sZrRrmmlTZO/DcPq02jLfmbS/NO m5uO0sJUuRYJBMnKTTY+xzTauOk+x8Lm46HFvm7eBjqT4chGux5W/vMQ5vhaepvC1j8e9rzFtRRC brTA/EgS3dI9LT7s7tgrIxkv+ke2+Nr1G8P5jy8JV/5tUei457pw3mHVQ4v6uaFcFbLFSxeEXG4N 4zBQFiiUV+hs377H673KkYC1r4SxEbLPDzIz0P906xHq1qsv/0AbmV0GCWhfl+DVXSbVikbd2LHj 5HC+TJUSFouxXC8GMkPmrWWK7hmqd7iCJPzjlKD7L7X7h6KDuujvfpLea8rMc2W48sqJ8pE8IZ/C hQZSc+difjrOwKqNChdWVYgxyil/o5Ece2wfvcOUF+9jTvb8/NJ2ff0GjQryP3JFa+/e/TSn3UVn D5VdV3FDtfeQ3FwVQZw27V67eVcpcutXv+qgeVcJV0ycEFa+tVKmm2sEuvtadBYMiVLsV1xxtbXp 0OHQcOaZI6zkybhxfw6XXXZJmDHjAc2pj34/S+C6RLuP9tfaVDAHuM+lRYvW5htp0qRZOP/8C8JL L71ie41QPysrq4J8QL217vWFSWvUpq/NpVWrtqILs7NYu+4DWAf+gZ2HiAn063ei1vUt+ahekFO8 obTtL4WJ1W3Mt99+RxrDieF6+Tsuv/wSWW1W6ftkRdHtIZ/V/cLAWlrL3tKw3rP7cUTHw2w9Fi36 XPeMpOnqMk33kkO/ia0d48PUVyoI4GBpWxz+bBb3LUheXyLmwYvbXP6CdooU+kRlQvi7ffsoGYzw SkAeE5Xb5HE4EzIKgwC4vFaTh5miwRS2M55lTasdWguaB8lgmFqIyIHZMBagiQmF69BwCOdEmoJT owHhuMXMgURLdBC/ud0c0wo31dtgZvM2hPrC8HDOMjZtYFj8ThvKdHgpDdrwm7chA52oJW/D+JzH jkobGCcZ8/wGg2UNuZY2tIUhY7KCdtrAMJkTTnL8HURysZZRG2p/7W/zo6ZX8xbNzWHO/NEGGSfe hvvCfPC7IEmi3eH/4TpMYZikXDigDAwHZkVvwwuAWQn/A/R4G+4J46S14Z4tVwhi82bNbY6YMfF/ cM9og5kTBoNmyTgIGJjcMEdCG+N4G6+7RbQajMTrhHFvk5pncV+M7X1dJKFF2oeiYMOiL9eEoTM/ DrPf+Tz8oVmpcPrBdcJedSVgVVS2+DYODlBVqVItXHTROAsT5bjxxmsNwPh7zJizTGIHxP/0p7EG JEiefJIw1q7dgZKmH7Rr8BF06NC+IDyVeoJoNvRn4bQ6OnRoLRAMukf7ywF/m2V/o13Q1+GHHyoG c6jlI3Tv3s364XcY3MEHtxUOtLW/x4wZYaBGn+PHj7FPmANH69atdG0ru+6cc86MclDILtdCcR2+ kV69jrFr6R9aWrZspmilewrmxm9uYqENWkvfvj0jJ7EO1oWQ3GuvnWh9RjkiQc9Sbrj44nG2j3jb tgeJ3oNsLl26dBIj62TXnH76YLUZbJFhrCFM6txzz7bQV/wXh8mPRJtu3bpk/EsR3QccsG84sHUb OdefDh0ObaP7NbbgznMeek87LarNhqYKjS1aHCDmFjFKDpS04cOHhZEjh226TuMzHirrkNMGGQ2r vg0SCkbbGrN28pMrPP8l0zZhoLZZ1o/jfArGSfsSN8NaesQWry7kJIA+ctQoA/w95TSlphQaAeDF y0/HMBOPlkELQSvwc4AeoE97pE2K2aUlGDI8oaz11CdaDNd7narIEU6yUXRgJ/ekNvwc9AeQACzQ AfDCtBibZDZ35jIXaKANv9GG87QB5AF12nAd5wErxkECBzTdIe6JeozjDnZ+s2gstcG5TBunzUEP 2hmHNtDBOKyVRz3xe8E4smF66CuMwcepU0eZx3p7AeM9ayHpbbTx+JtxvAQK47h0z2+Mw7q5U93b 0BfrRv+sN4evm2eR+xrEx/G1hNF5IADj0Ia1p0qqJyk6bbTxcdyExRyhmzauudRSKRvb711als8H 2vwZ8/mkOfBL8oxvaxsU+92yS1mI5tP/WhmG3f+RzEeK4z+yQujRvE6oohDKLM8WL05IVTEIMgts hhN58hjADyj7EAbQGRDmE/AFuNyxb7kdAhXbP4KaUJksbvIVOPBfkMDGNeRAeNl5ryVFTgfn6ddK iuifmUh0wAQ47235zfMnPDnQnjUR63Qwhl0XQyo/x5ycdqMlA4bx775sntFt8RsZERozjpU/Ubv4 Phesnc1bA/AdGqH7hwzAsxbMm3ly2HxYYwhSf2nz5xwVHi4YP14C0Ze2tkZL5sZYW/W5WRa5r3Fm Xs70oTue5OfBGdDyvfr19fL7btv2qg2h0tdeO0nJ1NXt/vp98TUq6pProzWO9kUpEfPghfacCEDO gT+eSR4Ps/RcAv/NHEKSiItz0HZvARDHHgJ4P5IhngAOAOIZ14DkRq02jAvNB3rd3MS1BaYdXcN1 nvkM+MDkPNPZHmb95m3sxmTMJg6wnPdsaTfPeD+M4/Z4r1nlGeKME48aYkwfJ571vlnm9j5Rxrjn fdAGOrz8u5u64lFYMGrvG/oZk7HRojz5kPMO/j42c/B7Fh/Hs72dEThDQjuBNmek/O60ldaLQ0SJ 98N1nPc20Ov90CZpUtts/feJzGdOL3R6m59CaZL8fO3jniV/gl6065/7PIx9ZGFoXnVtuP43OaFt o1xli+8RZYs7om+r6hF7keIOzc2+R+98dBiQZb5nPj1LOQr7jc7ZqYxT1cCPP2PtCrqL9xd1v+m6 +LhOp48Zuy5Oa8Fl8XVJrFGcXh/CaUyz40OT7YWeRn9Kpd1C1zG2XgUkZb5sNocU2gHzpk33FyVY CTZfo8Lmb91k7kdh/om0tn6v/R7CLJo2bZQJrNh0b2OPTpFfN2ke0eRKxDyKHGUnXOBgGgePpZRz l4mEkFn/3T+5HpPIm8rzoH5Vsr4W5/G3YLbCvAaDjCfq8R0zD6YVN9nFzwOOZEID5mhPnhfiS4MZ jigJTC2YbTjitGHKItAAvxIAGz8YZ+7cuSGnao7U4AOjG+leycx3zGhogvifPCzW+yCoAdMQmhS0 M2583TA5ksiH+QwTV5I2THCYkTDnJSshMxZ9W2Vd5Z+gISXXhXVlfVhXNLf4eUxoZL/XkXZ3iGhL jo3Jirk1a9pMOQxNfrQuO+HR22xIXvDdK5QNX3+fHwbd82GY+XZeOL7RhjDisD1DfTToSjkW8WIR SNuRaezIeZOBzUEuQlEHPBGpnYztLR08roSKWpbzdji21B+g51nkJu3vrAONT/NFEyD/JCVQccdR prGtqrBG2BoneZwgtI7IFLsNmseOm+F27lkzRbrGf+DhqT4C0ipVbQFQwkX5O2kvxw6PT4RojXhd LfpAgsYvABAD8MkwY/wC+B3Y/jLtPOHJvgdF2qy9cjD9er5F/DqrEyT93DeMip+DMUEXZh4yzJvK ZxA/oO2pp56STbbbjzLXWQcSJ9EiAWr3m3h7xoNp+rrBXJLJfPifaIu5jfbxA42ByrpkvaeZKvHB cF86H3VUaoY5kX4wj0aNG23nh2XbuouEw1KKiikb5i1cEQbNWReW560KEzvtFvq1zQ3VaylnBsT4 GR7UbeLIySnaWkCmNLkI2eW2LJeuVqgsEUo1alTfLiuyatV3VqKETPW0Y5m2BKhatbro2srkhu1C 3eadkF0OAGerLtfP7YgKyEa1DX8xmkfaTQAIAeknn3zSgDLuIwHwcFp/IOd6trQKr7Tr/WBCQSrG 1p6WYW6mHRZQIk+q2giU6AQlBNIOLwiYloXN9esl5sH0WsphniybwnlnfnwmM8wBfvI/cLinlT9x 5zxtYQbxYAVoxqQIY0xqBYzLQ0PS5QcfLDCGmta/V9pNi55jLTHxsYEUTIx7ED84j9+otQIf0jLM 3SzWtEnTn8x7B+MoTwKHjqmvfB5GP6ytCVYtCZf+qlw4Yj/lMIRsMZK8TfagzLMRn0DcXLQ9JhbZ wR0oI3NhpP2SlwDAUzgz0lgBsmShTBhhZOoNciBfYm3++Mc/WjIe94xkN0Jp3YTpZt5HHnnEyvxf dNHFJhyQAxH5rWQezoja5Irce++90p6fU17JFBNEYDiRWUTmTX2BJjdt8pu/Z5EPMgpGKCMRPhL4 8pUYeasJYyTn8Xtkxo3yWYhiGjLkNDmaR8iZ3cHmDU08/7Y9rfoghJfvvmaRWZt3V3GEGXOXC5e+ dtwngJS18jVknSJaWXOKj8IoyhSsO2NOUMgwZvfTTjs10zbyBdKWrHuEPt4Bp4F5+Lwj+thBNPp0 WqADemnjpvDkvd7W54o5IWjTf3llfRbKPHghylF452d87KXkpY4dDjGwSxbgM6f+IW1DnZpV5e9Q jH0C5Dnf7agj9AKgs//YvsBNPEJ9c11lJVAlj5ycyqF7lyNt7LTkx1ZNG4dcFa8rbOvdZo0airaB oXYhOywe1LJp2HfvWkpEisxK8QMndr3ae4QFctA23GdTYUK/hnYnHtfHHvjdEpIY82nTunn4VFnE +6hQXrL+FJLHoe3aiLbq5p9JA/jD27cLhx18UOoeLdVUEK9/n2MzDn6FqySO+nXriLbekhLTpdx2 rVuEJgq9TN6vnfWYVsiWzy+rdMhbuz6Me+LTMGH2J6Fn/fVh4H7aBkCVnr+RqWC5Mo5J4FsrTyvS Mdow+68Ajg7akb8nCkWO7Pnb5kWPGAT95RuTdh8h0YDcU//7W+1GSfgmwRQ8iwgTPK/QEDHy3WVe xfxaJtx1150Keb1CEVW/to3goB0TJu+I76WCtg6gzZz5kDEMnrGVKs9vmdLKVYCmSpUqhueff96i BNlvBvpgCDAVnie0T/qmBpcDJZueAbxRUAwAXca0a+gnt+Oll16yyL3HHptlZW882RQtmLUnmnLO nKcst2LFipUWLVhVZt8qSqTkN4CXeXh+FAmSfHemyPuOUMTzv7vySCJGGDE4xlql8CbWlfIf0Mo6 EsoLnVyDxky5kJp6b8gZoRrAo48+ZlGiFEJES+ee3aKsdLR56s6xVtFWCqUsqIXztOPZZ44Idwhw EaNarzktt7UlDBmmzb3mntaoUdOEUWeCxXtXIsyLGDpmqiix2MP8zYyf1pEFDWikJSoS9vbnJL8U b7if2lUUXsuu2yJ8q4d4vuaRfB+56VnV9gsLV28IG7/W+fiBnTQrJ+SvkeShh3XjN4nzujY7ew9r sTSlbxY8u6IyvFUGYcN/fty2bFlFDulB+zKlLX2WKaubo93SvijkfHZ5RTHl1gsfrxEAffvj/ktr 3k3qtgzzv+Qh3/w8UU9lyugBk4lh4zI5rgkjScy9cac+cjDmh/kptNM+q/p+4YNvtW55Px47K1vR VgKNz1La8nvZstVC/jpJfWsUYfbD5u15ictW2VfPXXqSYtksVXLVZkjLUvr+bz9/vFhfrNZOmno/ zn10sebyfTi/7cYwoE3NUGNPRfGVzrbiduyUCUACiqtXl82YUdfai7lhQ6QVRFFikbAWBVSUfDae AzVjxjQDSoCnb9++poETMg3oEq0IA3n00UczO1FGlaXvuusu5Tn8zgDq7rvvthI5RL3xPOPnAgTn zv2bgiJqC5Ajsy2MAWbi1Row9RIyP2PGdJsrfiyiDE855ZQCLRcQJlqOsG60lRNOOEHh2p+bLw9g orIBNOOz4zzgD5jjhzvuuONsg7L77rvPfuvRo4cBN/0tWPCBynHMUgTnADGU/zW/JaZTwByNCWY3 bdq0gh1QKTXCb2jap556anhQ9boA2pNPPlna0T2WLAmIM3fuEwxk0KCTbedO1uTFF18wMy9rDl0k S7766mv2Nya07t1/Y5uvsQ6Mj/8VTShKV1hq68+64fuEaRPu7ltj0wYTMZ+Yrnv37hVmzXrMTOn8 xtzPOOMMsxRwr5YsWWoh7mwDjlmapNFvVFYGqwq+za1N3o2YB4wjquiNIAADZK25f6nMo4wuzq2+ W7hPKvgz762IHuaSP8s7uSUcdEvUF3V+R5Jf1NglP1/abGnsmRAl8G3NgQrPA0MrJJj0o+S0FU3L juy76NGLewVrvF4MePmaDaHh7uvDue2zQ5dmdW3vjXxJalRmdfOPByUgCbr/jd8AJNc+4mHGJa0M AO0AP+ACSAG2MAAADnPSWWedZYD6wgsvWMACQAUAwTiQcl2iRapFKuYTMIdGzKOAK5UdKANyr2pF kb/F38wLUAGgAGOvVo1ZFlC97rrrzORBXpObRpH+YQzUkIPZPPTQQ8bcTj/9dANVgJRIQegdPny4 0TJBZedhKGguzK1Pnz4G1GgeMJxZs2YJsLsbY+Q3xub7jaqzBX20Y33Gjh1rpq5nnnnG6Gf7BeaO tA5DBHQx+3KOwBfux5lnnmnlWxYsYMvrtvYb60xgysiRI40JkOUOUAP2d9xxh8C8iTE61hrGAdDD TLEOMB7rz3zZdgHhgihIGIDvmEogDz4+CpX27t3bzNEwmSFDhqiW1dU2Z54bdjkdM2aMMSXyzwg6 gV5oZ4sDhAXm76bDop7xuEVhE/OItA+ehy0wjxCu7LVf+MNhe5kG8jMJCilqPXad37UC23cF9GKg la5VOfSapVeFRntVD+V2j3JckAo9wo4X1vOK4pIcIOY2ag/f9s9tITRyapYxsEDqBJjYWwaQA9gJ pQZ4ATPogiEA7AAcbQFbAIJ/AKLnHfmmXZiOYAKjlOuFVI22gtQe+UIqFPwDyIgkJJkU0Iz8ZVFu FoyAuQPUaAxeNQLa8KPhv0DLgYFh9mE8aGHN+B1Gx3UwEgCVyEXXDABm1pn+yUGjT7QNDtrhcyOI BZCG2bAWaEZI64A+JiQAl/nC/Ig8JKrQt9amH682zdoA8Kwd2gv0op3ACI5S0AcJrow3Y8YM8/PA KFgD7jPrz3MC04QuipXChGEgMM0pU6ZYX1zLOL6ls9Pv9wMmzPqxFqwra4emCyPkGszL9EsfxWUe /vz58+oMhOfKGIfuQ6E+j9yquwX+7Tp2rcCuFShqBXYPG9fJAV06iqZyh2XcRuxJoJznReTlS2od rm1si9ZB/7zcjOHFJxkLzQLQwjcBOAKwAAzmEkwyACR2dg7KBUG7b4MM7dAKAwCcqBAAQ4BRoI1Q 5w4A96RNL1cEMDIX+mIswM+3P+AcoEZFijvvvDPa3jjjc4F+GAb9AN6Mi8mNeXANbQBM9qSBYXkC LkyAfgDd8847z+h54oknbL5I6PwNM4OR4mtBOoeJsDa0xQyGtA6TmzRpkrLS+xkzYR1ZT+j33Cif B2vj0ZzMByYD/b6JGuvN2qCNwDy41qV6fmf90bDQDBmP9eV+YKaDgfVShWnoYa4wLO4DNMD0YVCs CXNmLjAh5gjj4ZO1IRfKK1qUJIHWaY3MVtE/FyZ+0dFWRb3yu87vWoHtsQL5+aoIIGevJznG1Xxe bn9pXYpLYxx+zfbQPDyvB1MFoEifmIYAcACJlx8fA+CP2QggPOmkk0xCxi8xe/Zsk5gx+QBCSNy2 z4qk87PPPttCrdEYADmc1EOHDi0wRwGazAXg6tixo+Uo4RPp0qWLSdSAI+sAYAOAgCNSN+V2GJO2 gDQgD/DxGyYhgJHrzz//fBsLhgLTwkcC7VzPONCMFgXgjxgxwjQOfB7HH3+8SeFcyzk0JtoMGDDA +iUaEymfdXL/DiYrzqG9mQ9T39EwPLiAZ4e1wfzEmsKkoO+ee+6x/tEEYLKsMeYpTE2sDyY66EfI gIm5GQo6Bw8ebEwM8x1mKMyL9Isfg3EZn7asEevL/WVjNExhmCXRtDBTcs+5j9DFGnM/PHpta575 pObhgs8vPlR3axZp17W7VqDkK4CDO5PpEXMwetinS2rOVABIXmQ+XSOJMw/zN22Lx1wTAaRHj6a2 EZVeNxijgGHgI3Bpks/JkyebZgAYAKqcB2w8mg1JGcc1BzRjdwfIoM8jrgAy2gKGaAWdO3e2vzFr +TzHjRtnDMjnyTWYbaANLYFxoANA5PsxxxxjdNIecw7gzgFdmN9IUJ04cWJBJQLX6KDhggsuKMh/ gkb3MdGOMQg59vwol+QBZUDYncr4Q/wc5ZM4oP/3v/99wXe++Hp6lBbgDUOBbjcTMXc3XdI/DMyF BNbfJXrmffTRR9v6sU4wFb572SToHzRokLWlf/xX7i8bNmxYQaFY6CbogTXkoH+u39KWF8ln358R xkozXRkTUaOdnzVT8rd2V8tdK7DTV8BfLghJgr4zjE2x95EmArA444hrG9vLdOVg6kzAQcBDrx3E PXeBvzEJxRkc37negcTNYXH/jZfDSZYm8lwHZ6D0kcxXcimWT0wyTqO3dWbBec9Fgk6/lrGdFp9v vA/3FdDG58JvtMN/4r87qMbHcUDnnM8//t0rMsTXxu8/83SfTpRHE5l7eAb43dfcaaGdz8vB3u8P dPoz4VFvXOO0eJ6NryHtvBRT/F5vDePwtfQXK848/PmAb8A8VH9RmwFsa2D5Tn+FdxGwawV23grE QT/+srlU75RtSk6LksIcOHYe5ds2soP1tvXyy2udXJf/xjrt6DFiz7W+llr9/6vEAOUV8czeAAAA AElFTkSuQmCC ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/image003.png Content-Transfer-Encoding: base64 Content-Type: image/png iVBORw0KGgoAAAANSUhEUgAAAxgAAAMrCAIAAABF8aMwAAAAAXNSR0IArs4c6QAAAARnQU1BAACx jwv8YQUAAAAJcEhZcwAAIdUAACHVAQSctJ0AAP+lSURBVHhe7N0HmC1FtT78vzkiKJJEguSsiOSM 5CRBQMmgIEhGQJIoKCCoCCgZFEFEECRHCRJVVFAUQb2KAeM1Z2/6vt/MC2Xbe89wzu49MJxT/fAc 9nR3Va1Ua721qrrq//2/elUJVAlUCVQJVAlUCVQJVAkMLIH/r15VAlUCVQJVAlUCVQJVAlUCUy+B EfQ19aVqiSqBKoEqgSqBKoEqgSqBKoH/rwKpagRVAlUCVQJVAlUCVQJVAgNKoAKpAQVXi1UJVAlU CVQJVAlUCVQJVCBVbaBKoEqgSqBKoEqgSqBKYEAJVCA1oOBqsSqBKoEqgSqBKoEqgSqBCqSqDVQJ VAlUCVQJVAlUCVQJDCiBCqQGFFwtViVQJVAlUCVQJVAlUCVQgVS1gSqBKoEqgSqBKoEqgSqBASVQ gdSAgqvFqgSqBKoEqgSqBKoEqgQqkKo2UCVQJVAlUCVQJVAlUCUwoAQqkBpQcLVYlUCVQJVAlUCV QJVAlUAFUtUGqgSqBKoEqgSqBKoEqgQGlEAFUgMKrharEqgSqBKoEqgSqBKoEqhAqtpAlUCVQJVA lUCVQJVAlcCAEqhAakDB1WJVAlUCVQJVAlUCVQJVAhVIVRuoEqgSqBKoEqgSqBKoEhhQAhVIDSi4 WqxKoEqgSqBKoEqgSqBKoAKpagNVAlUCVQJVAlUCVQJVAgNKoAKpAQVXi1UJVAlUCVQJVAlUCVQJ VCBVbaBKoEqgSqBKoEqgSqBKYEAJVCA1oOBqsSqBKoEqgSqBKoEqgSqBCqSqDVQJVAlUCVQJVAlU CVQJDCiBCqQGFFwtViVQJVAlUCVQJVAlUCVQgVS1gSqBKoEqgSqBKoEqgSqBASVQgdSAgqvFqgSq BKoEqgSqBKoEqgQqkKo2UCVQJVAlUCVQJVAlUCUwoAQqkBpQcLVYlUCVQJVAlUCVQJVAlUAFUtUG qgSqBKoEqgSqBKoEqgQGlEAFUgMKrharEqgSqBKoEqgSqBKoEqhAqtpAlUCVQJVAlUCVQJVAlcCA EqhAakDB1WJVAlUCVQJVAlUCVQJVAhVIVRuoEqgSqBKoEqgSqBKoEhhQAhVIDSi4WqxKoEqgSqBK oEqgSqBKoAKpagNVAlUCVQJVAlUCVQJVAgNKoAKpAQVXi1UJVAlUCVQJVAlUCVQJVCBVbaBKoEqg SqBKoEqgSqBKYEAJVCA1oOBqsSqBKoEqgSqBKoEqgSqBCqSqDVQJVAlUCVQJVAlUCVQJDCiBCqQG FFwtViVQJVAlUCVQJVAlUCVQgVS1gSqBKoEqgSqBKoEqgSqBASVQgdSAgqvFqgSqBKoEqgSqBKoE qgQqkKo2UCVQJVAlUCVQJVAlUCUwoAQqkBpQcLVYlUCVQJVAlUCVQJVAlUAFUtUGqgSqBKoEqgSq BKoEqgQGlEAFUgMKblot9s9//vOPf/zjn+pVJVAlUCVQJVAlMJkkIDb9+c9//r//+7/JFn8rkJps Gnma6fnd7373yCOPfK9eVQJVAlUCVQJVApNJAt/97ncfffTR//3f/32aw2RP8xVITTaNPM30/P73 v9dx/qNeVQJVAlUCVQJVApNJAt///vd/9KMfVSA1ISiBWP/whz/8/Oc//8EPfvA///M/zTb8+dWv fvWiiy76zGc+89BD326lBE1jefq5z33uO9/5jt8t4h577LErrrji9ttv/+1vf9t69Le//e3uu+++ /PLL2dh///d/93L161//+uqrr/7sZz/7zW9+s+8LEyKIYVRagdRk8huVliqBKoEqgSqBxyVQgdR4 Qf5rX/vaddddd+ONNwIulz1xff7zn7/33nsDjH72s59BLZ5AJzfddJN/PYWcQKgv3XvvVVdddckl l+yzzz4777wzRFVagglAmY022ugNb3jD61//+m222eaaa675y1/+khf8uPDCC9/xjnesscYahxxy CKT1j3/8o5QFsN73vvetvfba6jz22GOlE8sjk19nn3XWTjvttM466xx22GGIaUIlv1H4oQ99aK21 1lpllVXOOOMMqGsYCOf/++EPf4j+n/zkJ0OpbaxKCpDSEAm7tNvqx+7kkevHT1xMPK8BoHlEa970 ZylOjKWggYUm/KvgT3/603I/P5qlFPdaeUEl3vdvqoWeNdQqok50teosvJQizRcQ02SzkFS4UCov FPbHKlKqHYeLsF+4KHIbp0iptqmRJi+pEOXRhX+LEsO7yr3fl33iGp/9JuNNuWEkBbsoUfEoMXoM F6m2pcpwUSTQYj9SLYwU9ptKHIv9YsBNXqbchovZT4n2mzbcW7DwHkb6KrEYf2kuvcm/hZFxbLjZ E6eqCzd74hTacEht9ketFyUWvTcZaZriOOz3dUSlbNhXf+m5T2rDKVs0EiKbXXIcR1RsuNWFW+w3 u3zT7J+U/XEcUdMPF/bDxVDYZ1FNg2m64tJcs1vFPzfNeAqVWGy4pUQtRokVSI0Z/WWJ3vve9840 00wvfOELF1hgAYgn18ILL7zEEktYXKaktNByyy3n5uyzz+61Oeecc9lll3Xzv/7rv04++eQDDjjg 9NNPf+UrX6nIf/7nf5aWrr322le84hVvf/vbrZaDDzbccMNXv/rVX/nKV7wAn3k6+2yzXX/99X/9 61/PPOOMeeaZB25Lyko+CUjafvvtYaYf/+hHiy666HuOPDIITIvnnXeeer785S+78573vGfJJZd8 6KGH0ihgd8MNNyy00EJIYscglPe74x6d4dprriGlOeaY48QTT+xe4Tg1BEjpBuTz6U9/GkJ98MEH m5GbK3n44YfPP/98cnB98YtfJIo77rgjDgKpV155ZR7Bpqa0wdx4dp3kgQce+MQnPpGnFDFa9ksq pAUVeqSIfz/5yU+Cp8X96ZBf+tKXUsrTb3zjGzfffPP999+PKu9Y0SXjePHFF0OZpfsh5p577gGU zz33XFx86lOfUhYv3/rWt5T67ncfgctVpVFlPfLCbbfdVnwcLpCUFlWiCfTgRXOKw/0XXHCBFptF Hn30hwD0p0bFggssqJ8omlFNwdTp8psBE0JkS+ZAv4LNIujxAvpxgQyN+uEdEkgp/7q8kDqNRjxC hoLaxcUXvvCFPMIprdGp5CtGZGFzE/vqVDNdNNknzBRUufexr0LSQ2TEVajSaxREBsuPVXzmoouK EpsOES+F/Qfuvx9thBAlirLkmackoEORf3jEBdryiFTziE1GF/5FfJ4aiTEw1RZTdCePvPPdRx7B FFWSwKWXXhouLhqVrad33nlnk31Gm4Kx4bBfbLhw8YQNf5kNE37LhjX3pDbsBW2xFf9pK0pBdniP EplZWvQI8Rr69re/rSCCmU1s23XLLbd8/etf92/RfsuG0YOXYBo1EGYKSq7rLHfddVckkEx8HlF3 jD961BNbNoy2++67r9eGm0godao/dbINhoRHtuqRtmItpScWDUb7TRtGDBtmA2Hfn8URoYQ69Klw gSSGpE6mnvdzs68Ncy9F+0g1Yg+p7EQTo3p8nP1/s+FRYys2TLY0yIyLuJruyJu6MHnmfY+QpIiM QIv9aLBov2nDIUZHVpbJMYaiRB646Yc1oWbs4yXvh30zJChk86UL68iYKuxTcXqHK2W1qK1M7LQc UZxwalZDNOiiIz2UQyg9ccptmHxuvfVxCShOmKpFUmy+Aqnxov/f//73LbfcEkK6/bbbrMnPxSzm n39+cV1JaZ6/jN78wAc+8KxnPQt4AmKSBzIlpzjrn3vuuQGp3/zmN6UlwfKlL33pQQcdBB6BOFtv vTWwxWskHbXvvvsuvvji7Maf1PyiF71IXioJMKFI06eddprf0lQrr7wyLEWF/lT/W97yFqmmEMYK X/iCF3z0ox9No556BLGhZ4hfFnCIr3vd684+++xDDz1UnuwpAFL814EHHviyl73sJS95yTXXXO3P OIWETGBuqaWWWnihhYhljz322GKLLfbcc89f/epXuL711lvXXWedRRdZhC5WWmmlD3/4w8AxRwZF 8RpHHHEEmSu42GKLvfvd715zzTU/+MEPgq0rrLDCXHPNBYCyAZKfd955vZYwqaAutNdeeymioPvv f//7l37d60g+qQuecdVVV33BC15ARGUMhBh6f/nLX+79GWaYYbbZZkMqsM4p4IXrf9WrXqU5jb74 xS9W82yzzso8fvnLX9JynP6mm26qCC5A9o985CPzzTefKJVhlkiGSC2C2jSeEGvMJH+p2kUWWYQt veY1r1HExdkFKHBJBx98cLhQ85FHHsmuyCeDLS5ygw02yFgiEEGdv/jFL4479lhkG1H4l/Vih1J4 5OSWCIcXlnBFpzq32morgmJ+CnqBf8RUuCCccMHhup9RhwEJ/apzlle+UoZVqYQu0WjDDTZIweWX Ww6RCtIC6c0444xYmHXWWZGBqpfPNJOkLLlpjhYMMKJE75OA4kGf2CeH/fbbryjx6KOPJlgmjX0i 5dzZANG5pJDZudrU6RFshLYRYhZaiNWxvQUXWECM9FS1Z511VgZdXnjrW9+62267bbbZZmEfwtt8 883DxTLLLHPSSScZLAX6YF9DhiX8A/b9KTONi4R8kWzdddf1QmxYi9ihPtIGXA4//PCiRB6DDZ9w wgnGb0Z6xYYpUVuGWMWGWek73/nOpg3jBYBjUSQWcZFblLLmGmukxyFGANtuu+0K+1LdC8w/v+BK MsLbxz/+cZoN+6S0yy67bLvtthhRHDQsNsxCKFETohQuaOTYD3yA+mKKPOHGG2+sv0eP4t8b3/jG sE8Lxx9/fLyfgoSgW4UL/xpGrrjiiuyq2PD666+fLhxHUeCX+G1AGy60q9crLjqSp84ecek1XqAU lagw7I/Y8FZbFRumRLJin8l5cLyvfe1rw776zTm87W1vix694A7zNpbWnZOndJPlzNSy4Ze/nF8q 2gcCVl999ZiiyQrTEfSYvsaP7bffvoV9Nsz2WGByRSycMWAfgyyzmQbDznHHHccdecrm0xb6AZG5 Xj3XggsuKHhxRLiQKaC19MSWDWuLqClRZMRI/DDaih9+85vfbFomlSOAPahz5plnJsPkm1UI6unC I11+lln8iGM55phjCvtw7aqrrBL29YL3HnUUQ+WiNZ33caHOOCK4Khkv9Bjn6dEjulhkERFBZyeN 9EQ2zCz/zYYXWECQjQ1/7GMfKzZs/meHHXYQYTnwEMyh6aR8uBjtzwqkxov+4EuAlJEBxKO7wkZc MD8omdQsyRwBKaJvVcdSe4GUtU3C/CabbCJ4cI6cgqQONKas+gFndiBppHWRiXHQWYAUxXMfyTNR NhfJCFDlTxkyzovfl2pyMWWGpbMFNumlYjacl1xCc56xC/rRkHZBRi5P7+1S1ZOWTUZKLyUE/WHp pZfmKZiv3jLiGr7//TPPPHO99daLm9CLuDZ+kGfUFbEMTPCPnE5GPzq/6EJ0auC7xfVgHfoSkGAR gUEv5Q1HU1/f5CbEP0gleIIYlZXeE4SKbxUsn//85/MIJYWuRTrS7cXIuG/9UBGuJMlF5HElvIAx FpqZGXeMPI26iVquBP7AguK8G1+Ga6SiAQGrrbaaWCuioyfjSLETzeovySHkgQKEQ3oCCXvjvrUi giqliKiz4447JkB6mSo5HYOtcKFagFVY0pZ8W8TLDXHxkAEuOBcxzJ3ll1+O3QZIGXSy6tCAWtyh U1D0vhEhaRNvPJ0LNuLpqFX6gZz5fSAMwkDMuw95Ny+scvV8/etfE8nE+DhrvQDgE1HwpX7icp+4 wD7oAZTkMROAmYp+pFrs3/HFL3J82AcQkzmAmyku7PsX8qZEBGgdLMB4sgJ0wcPCo+TgkdaFRqAz BSkRWOTZVe5N6sO+d8K+1pnNQe96F3rIZIvNt+AoIijEs8zll1+e0uUGhC4GaaSEtV/+8hdYAFai fTbMYNQcG1aPUoCF910GcqJ1VIY8gI8NizEELqQlfcsRCXXiMf0mXjKh/fffn3spNvy2XXcVj73j BeKCDCIub55zzjnUpAmtf/vb3yLh9x9zTNhXFWPQp4wGRSD8rrXmmoGq3ufQBEVxCDGxYTF7VIkj NkyDZMUavcxB8YqZk0USptDgJgnofdYk8GOZJjZ4oPF0RjKUmGfz8G0KCtstG5Y/iA0TcsmCMAl+ 2Cgi7CNJWFUtO0cYCEX1unzERWXoDDQhTOoGAWPD7rBMoDAZFMZDp3FNXuCW0UlWQSFeZues1PsG XelimqYjIIC4OFJdnqxImHai/bvuuhPxDJKl/ejRR+kRzKUpsiJnuHn3J2xYDcA3tKFTxKelP8Za aLPgyBDD8HR/ToMvUlVSODqjnkjI4AuqtMKxBH+M2t4DImDThqmGio0DlT3j9NP54VGkPtKhYEqo kasMJHJf1CMftsQ9hjw0y2ARiPeNf7h37Ov4zDgtskPCNxhGiYs71de84DXDV8L0Axf0zsFKGZz2 8Y9HNfTuT4yohOVgh2R233131TI5EmZj0b5qWSYbpp3YMH75h5DHYilRaChKZBts1ftSj1K0qaEu Nu8fx8EXSuVYRQg9kEkxNTd7d4wAWQCpU089dUqAFHBjdLXkEkvoq8K5WJt5vVxSTaCJd5g41cJY NJ1Hcl2QFm1l8k5nZpSZpPO+gn4jz022xY2aAUxBTv/Zz342EMZuuEV9pjx6UgQzJS88ZUBKb9RL dU4dQ1/ST7KQgu+DKRMdPYqzyFd+pAfKkEacoMv7egsP7qkOQ/7u5JHLa8Yf3J8+yavKwKs2iR+h 1A9dS3ciTEIudabaN73pTd7PqJRb4YIFPGlz/S1jL3Xy3Zw+E0IVvMsFcIhKjQCpe+9lEpy4nCXu AALIgI/GtYIch8iNndCp3wpLuACk/Km3s1JeA22QjbgVz+V9DFo8x4/wBcm0G21L5HgElq226qqJ zbkSmBWM1+NukEdcN914I/sn0rDP32GWHUq38OPwdEnkKMLLg2tFqljTNXDtNcPxvffeO/4xlzoz npOrEOzdgZZ4VdBZzTqgl11wmOFKU+ApmCCESEk43VAQQhX8kUEwsQgScCGysS8eI4yQH3n4YXUK 0mJAwEEuv8lZhEO8OvXTIhyPEOapvgN+QZBNLiK3xHjs0z6OUqeIElNED728613v6mVfc9qCG7Bj Qp8eyQqQIl6lvM9aTmrYcABE8pRmQ4RJEbZwERsGyJgNrbEujmveeeZhMPRIDkHD5CnN1hRpuAhM ZyR333UXbJREDjwE3WpOnbAXPRZTLEr0mgAjVmmo9MRAIuow+KRNjqsULFxgX1+mKa0XLoyOShcW Rw0Gml3YkGDtN76Rdtiwp1NkwzfdRKfFho866ijj5F6LQgCoJItJlRwLdrwDN8gC+kEd49iwGK/X 61y9jih9Sg3qoTI4O92EnVA6L8GDGWNDBpTCP7BhflVznhoLKVIMFbOsZb1111UbG4aQmjbc7MLI 4II0BBuBoSScWa1cKoc/9DIaAdRgZfUESOkjOrJcLx/oNZ5KPozN0D7CMnaKprxPXJ5yRMTl/QCy XGr2cpSuRYrWtRkkqgjqy6OjlKBtTlLPMkLTxbBPNQjTNGYZHvlkBDXaoR43fjSYCeEhvc/g999v P72GeClLc2yY7sCv4ohKwQxojaDGsmFDmgxQ02KJJpGbUmAWgyRqTeA6CK8CqfGAlJ0Y5HXnmXtu yaHMowXTcNxJI7mmCkjRIgzE41OJUZE4x8tkSq5cbMvAXQ/xcmsyTtPMjqFbxND6GFBxRgzv8/JZ xZXLGAXOE8mYlEGJcMX79H4POCWYqe87TxmQInOR7+Mf+xiQwSeaW9TNMAXiCA8jPWx0gOimXsfL xO9DG9xNBhOuvAMeJQjpwOnkBT2QIW8rMoFKmfuHnzgXouMvgiTEBpDu16OZ3lZBfyY9LhQxGP4L KkoTChrWmK0QVIRG47xAQzkAxIi+3BnCjCYlElAOMnIQyvoNuHD9gUeFES+Xvm0ozOGCEcI8Z0dE HhGC4SO8qJ8TkbEdRrTCj6vWNwf8jh8BAeSGDEWS9CIlvIujeIFyOL54Me+jnBtiYyzNmJ71yknA K8ryvxhvrm9IDgCpuMAOIOVHwFNpUUEoR0TUBKW8YZllBBWRHu4MkCIljUaJNK5g9OuOjkCYICml yG+RLQhiBOKR14QlwFRz2L/n7ru1EiF7Km1JoU2Rap32E4q8Hy9cpB0uvA8MYVyLvVyIvtgPusV4 0xRpZFRcB2WCoMk+kWqLoZK8MT0gJahgIaEUqR6dcsopJRoV9lVlNC/SJDnUY8M/FmayBguQQhsb FgNiisTlaS8XpEoIJAMV0TsDwIhUKwtEXgYDxmZ9lZisKiSR8JPuRkoq1FkM4jFVZnmK9qPEpFgU SReOKY504V/+kpMU5guPox19BO25ExuOYYxjwzSCFwEyevG+mL3F5pv3cqFFvWOVlVdWhGMRKXGt cwnwHiGeDSf50atEQEoupyxbbGo/CEapwAKcepO4Yga8BBvO2GmjDTcMjIYSaFzrfFRJEjf7vqds mG2EmF723aELwQJHEloknDRVLu5UEk7iRyCTBE0ilnz0dz1RQeh2icUXd9NiX5g+jkhg0uXTYrE3 BpbBQPES5RFfGoG4Q1+cIV37HaeKQiSZS2Eb6OEe37zllthnYwarWiScDGhDuVaavp2HFNfMsfh3 v3335YioSY/QUPw2pZNwqyfyLWIiDxZTbDkiSslQs7cLo5Yx6zIRFyvSO/SpkUxhBVJjAYhkpCTJ E02FcELPy6TG0Hn8gNAAKZ6uVRU76J3aE8xMtDXXSHHZ8k+lLLMwLjFBS5ctFKU5gxj9Sv+RnWo1 x7hRxQMir/mIrzEtLT+pOFPjTUwTNNe/DwyhUvCpAVJxxyuusILOlmkgaVW2nowUpgxh/WneQd6F RyMoF5VBlvpbEy3F6STHQJiZE2n6hXR73se/33rwQR1SIsdNGnFH/6FxoV2I61sQGXwK/O3fU089 xYiQfov3Z0s0FSCFKq1k5I1B9XMckt6AFL6sRM5iJu9DKgZ2BQ6m3XhnL/iRpQmCpSUpcpm5Hy6S vQgyYBvhAtcGVYJQhrPCBqG5JCHILTNTJGloDtgx9cCjcJHF0agKkOKPvJ+RKCCVCNEc+waWeQ1t gJQf7mRhkIs2XYqrBDHUCkhxhWklYU/Il0mNEoEhpdCmlN+4U9A7eg0gpXISLktZPcK7erCftdth X1WsQmdpGUbGoIqwKHnoAqQiz3Ch85pKy7SLYFC4QAymysI1jWoxpkiq6MxoPuyzqMJFYR/XghYg lUjgir1BPwYDQRJN9sU8qhGbmwHSO4kB/7Jh6HZ0JVbLhpPv9DKzKVygVrvkRlZuChUUQSDpDpRu AjSLftQG/ZeClJ4MVutDkMhNQWZpMIAdd7xc2CdDwTULEGNCqbN0YRNz3Fezn8bmCSQ2nMRSrw17 p9iwzp7laLEo+V1jjGRWLNJ6nItR45ewxKyecsP11wNS3o+NYX8cG1ZzmQmNmTUdkRyMmw99+9tg galtGTXLzuCnaKrYcIBU04Zpln5lSZsqDvuxYUAqXDCGZhemRBkVXZ4jAokMnjMoimGkI9MIVWJf uOFA1OlmcUTIA6TcTN+MI2L5seGm6/NOgBRxFc+TF4opKs4NQlry/VAdx2LmNE9Tf8aZgJTK9Z3M rPGH3FqAFCnRDh7vvHOk7xO4O3FEAVJNR5RBoJfpUVXpif5lov5kwzKLMcWWDd9zz908GBse0ddD DxUlKpg0lZpphLdRGy7A4oShmpHqDyTIBby1RirfzcGhZUMBWrSoTWIpd8jU3FnvGil6BaTYVnPP J47Py9IGWWwO6cNq+lWIkFHgSS3soN2WYvypN+o2mivJsEI6hGQmHlJ+5JGHW/CLnxIFdUUv/+EP v2fKggqv1BE/leJPDZBi9Ew/a7S5BssSrVmhGt4kGSlew2/DEcbtBRlES3O4D4mlU075V0aqQJDE bECqF51kPK3PJHEtNGbsGHDwr4zUr3/d8iaJGckqI8AiTdRaDikvklYSKhhGAVJxXoUq/qIAqbyc 6JUg1BwIFiCFETktzFptjXEtkhKXxGLzjkp4nACprDIJkCqjeXKzOAO1kZt/ravwgjy8xXbuuyyD ADsUb3JRgFQcYqKgcHVf44ubvK9RXPN3RvMIw6buk5otvBVdOCnOqACpMlsRgZcEnlZkaiNYpDL4 pIWaQKrIrbAfIMUnFiVi2YQvjnpFGiDFCzczUgkP4UJO8S3bbIMLlYhDhQtKz0I6/VRoNwDjkQmT apAKfO+6665wp4LESKHhAvuvX3ppcRf7TSBVuMAaOo3TNI0w2QIF6XrmV8zMtgOkescJMarY8Eia cBRDNG2YG0lGSv0GYOECnVwWBIkS9ARIseemKRrN64kj7P/sZ1IahX1ICPsAaFB46RrRPjmbn5WR 8gMZxiFNJbI3xbWIEdiI0GKKujkAJImYFcSt7hZxrbTiiiSjoBROsWHOQZ1BIU0b5j8JPzEbkEKM gsJqYV9nxzXzG0EGo0CqGHCA1Fg2zJPAK8Slr6lTDq/piAwDJFrMWPEGlB5RB3TGA/gXVQFSAUaR IRaEg+biy2KKsWEcRYliSmFf0xL26oRCGFhErQsbQsdUFJGTK+50xJxmnpkbCVxTMHmyAKmm9pOR im8pV4CUFgWXpkMrviK9WNoJ+0hJr88a37iOsB8g1WQfGQzDWA7ZupXZyTlmn51VoFZ0ZgDFsQRI pXWXmvU+wMs7Or5eWXqiSUPrz2SkaN/TYsMzjzoiXLABNuyRZLbuMFJQezPPzMBEXu+L/iNhaPaR rs3dQaIMpgKp/ohCzsYEnDVSFqkxr+aWAcIqy/M0KyH4RzqTF0lFcAyNMizwX3+mFb3Fn5mnS4bZ 2JSyQWMRQg/k6RQ03QYHqCoro5PGLJN0+qesmFltRulRKszsnsXpxhMyH2hIQV8WNfemEsh1M0YG AjIpa1Z6E1oD4ypemFMeuPiUFDRfQ87cEEesO5G/AT3/IlZlWsSIirTxbnADgxr66PCErDPI5cgS k2RmsqMyYdsd7slwVpcrj/ygiyRCImc9ir9TZzCES4uWmhKpd5LUzaXRpLjBOx0evBO6UMXXr77a apk+i2eRxBZIsqS9oKj4R5VnjVR8RFpkTpZG0iAaSnP8Gy7iapmNNIa2NM3YBAbRLqsKvBCWWV0i ROrM0gSpDhJTLZbxqELQxGDdHXIWhEQj93kK84OmDu0fq7aQmqkBVPkRLrQCECAe703JEAvhMFdL E9AWE1W/mnUHKwWNOONP+VANLfuGNyRTElLd5DRBvRRE5Ne+9lWqN6aXA4jfJElIhVIQ04ziYR+P 2DemLMN64rWKSLYyWm4p0U286/hNgeuAaEaY1CAEqYinpI0Lik6KFG1UT84e0bgxjCK8dhayWOiq sxT2PZWf5qbxEvZVDkaASmRVuGASUJdIHBumZeqgF75Fu2yYythwk4uWDVPua+adNx/HFRtmfpCN Vt2Ux8VFFnFLciQaaU4c4i4CVYspwpE8XiZYqVVBghVODM39xr4/m8SgjZRwxFqsritKxL4cBiXq v6IX1K42T1lLurCeC6fSFCcJRzZ1gTyijg3nm4NiwwQug0VH7niHd6XHf7fhh7JOmT8hZK8RlxfQ AwforWFf5TffdJNgX9BnemJsOB44NixOs+ErPv954mL88RVIChcWxhkzBIvAMcSLqmwK4GUGkKyn FkUc860bb7SRH0X7tIBBA8Im+95XSWxYnf4cVeK304U5w3i8EXUstRQhsxPKBUa5O1NtiSxcBEao htNgVBwIA860vgozErCWtwy9wj6NsOd/d0SPJlUj+pB2RkTpUPGfxOs3KxK/iFdb6OEiOHBNF3+C a56HrJrsq6EQpgk2rLg+wieXNL8ub771gP33L45oJLY+/DA5ZI9Df1IuwoSPLIplwxiJEps2fMmo DdOLQJkuHCVazs+3UApq/SBeqqdEGscFXnTSIX4RPyUxcUreefqPiCGUQw45GFoCfnV19lEWSGHA CgaT1rRu9MCB6pDkbuen8AajyH+6z7lArAGt/qRsaMxTCpCIkiVy6Zb0lBVLquUTve/+/PONfHts PGFxQDQkt+8RPM61ecSSBFfm7hFryPfS+bjd04SBAuwEEsZnRTDfJA/Ruyv6lGil9Q70pnUXaA/j +2GE2tw+dIA6xyoCTbJ7E+fBDUzcv8wXm0Ip45ZvgwlI0sWhUBaqfCqlT+rGUAuoIZywfn/mY0l/ 6pn8msUffL1HLoLi7iWfM/xVlahgUKKtTAnF5bkMnnbddZcEV5faAGsYiGOy+NesPyJDp1YMZcTC FMyeSZyjXi1mZBOdXJmEMvvOfasnm5SkRRSaaEatIprzFGFcDH4pWou6tLZGMPRjj3lZpLf6IU5E PRwQo/JmprpSpyDKI0Cc6kxziMEFZ+cdpmg+JfEyIdzwl9fOcl1NeBlJMkx+JA+favlTZZGHNqR6 JGYLJ/CQsowWJFKEIhCDsNHQO7Lq1lPVig3ueJTZhNRJLPyXhdheCEqgd/4uSxlCAI0ARmVCsEjV O1n3kM1+CvuqpReEKR4lKmvQzJZoH/3isdyM5qJfPRG/xKsGC6754sKFd7gIaMBTWRkFhYqIdOSz sve8B6YXvNXPM5jS9SPsew124eUL+2RFm5prsu9l2aPYcNhnkNgPOv/oSSc1bVjl3AsxBjTHhjkx vGR+qtjwYYcdChKhMKSSLYuyeD88elmKhe/ir4rxJ12nM4JEhX0hSjihEXaSbzaF7WjfO9gnLkBq xIY33/zkURsO+2A0LryJfeLVTzVUurBBIx9Lbu5YWs7lKqLO7HlhOwaMoMdaOlINXIvAJep4OU/h BtU2bdgQiA1jgfYBAhPNKExBlRsqZNgc9omCs8VLs+9nilbqqGnDYjYh6ymKGDURSOqMqWStm46m SwahxjlwF/ncr9jwYYceirymDXsfAVKSXi7sIxI0DzgrNly6MN+S9ezs0I/CPlMhKx0cVdQHshBa cm9IEsKADOoL6GFjhjQG5xF4eqLm0Ma3xIY9ohqdS39nw+qRPuSHUVLcKf+QNQlCD4+HhsK+MQD2 s6AwXdj3fTqgH2VqXrtZPErjyHB5qodiTSeNI6IRJMGFLUfEIBEGsDK2ODfaz+fDGGT5RxxxeFEi fMaGs4dFbJhrKhZlWSSbV5DqdfymEs1K6/v5tH+IIW8oVT39QCrohPTZE1uhiWYKJ1/Jwb8xJl2i KUS/R+LrAw/E/8b6/Un6gUT+Zb55QQcrIpNeote0OPJ0tDdyQHnBD1V9m1sffaQsy06eDA5jT5oa cV2jTxHc+jTP0qu4g5Kp6qgqTtYoH56DNSFOP4znWG3HavsW5xbl57ViAJr+gxHjVKlpXRFfVAAp omeuV7/af6AP/1Vm2XVy7snNkadzzcXujdJUkqw15wJ6pqBwK+OtYJzU+uutJwJpxeifLyurJuNr 9K6RTy9HC8KvFq65KRh4H8KjRDXoluK3pmd82cvyVQG34k/bxgC+CCbG5AnUqTeKKyOzgS97GTp1 9TKd4R265YwKF0C23LsgR+xSzdx0hrbGRtycRLTkuSgCSgL6avOO5AdfGcK8mZE3R1y4wH52zN9y yy1wIcZnTlPNXAxqVQJ5MC3xHiXZvoX0mjsmJEIgT6PRBfwhGGgrI1Rh/vEW55rL1InYk0fCqhZp Wf5fqbK7BFLVqQZYqrAvdFlpEY9GDmgjT5MXXjh6dJVu4IKCSpnpeNmoEvnfzCZE4P4V25rsS/zo vElUMBJ6LFzQbJbKIZUlmN4qBReYfwGj+RFsOrpaIh8SloL4TSjySI+mDh+vxBS9JiiGTokZ0shW OrgQ5suks6fCCYMv7DN744GmDdNd04azZG3Ehtdfv9iwENuyYVGhcEGP1ifEMBAMhTAYZkB6DK8k pXDBR+28006loHCbTyPDvgDMJsO+d7bfbvtsVZoUUdOGWXs2CNWi+mXK9aNwoWCgagpmB4TCPqyZ /Thiw2a9C/sKGh6M2vCWIza8+OK0FhsWWWPDpuc4XormJZpd2MiBZ1FWHyFhM1BexgfMkU4aUyQc Oi3EFBsO+3xUdoOL8UtDqtBQk1opIhsTeJMdskYUUgryMi1YbFivbGrfMEloLy1Sjf6I8ShFVrhp wxyR+iEGlRuT5CNKZPtmk4pxRFacgyvLNMMULOIRygG7IGOOKOzr8iWTHRs2AVeIMYbPXgZRYtJF RYlGv4jh+mLV11x9ddjnzfgiFPLMKpfOVIoz0YXxUr4sCW2YJasiUhLjl1SCeKlK73NE2MGXbhif GbPJ16CloPEG1tIT2TCkXuSWLTOKDUOExYaRLQmiOa4bFzpF3J2XMyTGhejQ+mJsIuLg1NY5KYDU 1BI9vb0vrcW5J5msryY3PqxNqlrC1DFENYGz7FrrjkDCmX7hCzdziPowm5YSuO7aa/3nMvvT9H0Q npt5qpTcc9CYns8tyiKUgnxoEIkXxDZPvO/fW77whXjSXN7BeKnTC6Cs2hTxvkmBZG5cQC3KpRCy 0U628/Enjq4f2Q96ZBOdNAfA3ejm9derwDu8Z0J+8eBqKC1mr3Bc++H9OFZvKjKSOdfkqLi8Y6ZJ Ke9oLoQ1ufjWtx4sdfqB2sCmUSZuytDQBQCp0K2sNKLrES7cuuEGvBdwFkbQoGwRafLkhQtOsLRI CKFZKUOBEZlg/6abvIDZFvuQVov9ImE0KKtRL2SIn+a8cNtt/1IippKRKkpEeVOJ2CxzDX5EEbEo jDe5iATCI7uLERZeEFPYBwKaBe+9555SMFgw7PPseMd/uFCqxX70GGKYPfKaNtxUYrFh9DRtWFJq SmzYO9iJ2effYl1FiYTcYP96Ug21+bfJPoNvst+y4fCuCOkxtmZPBJ3TE12JpoV9fV8XLkoU2sex 4Qyo/mXDN9985x13BCvLOjS1780oEftsu/REkm/qAhToa8NhX9mmI+IYBV3apFbqLj2FxEYcxc03 BxDrd2PZcNiHAgv7zdV7RASU9NrwbU84ooBRF0eXLuzlEY90443mpMOXp6XLJ03uhcK+ftcyRT26 ZcNFico2lZj1Q5Qe9rNnmMtrYR8vKieWkQPZdOEbb1SzztVsEY+kVNi3v1ksyjt2mHvcEd14o65B FM2+T5tNR1Q2QY1ImzbMYps27HfLhnFB6eGitOI1fcpNFjKU80KGiyIqkBquPJ/xtVnix+6Zctxc 8a3ulFUv+o8/y1UG0M2X87QUyaNWwd4m+paK62+2mA4cOptNlPq5gyw36S0VSvgXBcvTEkUKy5m5 K/TEJaVIiVVeLk2El5A0hVwogsjCRfxjaEsN4aIv74XO8Rnp5WIK2R+LkYFVP5YSCyNNdTQl3BRy xFIE9aR6HIf9cQx4fD1OoQ23WBif/XF4nwj2e3vilHfh8Xti04bDVOlZ43TG8dkfS4m92k/2ujTU AmSl5/bacBPxt7Tf0uPUOqK+TrLZ5QdwRKXL9GWkiGsK2W864V4H3mR/fEek7DgedcqV2HLdLS40 IX1Yp/ae8ThjmmegHFpcumv9USVQJVAlUCVQJfC0SyBAuQKpaR6HPOMZtChHKpi91qtKoEqgSqBK oEpg8kjAZK69cSqQesbjjGmeAft1+SjSd4L1qhKoEqgSqBKoEpg8EhCbfItWtz+Y5nFIZbBKoEqg SqBKoEqgSmA6kkBdbD4dKbuyWiVQJVAlUCVQJVAlMFwJVCA1XHnW2qoEqgSqBKoEqgSqBKYjCVQg NR0pu7I6cRIwbZ+rNNF7Z7DWSz1Dr7CX1C6LD3rp7FJbaBs67806J5T9wXTdt1RTCKF/KJUPV7ZD 134v10O3/1YTXaQ6dPb7upHuqm/JcCginSBNDdc+uyh3SspWIDUlUqrvVAk8iQTs1Ow4Lae12/jE q07acbSFYzGc1dDlsEX72tnYeqcdd7RtsY2b/XB+gq0sB9aHrzJtE48wJ6CVU4bu+OIXHfvgst/d YDX7RsEuz3avtkc8Iv23yy67OJXSMtXBKkwpWyOGsNT59re9zQdEXSq0+7zDMdBpk/1yMrqN/tKK vf4Gq1xVNmqnKYLdZeed333IIeXgzsEqbMbRyy+7LOw7i8k+OjYltztRx2p9/cSQUq2tGkd2j3zi ANMBarZBInMiVUpPnczA1u1dNk5ED42weVtd20PyzDPP0A80YRv65hkVU0utfZuIMcLUYUNtOcl+ amvL+zq47dGpHqmpkGwdEdH94zJgwmlFKiQK24g7u8wO44MRqZSNoJxh4BQdm5IHk9kJ05+E7BDL warlQ8I71TupApE8FfY15NTCLsjPjucU5FSDiFQTOu9gRD4FpSqQegqEXJuY9iXgNCuHQjz3uc/N 0T18vWNSHPvgDI0upyLad/gQR8AfdJAzAR1P5oczwrqACRvic50veclLnHJY4pxA5SgMB1DYWHkw VTlzid90fIQjPhDpP4dCOInC4U6DVZhSNjh2ypAzNFKn/3L81sB1OiTAqaj0AvjmGHKXfb2dUuIk HM0NVjMg5byOvd75zpe+9KWiqWM3bGw7WFWtUs7kEeceZ//gg53E7DgRG/13qZwA1Qn0p1rHnjh6 RTgcuE6G5CAjx3c43jF1MgNa63JGliGEI0foxZEvtqp12Da7pTiUdwmodph0UiQKHSrHPiMEu4cP zLuCOrgjkF/6kpeAj2Hf4TxOZcm5rl0ux7nQ+EidBx/s7Beqt1/5wBVC4Q6we/azn+000oC8ww87 DAJwmKANxAerFo/GJFQP5sJ5tiF0iJCjopz545y+LkDKMXxOlUFb6fgMoHUa22A0T0SpCqQmQqq1 zulOAhyT46WgB4koCQOnDvPRzrMb1rFQ3KiUz1DECktxdg4HLI7e4RKOVpX+6VK/aCrsOaUklTiE BLLsEvNSD1IdvBWPrAnHgRtGd6ETSSp0XnUBUs6vACacrdGlWmUJFhi1aWHHekpxZ3rIyRS9sDF2 5ZS0LkBKNAVGncldghzoj3020IXsP//5T47zcwhpKgFNGH9HNIkqAAWdDphzmorED2jVhfcmg+ec fbaD7bpE+mZtALrDHO0VmZtynHB5lxGUStDmEEPnmvvNVqFz5wN2AVLqkXMdBc3vBdCdpfO+974X 4DME6qJ6Zk/XcpyEYDihkzqCxrl+pX8NVnnYd9ZeitP+kUceIcE/rFzvYFSNVaoCqeHKs9Y2nUqA 1zB4EvlWWWUVg2kB1el7/H45CbujXOT2P3j88R0rKcUlupyZWuKcMaUBZceg8o+//13wAKRM5zlN VtoM8us4tYdg0fQ9Rx7ZBFLmoTrKQeJNOPnnP/6ReiRjiLcj++qRflMtBNmRvFJ8JF9y8MFNwkQp U3smUAZuIpme7nppEWDAwOZNOotztE8IzZTnYNSahAV5wUdR2UQPcxWwHag3WG2tUsjbZpttus++ pVrd3Mm7gJSUick4cOe0007rjiTe/OY3B0i5qN5saZdpTZU4uNp4z1HfUlN6PcuX8DMF30WkzF6+ nOpx7dRhBnDF5z+/5hprdJnYRQ/VyJwRZqGN2c8/33wFrXaheehlK5AaukhrhdOjBDjNtddeW7LE BJzBPY9vnkjE+vWvfz0UcQwXSJngkCe/8MILkc0DCtimJjvSafy93LLLmt0Q/0xr8nfdoQmSjEFX XnnlY44++sMf/jDXv/deexn7diTV3JYlF+ZNsG9Sw6IxM0cd65wIICVNSDUtMXaUKrNcZpllOuaK emWVtMQ799zT4hgzMpITHenUBEOSkbKAyY+jjz6a1iD1yQmkdHMjE9NwZh79ACu7s08CFjO968AD Gb//TJ7+6U9/6milTh3eeOONdXz9VHbTLKf0pJq7VAtIwdD6kak9XsWMHri25pprDh1I8VoQm3+7 UDtBZSuQmiDB1mqnLwkkI8WDcP2G0VyqOYgll1hicgIpupGVEZZkJgzNrWjpPjQHpFZYYXlLT9Zb bz0rJBw+OhQLEEEXWGCBLbbY4hWveAVE1WV9WJMeky8mIs0XmDExIdud/V4g5XRVEyhd0hJ9gVRH qTaB1He+8x3ZCJdUh6vLRwyA1JJLLrnW6CUtAUh1pDNASlLTuquLL754ww039CWEeajJCaTMF8NP 66677uqrry41NawJfWjs3HPPZfyurbfemjQ6LhICpBApbWwgAUJdffXV1u93B1JmdTNulIbXra6/ /vq1KpDq3gFqDVUC05sEAqQuu+wy0EQAsEzKqg7LJiYtkIIkZCagH4ulyuLTLlrL1J6FF2IqBNBx mXmhxNTekUceSbwAH4QKnXQhspTl65dffnmrxKwWestb3jKU/EFrak8qRYDpMonWO7XXnffm1J4V M5uMXq9+9asXXHDBLovkMrX37W9/2yTXoYce6ttVEv6f//nvLgTrR7ImcicWysijmDeftEAqU3s+ i9PxmavkmeR0d3RutGNAoh4XCWti4FXhUQQgZaij19OO9UyqJd6hACngLEskjXbwPhFAamRqb/75 69Relz5Vy1YJTGoJcEnrrbuuER4qRX2BmTM12TGUobk6jSA/8uEPD1EE0g8+LTbWl0ITrrojif/6 5z8hs3z41iUN0+IReBKZkKdOq019Zt9xUJ76fagY9i0TAdGGIlihDnQuOTOr1wmkC5Ay32qmrLm+ mBDYWBej+t53vyvHI1WWfXpU6PIpg8xfFxsw6yQjlZyWCvEOVXf5ai82Lwcj0pvhkkexKN4nnAN/ WdlSsRXW5NCF5WaFNGLWKdPZ2M8opeNXe6qykslCriyJMz7pDqRk9aQMfWSq8uA8awaMJbrYv2yc pYE+fTVs8JGB8YmtKywV7Ti1h0J5OBOFoU1tknM2Wej+/UoXZscqW6f2JkKqtc7pTgIiB29ik5v/ /M+RRVHmjGwkM+uss1qIU/YrGkAoRvafMR6/6CLjSCtP/fjsxRd3XHAaMvgpKZMXvOAFW2y+eRcK UxunzHvOOeec9pJBpDjdBUAUQVkOZU5ngw02+O53vxuprrD88hZ2dMdS2Dc6f/7zny+aDoV9wjTE n2WWWcyUjWrsImm5TJ4OoPciVWuWoZxU6LL21qf1XVaJYdyks++hLrzgglItyGIB8sB0gg4+Vjef e+yxx6ZOZtBx+wPEyJWSISgpc2apnMSJ7+y68K5OWUOcopDefQEaajvWKcZfcslnqd6AJBX6REDl 3YGUrTRkCq0OjOrhqi75GGgPYSbKyTMI8sEHH1x1lVVgtS7VWl1uTAKNWR+mn/psxZ5qspIdu5U5 XHOFtqSKSDPF6ZvTga10QgtWIDWh4q2VTxcS4JUM6H2oUnZk4a/hHoM/bqXLuFywBx3MaFh7seqq q/phqDesZSKyMmBKvjDvqCdO05IL/K604oqI9GXQUOY0L7/8cgjS5UdGpRy0Rf3BVR0vYsS+8Nyd fYRZa2IsTgK+NiABF1FYxt4xmsIoVi+lQpc1vKaMOxKsuM82GVKpVqDqkkQ0VWR/S7yvOKp9lx/s oeP3/0gSku19AKbD0JoQ+DvybvJxjdVXTz/Sp0Jtx08N/vrXv8qU/JvqV1rJlHRHJMG8fV1x++23 S5oikm+xs0YX9n1K6ftHJpS5cvVDJ4Tg6rglqSwRjGuzUORZJrXnnnt0GT+kX+uYa6yxhonC6Ei+ 38xpF/Y7uovxi1cgNaHirZVPLxIQL/kOVxLmOjzX789//OPvXUTAF6fa5tUl5jWJSXzqmIEvFYqa hUjVDsXlFfZLTIqcu68+QfbEsV/k0BFFRbYU1NT+UASL92ad3UN+U/upeVi8F9o00V3vLcZDakf2 aWTi2Edw8S0dVV94L6opptXRpcTdhTytdATQfc2emjqy38UPP2nZCqSeVET1hSqBKoEqgSqBKoEq gSqB/hKoQKpaRpVAlUCVQJVAlUCVQJXAgBKoQGpAwU2rxeR4JX7rVSVQJVAlUCVQJTDZJDCspQjD jeAVSA1Xns/42nzC7fttn+7Xq0qgSqBKoEqgSmDySMBy+2ysNdkCbQVSk00jTzM9gJRPomCpelUJ VAlUCVQJVAlMHgnYqMJODRVITQhK8M2Fb619G+kAqbKw3yJ/0LVAadJ3Rk/rm0z68N2mgnbC6P0i wEetarCTcu83Hea/bGWrTtvQtQr67l1Dtv/RtH/VPwm1Po4aACnGCvjXq0qgSqBKoEqgSmDySACk q0BqzPANfNhZ3/6tIAjskstv8CgwJZjGZT8ur/m3oCIzuHYCtG3X4ostZrPabGWhyFVXXTXXXHPN M/fcTtB02SrQn7auL0SARw6XtfuLzYjtVgL3NCGRPQ/PPeccu9M6hszJCb7tLAV92+mYBedz2XHO Dmw28y0FYSYbxTpvwaVRW5/Zl7n7SZNpGkzEeJdNiaYExlYgNXm8RqWkSqBKoEqgSqBIoAKpMYM4 FHLIIYe8Zt55HaMz77zzvuaJy2+nnwaFgEo2ePXETejEv/50E3Cxo7SjCS644AJ7tZ166ql2wMuB kQ64tiug0xXswOZfVdnCv3lQkbwLJGT7adsSOmLWWU4F8Ug4uWMfVdvWXXHFFXa+t+V/2SRDu3Zc tZMvCOVobnv6ZQt/F3psw/jc5z7XLrTadSYoYNc9IyWRpgn78pGALdSmBA8N/E4FUtVtVQlUCVQJ VAlMQglUIDVeZJess22r4xrgj2888ED+s5E/tBRU5JghGMhNRxlY1WXTWH+5KR1lz/uXvexlUJTX JIqgMcemAj2eAjFpFUICpBxNWnZbtvL/E+edN8ccc+RwKGdayVfBZEFLtOX8RacTwEC21XcYp1Mp JIQ8Qo9NbB0GkmM6zjvvvBlmmEHxAqSc0Y0Rh00ODGV6CzpdC3y0d7a9fe1yO8Sae6uqQGoSuo9K UpVAlUCVQJVABVLjRX94xQzaC1/4QgdSgjIgizvSSBI/8FCzpDm4Zz3rWc6fyk2pGrvIv+IVr3Bs gj+d+TDzzDOb4Gvt0yozJKskWVXWSIFHzkKS4AnYcvbQi1/84re9bdcUNGHnDLLTRo8yNZFnB31T dTJM/sxxRU7VyDa7Z515Jtgko5a0k38DpJytDZEM60NNjWINdHPqQgVS1ZtUCVQJVAlUCUyHEqhA ajwgBb6YRwOkbr31VoulHKhpATjQA7u0IJFDMQEpU3ipzlNHulr/5EgywMXJ8ACQI05bi8ovu+yy GWec0UHiZTGTNeByPPPNN5+15OqRQHrRi160+ROntzogUytm/TyS9HI4kbSTkz7TIuwF2cBM7NjJ l5ZnJa1VgJSpvbnnntu8oQNrAcEhbmyfQ9prRmo69CCV5SqBKoEqgelcAhVIPTmQgl0gm0UXWUSG qRzHDYVYFV7gVAtIqdTi67PPPhuaMd/ntHCIx6GhFqeX9iAeiRx13nTTTeUmILXQQgu1gBQAlw/0 gJVnP/vZp59+eoCUpJfZw+b6KvfVYF25RzBfsy1kSFDdeOONpilhqf3337+VVOsCg/bdd98KpKZz V1LZrxKoEqgSmD4lUIHUkwOp5z3veSeccMKnP/1pM26ZqnNZ1QQn+W4ueZ1eIOUm2DS6gOoB8GWm mWbyoVxzTs0cnNVRyy27bKkzMKg3IyUrFiBl+qyVkQKkkpHK5SM+WbGFF17Y0dythJPPCeWrvCND Bqvhxad2XcBTs2wFUtOn+6hcVwlUCVQJVAlUIPXkQCprpCSf7rnnnvKRv+/mLAOXcArEOe6440Cc k08+ubc6cEoqyPpxy4ma4MZMnJXsb33rW4NvcuVlK5+sc/fnddddN8sss5x//vkpCB4BQFBd3lxu ueWsfMrqcheUBu0t/brXXXXlla0v8hBf7tibyip19Ni14RkKpGwJMVbXHefR+L192ig4PXAxzWu/ KnGwwDw9yG0cyUwq9icVMU+B569AajwsASRBKoAUCOV3Ewbdcccd7lv2BNCYZTNT9pKXvOTSSy8t 1QEuilifbo35q171KsukWjst+YgPKjrooIOa+2pq4itf+cpss812zdVXSy9ZFGU1eoFKllhtttlm 22yzjVk53wNCcpBTEJJK7FC18sorf+5zn0MPUOVOAU9uWq0lB+a+1JRtGswzlmq7w6mnMiOFfnsu 2FO0t3u4mU2/mHXv0+z11dvDvWwa9Oc/+xlk2beg5XGuvgXhXQX921vQ+z/72UjBXkq8rC0Ftdv7 dLTgyJ5kfQuOw/6jjz7Ofl/HMQ77P/rR4+z3LRj2+z4KF9jvz8Vjj/Xlwsvhoi/7UaIN2cZQYn/t FyWOpX200MY4Suyrfe8/KfvDVWJ3Gx5HiX3DW7HhvkqcEvbHMP7+Nly039uF1dOd/XG68Pg23J+L MWzYyyxtrC78uA3/9Cd9uzDbHsuDxRHZtXDMLtzPhr0cJbLhwbrw1NrwOEr0qChxah1R8cNTy8X4 NjyWH9bKOH74CSX28cO97FcgNSaKgGk+9KEP+druOc95zutf/3r7MDVTOHoRDLTrrrvuvvvua6+9 9rrrrvvxj3+8QBMZIMkkX/xBWmb0PDJn12rJFlDrrLPOlVde2bpvT4SPf+xjqt1oo43gMwvSmwvb AThf54FTNt487rhjsybdxd+BXJa0I2b99ddHj9ZvueWWPAUEZcu23XZb91ddddW3v/3tNp2CtzpC KCJCm8uHhyY383uIa9ib5GX7A2wCl5tusonZUipo9jfaue22Wzd705tsCdEbvz21BdeWW2wBv7YC v5dtvmW/rhNPPLGFGAQePUTekegg15br97Lds+zX5d9WQW/6unPbt76VqNXQCmBeZlr0e/nll7dI RZv0p8ncA/bf/8c/bgMUL+Nu0003Nafccpr+JJNNNtmEfHrZR48dOtiwvV5bTtPLF1988UYbbshC etk372xbjR223/7hh7/TYl8wsFwPFxd86lO97N9///1v2WYby/VG99L/twyigj4vReo111zTUiL2 77zjDl9XMPLWozgv9z31EUZLiR7ZjIMSj/3AB3q5QABKzKSbB+9V4qc+9SlKxAvCmhallO9qd9hh BxIgh14uPnrSSdgnvZbASVjGmrR9hNEborx81FFHYd/iyH42fBv9HnHEEX1tmENgGyyk14bZEmLY 1Tg2zCb72jDt2zClV4lsnuWPZcP6ixZtaNdrw3oZOlHbG9qxzIbtpSe/3nrqUbHhXuz+6KgNc2t9 bdhWL4hhw71KjA1zmLTZq0QfQdO+Df9aLVIcGzZq3XPPPXsxn5eNjTfZeONre2wYU7w0KzW30N+G DzrI07vu6m/DDOO4Y4/tVaJ+9I7ddx+14fv72PD552Pfd0i9SsT1dtttN6YNf/SjCtrTp9eGTaGM Y8PvPeoohiqO9Nqwb7PGsmF2yyqs+v1yPxsW7MayYc4/ftj2i73sW4VMiWPZsGkfNqxr9/ph0zuc xhVXfL7XEQmaI374gAN6lUhWNiEShYsfrkBqPCwB64iRZtbsa3D2WWf97ne/ayacTMlxNNyoZUkg S3P9U3ZJsIjqrDPP+t53v9v6xC+VOMuFW++74lvqyMYHZ555pvp7t81kRp/4xCeEjebW5Cbs+IJP fvITQNipp5ziP60//PDDaUslbEjAcF+1zXXoXbAUf6HDMERzkRbI+8G2vv71r3epc6yyAVKEBn2C tvTS8pg8iK8RLWhbbbXVTJu2IqKXbVoBaAK4rY4BjNpXwir+bbbeWv3NgkStUZk/S9y4lVZQ9LJu ZkrXv9bMNQvyF9y9Uso6IrDVgb3MQSv44Q9/GPhuFtRFbXMv2Yna3g6MVNxhn9W1PCaWWYVH5OO1 FvvosVG+atlVq1oEHHPMMdiHGHrZ9+GnfOorX/lK28O22MfFHnvsgQs+pVVQczY/s4CPVeRUoiY9 CooWWjzttI+3NBVQa58O09atR2pwZ/nll6fi3uDtkeGKOtXcIiZnItnIzQcfqGpBEC8feuihuIC0 WkrEL67NrZOAD3Vb7tvQiMQUPOboo1tKJGEowcYl5tB7gZQWjXaQSl8tHmPDlGhnk172PY0Ns5Be G2ZLfW0Y+2zY57qsEbzrVaLAhgsfvvQqkc0rpWxfG5atV1Dfadkb2myzgk7U9sLB2LAviC/57Gd7 bVgs9Ih8epUYGybVXgTm5XyIAy21lEhrdGclAz3SZkuJXjZkHceG2YxFq31tmLsbteHTxrJhttrX htk2C++1YZKxuTHtc6r9bXi++fSpvjbsWyJc6I+tgtQtiEgHsGF9uZf92LCBTcuGR8elt/lmnMxJ vtWFvRwbFhxbftifvBMlsuFf9PhhthEb7h0Jq9MwYMSGt9mmRQyyWaAowxp7YTQlGiSPb8P8cPKd LUcElyt40kdO6rVhkQKdr3vd63oxfbFhvTVPK5CaiKA/vdRprAPR20PrlFNOMRb0Q09grBPBf4CU 7m0204jNkLcVEvzJ7x9/3HHwYu9kk6fnnH02antzEl4GL7gSE6B9c+O8m2jRO5z1soBhYOrfVkF+ B4pVCq7tnTLwsra0qN0WqaSHQpI0xuqNwV7GnQV5vajOy1/60r3yguTTyz56AGjs9+YkvHzrrbfg wrCslwsyB74/+tGP9oZSL0PzH3j/+2VWegtq6MMf+pAw0zud5GWuFqk2qm2RiguO8vjjjwcyerlw x33CAdZbPtEjtUlHqblXiWhACaghprbo8TL6sY+XXi4kM/BupEQOvQVhPuwbRPUqUfQ68YQTTOv3 JjO87HgD7Ess9bVh5m1Q1N+GzzlHf5taG2aBsWFpxV4urr/uurFsmM0rpew4Nmw0NYAN66e9qI40 9OvYcK8S4XE2LA3WmxtGAC3QxQA2bEUE9tlALxeshQ1LVY5pwx/4QC+siQ1/cBwbPu88T/vb8J13 Yl94nlobhkuwL8Xb14btsKMXj2PDckhTa8OfvvBChtqbWMK+1Sl81AUX9PHDukP8sM+wervwWH44 MwNP2PDDvTYM9FDiDTf08cOxYX64NyNFVlbj8MN9bVg+Ul9zIFt/P3z++ccf/y8/XIHURAT9Wufw JRAgxV6NeIy6GHfLuWeVjEde6PX77hgdeqr39hbkRAxrjJ77LrAw/jBC6ru8Jgcv9l2X432lWgOd jIe0oi0FtdvbIgrRidq+XAzGftI5Y3HBoXRhf6zVReOwbxiX07XHYn9gJap5apU4DvtTosS+7FMi 9nsTEtH+YEps2nBrEUn8eBclTvM2rCf27cLpiUO04WQ+BnZECg5swwMrcZLYcEdHNAD7RD0UP1yB 1PBDfq1xIiRQj4jpuwCz3qwSqBKoEqgSeHolUIHURAT9WufwJWCBmskySal6VQlUCVQJVAlUCUwe CVj54KPp3gXNww+EU1mjI4D/31QWqa9PyxKwGYTlvRb416tKoEqgSqBKoEpg8kjgN7/5jTmTCfpi vUtcr0Cqi/Rq2SqBKoEqgSqBKoEqgelaAhVITdfqr8xXCVQJVAlUCVQJVAl0kUAFUl2kV8tWCVQJ VAlUCVQJVAlM1xKoQGq6Vn9lvkqgSqBKoEqgSqBKoIsEKpDqIr1atkrgcQnYpdO+kTasy9nYNs23 daGDiezg1zzkcWrlZaecz1w0cjmZxOaifnz24ou7nN7ozEpbIyLMoROFMJ80OzXCZWPMqaUw7/uO xi5/dpG2yeEovRfZsdP+e81zCAao2edCISx1qtxq0wHqKUUcxIl3dDpNoXz741OgtOLj6sEqVxV1 Oz5F5Ri36aiPNgarqreUPVfDvgNGnLJw77339D2nYaqaI0Z0ptrsG+ffqaqh+bIjJZhTeC+asudn 36MmprAVpkgjbJ5U7QfmIBE1U5xWmkdNTGFt5TWME6OqbBGpTxUJTG09zfcZuW4+wv5n0lkvspv8 l7/85aGsibafaqh1niwhdOGdayLSq6+6yialoY3ls9XskDyYBPiQx3m/+GLej2V+7tJLSZgzZABd JIBxlagrIqUsvmswIp+CUhVIPQVCrk1M4xLgL973vvfNOOOMjnpwPh1uYZ155pnHWTHOn2qdoj1V snAG9grLL++wi5HTJ+aYw49VVlnFfutTVUnzZdvirbXWWo7OcGSHw7nz6Ibrr3c+iSYuvvgzg9XM nzoCBb8LLbQQIl2ObVl00UUDKwe+eM/ZZ5991llnTZ0rrbSSndO71CkkO3EcnXvttVc5BFMIdLKH s03E6cFIFUpVuPTSSzvsAuOOTutCZJMG5404VCfso9wpbwsvvLDNoAejM6VscWL3+RVXXDHVHnnk kQ78YcAD12nYsNNOO+HdOSepkxk4r71L5AOa6d258uoBShxNs8wyy1AcG7Ah5MCk2kV9jdVXR2EO Qgm1kMTAFSqITd0c+0susUQqdNyNs1a7n7LqsB0n36XX225+wQUXhKoHJtW+Nk5icaqMs+0yinjP kUf6k6cyrhisWj7EwXwx++233962q860cWLVS1/6Uidddtmn4EMnnuigHn4pIl19tdUctzDE8clg /I5VqgKp4cqz1jadSkAPd0CsU7cdu+FARo7JQdqLLLJIl+wRUQIoXJXL8V5OdMnvLgN9mE+Wiyd1 5kapx27UDrh1NESX5JkRMyThgLYQ6XwV5+71HiI+VfaBHif0OeAsdRrviqOSH1NVSfNl7DvLAtBx vEbx8tCVk9EdK9mFfWCCGGlcqGMMXcbihWCaeueeezrFKOzLRgir8Lr4OrAEGCc05hh4taVa57gB VUb/A9epIEULpVIdqdNZKM566zKEoAvnEgrGYAo0qR/BpksssYQDf7rIltJDocNMnEyMQr+76B3v 6LG3PoALqaRy459lXv/6jkBKtTAKOlVIazvtuOPLX/5yohhYTXjnl2DTd77znUgFepy8Puecczqc p4tLoRoA2oFCiGQA9PX5yy9fa801kT0wqQqSHo/qUMiI1E70vBYr1dG6VDtBZSuQmiDB1mqnLwnw RIZikttrrrmmnPYbllnmS/feK5bIAA1FENISDr8bSlUcNAqBnjJNID8hQnf0+//4+9/VqWZhyQlf PLVA1X0SCpA64ogjEjtRaGzqvLYuchBOHBMrvVE8smPXhJaO7CPJtBEgVY4w70JkykK3EF6TMMkk 434zMgNXTkHLLrts82B46TR4oiOYsLsPICXfg1radwrezjvv3DGUAlLvec976GvTTTYxwQepA1Jd 0rFNoUltOrW3S8qkWZswD0g5OwuGBnPNwelQHee12byzfqGcNARHUv3As8+pBMJzCDRhQtLON5SG dBK8k1sHNqeYPSAF4bkWW3QxcMrc+ZprrNGR/RG9b7rpJz/5ydBGGlYgLL7YYl3ykV3YHL9sBVIT J9ta83QkgQApywVWXnklvn6ppZYyHzFkIHX88cMSKJe30UYbmSHinvhB/rTLzE6oAqSMwk1AmCkz qSeoGJt2SR6kWihqh+23F5m+et99smh8q2RSRzlgHPtSR8iDdDXhcN+OdSaiDBdIAZGAVEuGpNol /MvoAJFASXd+mzUESDkl2jIpYZVUu8zrpWYxnlk63BCAgHuAFd1qWEDq4x//+BCBFH7NZlrJ5LBz 02csoTv79M4AoHzG78K4kU8X1RcgZcnRLrvsYvhkVhdaHQqQkpEyjFx33XV1LqswjSeHC6QQD0Lp XxVIDbfn1tqqBCaRBEpGarvttrO8Y8MNNwycGmZGanhAKquDrbmRMzBzJHXU3e9L8Jh3s9ho7rnm mmOOOYbl7xwabzJrgfnn9+9rXvMaC9g75k4YDfYNzVdffXU0n3LKKbvsvHN39nuBlDSPMXQXKHnY YYf1AqmORt8EUuI9K3WZhxX/uizkl4dYcsklLTwyVTTfa17TzHgNTDAg9ZGPfMRiPuhks802M10o Hzk5gRTRAVIsn/3Dkd0TsREaszzkkEMYv/+Myq6//vqOi4SYvSUHEA+pAqnQ5H777dcdSGXcaILY UGeNNda44YYbTO1NBJAyQhuWYxnYLPsWrBmp4cqz1jadSkBsfuMb32hxtAU3UJS1AqZ4MjQfikRG pvaGB6SQlOktfvmss87afPPNO450VZipPT5aumu99dZz3vtQGDcot4zdOozddtvN5GaXZTdNeuQO rWIGpE466STYtwvcKdW2MlI+O4DVukxvWRw2dCAlt0FNEaMvtqxftpTNsm7Yd+C19qpKRgrMNakn LaEXyCR1lGqAlNyJDIoJKd9FTlogJVsGSPnQDE6V7LRkyndwHdknVWJUM+N3AeVveMMbTJ526VYZ P8hHyhwfcvDBzMAU5LCAFH8C5oJTEwSkHnvsp4Q88AeGXeT2pGUrkHpSEdUXqgSeXAKA1Dprry0U ZbbIn1YzCC0dV1uXhvfcc88TTzjhyemY4jeslQF3oL1TTz11j3e8ozuQ+uc//mGtfb55tp6jy/LV JhPWCbnUKVSb4rGWfyirTYV8Q3Pf2J944omAWveYh2ZcGzGXBUyaIJAuQApwRFszu4NOAKWLBAAd n21mswO0CdUuYEXmo0taTg7GAiazpfQOUDIDrXSpEHmSJSd95CNW85gxpCzfMUAS3Sd2Y13WHvnU rrvZpzbd3KyTjwOwzwyMUkz0d1x1R9fyRmwgYmT/mujynYFK5LRkjOSK1CmJqAnjE2h1it1Gnxfz nQEIxdrhSEDKKAVc656RkoaUjEyTNCXp5VtI5tqF2gkqW4HUBAm2Vjt9ScCQceWVVpLdSe6dP73r rruM9YWWLs7a2PEHo5esifyEH5x1l9hctMLLX3PNNeZifBnU/Vt9HlnKXQbOMhFEGjUOBUjx9ZaB +2IxcyUG+tZe2AunY4hSFSzio3fsG5F3n4fKd1smyHz4LXESlZnhlfvpoixrYg4++GBf/qdCl2zf Ouus0yUtIbxlxTHAV6rde++9Tz755IF7LPZBUt/8i9OpkxlYKtQxfeiTveOOO06kp/Htt9tOuhc4 67j1A71bvYfCY445xqYP0jx+M7OBeU+M183nnXdeW6mF/QsuuADm62ilpMo4falnWyZ1WoRkLt43 pwOTindrt2X1ChZh+RaKGah00RTvsdpqq41kodZaC0w3PGP5vrDrCKTgM6YuWxaR+oJB31f/UBzL wDIcq2AFUkMXaa1wupMAl2cKxnfFYsnXvvZV/EtK2frFjIk8f5eFvULI/PPNx0fbTsnkix8+DrIQ YSgiVs9cc83FWXeBeqGE05Q5IAHQBJGrrLxyx30fUq05HYtOMC4nMdLKP//JQZNAl4/Ai+ggHtTC EN3ZFzIh3Xnmnme2WWclUhJwqRxe6bioRXYHlkqFLlDVR4tdMlLYRxK7MktSqj3hhBO6LOtRIb3Q fov3LiASncL8vvvua+5VmPetPmGK1h3RiXhMhhhnV/pUJFDSHoN1K+ShDfvWSD2u+jnnNF3eEUnw KoYQZ5x+uml91Ur4ddzhFhTTd9C5zz77BI5YIEgIDBW2Hoz34Eg1y8DBuBme2bbAsKpjltfWDGij pojUEjHsT04URQgVSA1sP7VglcC/JGBJkCG+cXny8BZEm9pz54c//EGXOC2fDzTIQKjZ5YchaZfh Y1Nn4pwRud2PuiuS05SFwi/yEGnmqPuS8ITSMJ6kkVYMpv3ZEZ2EX5rCvjUoQ2FfnoOmMB59RVOs omM4QRtQngpdpmI7IokwS/XRVK6OOTk8SpQW7Q+Rd8apC0T12Vygo7IK4ySJ4LDfMSOrg2O/pfqh zEAZjejsqooH6IjMSE8luIZKI0amlf7VMScH30gaBeVoxexzRzUpLsWLVGqKjrqz352kcWqoQGpC xVsrrxKoEqgSqBKoEqgSmJYlUIHUtKzdyluVQJVAlUCVQJVAlcCESqACqQkVb628SqBKoEqgSqBK oEpgWpZABVLTsnYrb1UCVQJVAlUCVQJVAhMqgQqkJlS8tfIqgSqBKoEqgSqBKoFpWQIVSE3L2q28 VQlUCVQJVAlUCVQJTKgEKpCaUPHWyqsEqgSqBKoEqgSqBKZlCVQgNS1rt/JWJVAlUCVQJVAlUCUw oRKoQGpCxVsrrxKoEqgSqBKoEqgSmJYlUIHUtKzdyluVQJVAlUCVQJVAlcCESqACqQkVb628SqBK oEqgSqBKoEpgWpZABVLTsnYrb1UCVQJVAlUCVQJVAhMqgQqkJlS8tfIqgSqBKoEqgSqBKoFpWQIV SE3L2q28VQlUCVQJVAlUCVQJTKgEKpCaUPHWyqsEqgSqBKoEqgSqBKZlCVQgNS1rt/JWJVAlUCVQ JVAlUCUwoRKoQGpCxVsrrxKoEqgSqBKoEqgSmJYlUIHUtKzdyluVQJVAlUCVQJVAlcCESqACqQkV b628SqBKoEqgSqBKoEpgWpZABVLTsnYrb1UCVQJVAlUCVQJVAhMqgQqkJlS8tfIqgSqBKoEqgSqB KoFpWQIVSE3L2h2At//5n//5+9///o96VQlUCVQJVAlUCUwyCfzzn/8cIK5NdJEKpCZaws+w+n// +99/73vf+496VQlUCVQJVAlUCUwmCXz/+9//0Y9+9L//+7+TLaxWIDXZNPI001OB1GTyG5WWKoEq gSqBKoHHJVCB1ATig//7v/8zG/WnP/3pt7/9rd/Nlvz52GOPfeMb3/jmN7/5q1/9qkWEaSxPv/Wt b/3617/2u/X0j3/840MPPfTDH/7wb3/7W+vRf//3f8PF3/72t7XYFx3/9a9/efjhhx988Ju/+MUv JiF8HkcZFUhVp1UlUCVQJVAlMAklUIHUeEAK2vjBD34AsphU+u4Tl98/+9nPAoz+/Oc/5xHVPvro o6TpTzc9/fGPf/zggw/ecsstJ5100uGHH+5maQm6+upXv/rWt751rtFrr732An3+67/+Ky+Yar3n nnv22GOPxRZb7H3ve9+9994LHpWyP/3pT08//fTXv/71W2+99UUXXQQwNavV3Hbbbfe6173ugx/8 IJTWhEp+o02RN7zhDQsuuOCHP/Shv/71r8NCkb/73e8iHk385S9/KdVCgaRHXN1BWwFS5Ey2uWgH cEy/8qPczw9NN7tcecGPZkHv+LOUVUoTzbIpWBpKnV5oNRd6+raowlaLU86FN5t1loJPygUKw0Wz rdA8Di9jsZ9SLS6aQvAobBZqi8AjzyYjY7Hf1EWL8VQ75ewXJQ7Afrjotahx5BbJPCn7vWbTqrNl ikWJLSMfRxdjmX0x19Li1Nqw95vU9iqxsN/koqn9cXTRLNLsjE/ahccvOLASewsWg3xSuY3F/sA2 PLD2p7xgcadDtOG+XbivHx5Y+y1v/KTGP5Y7bbnuVlAYx4OlJ8awu4e5YUXkUs/TP7UHDL3rXe+a bdZZZ5999jnmmCOgx/WqV71q1VVXlWdC64033via17zGTe/k8udNN90EFR1zzDE77bTTCSecoOzi iy/+m9/8pvB2xx13gDIQDwU88sgj66677tJLLw11eUGjX/7ylxdeeOHPfOYzFPPhD38YZvrOQw8F t8Eo22+/PQQGstx///2vXWqpj33sY5bceUSF11577SILL3zddddR7UEHHbTmmmv+5Cc/SaOKq3/5 5ZffZZddvva1r7kPl7SSZAOr8A9/+MN73/veCGf++ea7/fbbQw/Md9999y2zzDLEJYs2cP0pGCCF NTk8InJ95StfYe7wIvwKwX7961/PTSDVD02Dp6V7KEhiKegFBR944IH/+P73A4nIM49cMnYKfuc7 3yllSUyRB+6/XzPptx55zc0vfelLGnKlWtospVSb+y5tIR7lJUJLNxYuVIsLL/gRIptceLPJhTdT UOXhIlQF7hcuwoJ/3deuCkNhoafEJy4A2aWg31os7HuK/Twl4ZAaejySGS0FDSjYmOKRzw9/+IPC viIk3GTfm4X9KLEsgFODghr1Ti8wxe+UsI9+tLnU8KTsU+W/s/+gOwqWtiI3Mhxh4QnBYZ94G+yP 6DdjKmVdkbkr98OOIsVa8gKpFt5H+P3+95tKjDUWs2mS1NS+F3AcuTXNPrJtat/vb3zjgSmx4VEl /rBpM+PbMDbZQC/7sQr/qo1ptdhn8IxKWyqPpcX407OiwYIGertwXGjp8ooo6M9ocAz2v9E0/n+3 4VEljtrwAw/8W09EVTToUuRJlPgf/1G0j2XElF7MEY1jw01H1LThwPq4OBdBjbDGgz3hjmJX7jOD Vq9pKjHSZhIp2LJhj57UhtXW14Z54EJM6cJN31Va7OOH/+M/MB7tx51GiU0n3NcRlRZjV6Ps/8tv p4M03enjXfgJi4pzSMGm644N+7cosdhw6Ym9fvhHjz5agVT/KC8jtd566z3/+c//7Gc/q5/nuuaa a8Agcb1kpNwEuUA/eCIpGRjlP//zP3/+85+zj1e/+tULLbRQE0hddNGnn/e85x188MFeI/q3vOUt L3nJS2677TYVyhK5D5HQoj9vvvnmF7/4xdJL0RAENs888xx//PGZNFxh9IK3gjN23HGHJZdc0myg Pz/5yU++9KUvPf/888MY2Lfpppt6md0MV9kybUcfffS73/3uCEdXTKILcgIQV1tttRtuuEFqTcqq O5CKFwNAXz3nyAVufu5zn4MOdTk5vAXmn99NsBWcJXP/QpM0GH+hn2ywwQaj5eaETRVcdtllOUSP wEp4dO655/ZIQeLdYYcdPvrRj1Kf5nC0xhprqO31Sy+tl2bE49GZZ545Aq9HG0qLEPYFF1xgTtYL lHLXnXe+9rWvTYubb775xz/+cSqQnNOiS8ZREY/mn3/+T3/606ussgoAqnPC3C0u3v72txcuELP1 VluloDcvvfRSXHBMnCwuqHveeecNF5KgMp1HHHEEw3jzm9+MVPczJECnrGQiDXYUhNdTp38xvs3W W6MWqarlZZjNyKM556TQc845Z+211waRMwI75JBDUnCeuef+xCc+sc4661x++eWeeiQ5yhpTJ+iv CdWSW9jfeeedU3DBBRbQuVZcccUvfvGLGap+4eab9S90brPNNr/85S9LzPNUb3rTm96UgksttdRl l122wvLLM2kVavSss84qSjSM2XXXXY899lj9jtjD/myzzYZ3l+bYamH/A+9/f+rU70477TTv6z4q pJRXjYqL3KKUDTfYgLhiUUjdZ599UnC+17zmwgsvXH311Q1jvOCRIdaiiy4aue24446Myr+GHAcc cECxz1DFAFhvxrXKXnzxxWqL3HgV73MIDECLVLbhhhvGopYZtWHGHz1S1qc+9SlF1HnooYdaLRC5 qZAHe1z7o+z7rVfSO12cccYZvTaMkWLDHE6x4S233PLUU08l/6LEf9nwfPNJdRsv3XrrrXjX6NVX X83phYt3vOMdHOPb3vY2PkGRFvuLLLKIcIX+L3zhC0ahxJUOlZ515JFHxgbIR7BkYBE4xglq5ZVW 0hz7SUPNgvRIaJ7qvLF5T8O+SpKWSGKJeB+34Xnm0YOY95VXXsk8DG7z/gjBo1Rx1OhULXcXLlhU bAPlHHiSOtinGjYcqhiJbrLvvvtiRLv/ZsNLLsmGl1tuOXE6johX4eFTMDbMcgg8A0gGFu2vvPLK RtoEHpfohVNOOWXEsueYQ7Ao2o8jMqeBlxTcZOONdZONNtrosdEurFqEhX0sXHjBBWyD6caGue5F F1kkxEgKHHfccRwjG95vv/1aSsRsbFiLOo5eoDaiQ3+rC3OhxQ/zQnTHg2Hh85//vN7XUuJHPvKR uL6ASFyHize+8Y00RRqIjDc+cTRhQQDkkCLqJGqyTZcvXZgrjnm7fvHzn7/rwAPDyyWXXEK5BZmR ADMQYtKF2fB73vOeuGJy44e34odHiYkf1hAFdYxxE1H86c9IJa0iCL3whS8EkGEX82jmquBx3Zg9 Ndlmvs961rP03pYsyJ1zp48mkKL+jTfeWLdkrTrzWmutxeCyUgoKURW/A/po8YorroCHmG9WSgk2 PBFi/EaMCMd6+Bd/QiqcjnAlQYVslLzohS887LDDApvuvPNOZIgrwirLThKr+2WR1sknn/zOd74z 6K15ITiZEuQNBUgReALwe448kgTADtLQtV7+8pcbT/DgGPzi7bcf/b73mdn86lfv0/NBrjI5u8km m5x6yil6u9hw/fXXC8NLLLGEIKTbAwf6tjq5QsMX7LzgBS8gydIhORQaFBehigApjwhT60CM0CJN +PWvf03uDSDTGzMEFK2FE81pVBO63GabbabP66KcF/eqLS3eddddAAq4jB2lcIE8EWuBBRbgAb0p dpZYsu2223Kv7mMfUmEAwjD4hQuOgCHdfddd6hSZhIdXzjwzQyI3r73//e9XhL8A9bwJbyVZFRCJ BbmRFJSzVJBDR6p3Vl9tNRGL/aBTsOQfRRqeSItQmpcVUZD0cDfrrLPyPp76k3D4U0yh9vTTTpt5 5pmpgJFrkT865JCDsY8kNQt1fKj6y9SY2XBV6SPlDrfo9xZbbPGhE09UoWqNMSiaixSEEIOvdddZ 59577gkX5KbFE088UTcRRWjT+9jHCy6wD1gXEMknRhf+ZTMKAhPoJFvVCop0xwaY+lJLLlmCJQnr jClIxdT0ohe9CMsMgNJpX2Y67Cs400wzmYvXqWFKQqNoFviBD3yA3eI9MRiDpCc6EgXJqJmEX/nK V+rFDIAECFCciA3fcP31DJi1ZCSdrCrUNcssswDQBJKQoFqvMSf0Cxhg7rnnnsu0YsMIABbZMN1x MvqR2BYMrU7WTolNG6YU2keM+vfee29CLjYMncwwwwzYoX2QSLV+44IlcGgKCkUGXUCq/qUU/ETL lIIF/GrxqquuIvC77roTEMzwgF5222238I7g9ddfH/K7++672Qyq1IARlLBVaI9IdXk2o6AQa3Sn IJGK8WeffTbBUqIxMMfIHfEk6hyx4cMP53vDBVJ1BErkdUlVVCeu8847D7Ih8KOOOmrVVVZBp2p5 IXaiyxMXdxTvGgytRf0346IoUYellAMPOIDxa3fEhj/0oWLDjBMjOlpsmBjpN6YIr3BEdKRF9EAP xipkpTkUkhVG6D3a58owwlrYjKoiMf/Ko6+00kreV4ro4A8hg3ww4jVDzX+z4Q02wD5T8ZTpsmEK 8oNkKAtqZLps2AhHW6yFaUFXFE1EaA6QQgzP7/6ss8zC5stccDAfA2CNsWESG/HDiy9OLAhTm57L TnRksMkAgCXEgRvxmmAx4IwjAr+oXk/JqEaLXuCEsU9cMX6lyERPhzgVpH0UctoQTwFSCnKeei77 5KJTW4ZJsWE+9l82PMssZBWjIgENRYneUSd6Eogn2zUpgBQ0wO4BKT6R0PVk6oFC/G7ldWgIkGIi LTmKRr1ACkJirDo/+/NUnGNAKRi4Bu5kaswwTqctUBfMkuiyiMrUIYcoAOt7yQAhFVYz5lOQAUFp ++y9N5tItVzec5/7XF6YfQMEbEtCq7vKGSjnxf40naus9CqVI34oQArXfDcvjCk9QaPko58b+PKh OjNT1v+JRQfQ2/kIsEM/dNMPkCJ5i2RTdA+dOWNHbkUNqdO/xkx8lhicPiw+rbXmmgaOrtVWXTVx K0GIPYCSfMr+++8vSKiHAdC4d/hcMTtEur773Uf0N5GJMzWykZxQbeGCd+BMsYCM+eabz2iY32ce LOG4444F8vReLXIxBx54oNaDY8RIzij4g30anftduJDTViHhK8vAuGCPBBXvpBXdnmQghnXWXpvb KgURyeNwTKqFzPgXDYUL/lGdXDxiBAMpCgGgcBF4hy8C5IIFocK+pDd1wAHs0w/RUVUp6MI+RhTE mrbMUAsnWqEy1pVhIqn6ffhhhyX+5TKKZcxIVYTSFXEzSsQRUmEsxcUq2JHSsa+joRP7dKTOc885 h7/mTAv7wYVY0CiLQpiq/EAwjvh9FAZGc6Y6WmFf6+wcJWSCfTE77HuBu2C6AVI6pvwEa/GOHJJ3 EKNFdPo3mbnCxTe/+Q1cIE+LENj7GjbsHeEE+8lIaQWegDzondNgYxkGoFZeUBxF/2vmnVdV7FCX eRxIvf/9okhsGAiLDQPWT9jwqk0bZg+GalRDiaI1dbRsGDGohWNwIatRuGBpGiVGvosNgDj8m1HH ZZ/7HMmMgqfHgZTBvQ6iE+mAqBK3YG4GTDgSCQAZGqL65F+xliwOrJAuDw4qmFYS8xZacMGbbrrx Ww8+qCGyohcBmzHgEbxu2jAZ6hr6HUV7k3MmLhzhizC1wsYKkOJRiUt0h+3QLLFK9Z7ec/fdhtn4 LewzQpXQi0pGbPjww3EdLpCny8A3yeGBrcyvmCITZZwY4VcBRKniJvvQoYHECIwazUhJXEE5CH7L NttI5CSbzpMYpYgR/+qJP/qR/CuyDbwNrlijVkqLABMbBgSpjBJxFDq9oJeNKvFrlMiS2bCJF5xm yKGD4LFkpHRMlPMkXtt9991jikjSnFW/LT+MffVzUNCzUR/TVb+gJoEt80eJbFhtEHBxRGrTHGqD F9WsWg1hn51YQ5yRACXqXF4bma9YYAGtsJkmkEKYgEIj9M7XxWUh76v33Yc1Mbplw/ff/3W6ZpMs remH9VlOTMHhzvZ0D9BqmERACkKCZ2FbQ1X+qCAeiKrghqkCUsxFQoLPAnt1bDNNireWfvM1Bx54 gEdabC1moi2Bk18wWurFQ4yDNzFwZExFE/oYLsRvpqYU18DWm2vYB9PZx049ldcGy7hmUcoKLey0 sNSDQwJSqhUnpAH05IwbXLouI2bTJMkF6AZnnXkmf0R6pkW4LdJwBeIkr5MBnE7l0gNN4hByM/+s EkGR48toT7TgUkXfL3/pSwnAxXPJkHOmWqFNOuX9jebVqQPL3JRct3r0MepQs9Sd8CBuNbngIGCJ rHCCqBQH2jJLC64ZJSNPBxYeYAs3W1xgxGieTjOiCoPq1KJ/0SNdHzzEmxBXWhHvPeJ0BKHMBaSg SlIQzd43auRNMuxzJxjO+9IkxhjhIgXjcBXkhQ0P+KYyGM28DIEgnhESV2/BpPpUIk8u1AGRsKyw HdVQot/uFE2lUexoEU4Sg7HTyz6S+EQmGmCEhsBWelSnkMM2msQU9vU7dfLX4oG+5n2EyUBoDg1g h6ggwhVTDCL0GsSA/SwJKlbqTw4d+/qm6MJaUKUnEiliAqQ4bhRGaC0lIpUSQZzEpLzgwn7yvu4L peINGPG2XXfdc889o1PUgiwiBMLmnWcetHEdTCuDgeOOPZZRgSBsGDLQa1o2LMg1lSiauoMLQUs4 6WvDegrjL5PghKCGWBSS2IyYR2463Wcvvhjx2A+QuvqqqyADSpT8EOlRhYvkAEzBiLLEFRWHff/e 8cUv0q+5KsJBPKVst+22uqQEWxI5mmZLkIHlRDrvt7/1LUMUwJrYsd+04VRLiYjJ4kIO7etf+xpx oZDRC+RibYAU3qWLKJHxfHwUd3I+eoofgJFIUShs9kQFuWUjkF5HpFqwWCVFvyEGrgJMPSUZoLbM PSXrA+WHbILFu+GicABJZD40QIrpIilTYK5MEOORErEAnTeVGBu2REy2CRf6bGy4KDEeTDYOxME+ pfCf6kR5yUghEnRDMMANFUlBxWUhSQ6p2LA6ix9WBMThiPR6sObNW26Z3K3fSmlU/QJWryOKGWAf HuJUGb8uoCNkDIxTuksKkxykfJkQNMxmIg2E8a6Z/0GwvIBH2GHDurDiLfaJURFjD1nGps+MV0Rn BVL9gUQyUtZICZBiFa0Iq3mVqgwRdNGgnKkCUrqH0aFwQu7QjG5PizxdIQJEY1h0rxu3dKM5XYhF cny9C4+MEgQbvkOwbMIvvTfTVZrjxXg6qL/7uiVDauBSYODQXXqs6CJL1JTmEIGUysGjJujRGVgw c7e0GJbSIc884wxAinYIWdT0yG8ekLKKGyq+WAfQ5/n00rXyKDAi3pBeuODMU4hzZWkRX8ORcUMB UjoYCYBfcVWBLCUIlRYRr8/vsvPOfbnQFi60LmaLdrqmVngBXOi37KRkGlJhKDRBbDjL1yS4Nh/5 Q1k+jhbcz8DRD62wohFxjY7mW+ynnsR4NQefNaslUs6ay37c7zfW4GuO/2VgcENkmMvvQBCYXnqm xX4huwApL8ueyvkldmrIbzmJEkrDe0bM0opsvkSLIpmwj2VxMUohTKtimah3VMUqxMJmnak2NZCS /v6le+/VE8VglahKhYg3JG0t4fJ+cgzACvb9W4BUYd8dbp1lqgGQkj0lecSgjZBlcQxIsvK6pUQU whamCJs2HPbzphcIB9ZkJ3LYZvdKtEYzAIR4QAoojI0pgpjYMNMNkFKWkY9jw1nHo2YQxwiq14ax T+/E9S8cOWob+Ak0JP9kf3U66FZtiMk0KwrlPDAC3WIWVaqKFQFSsqpyME1DDfsKGhwi2/sBUn5o BWsZCKV+f+rF3gSSCCQ48t9s+AmJI0lBEIRe/IBu9YK0okcn/I8Mq778ZeIaSeCdeiqlaIWQWaB3 NFSWuj9uiqPsa1GY9/lRr73F7AH3Vl/LhK+n0LAwX9QdKy0vUwTHyD0GGZiFDJLAhTUJaGs6IvRH idLbirSU6JGX6YgSYbjHbfjflVhsGJBKqlsThWV/SlOJaMQCqvJaacK/0mMtGw4j9CR3zk0RaYCU H9BellIgiTPUxx/nt+FtIl41M3g2jH2zNCc84SV0pTg65oEdP5ilVkrHVJATk16lEQRfNAqkYsO6 cHMsVGw4A1qDgSbkDRkKViA1JpCS+zW1p9sAVVxM2bqJjk0281nJ6wRImTtrVUTcvVN7usRznvMc FgPruEzumpnWvVNW6sWwySSCrtVKGnlZX4LteLFmwikFwS+u2XirF37p3pJqBu5eM1AQdA04VDVY IqqUMhbUN0qWjhlx5fzjBAEpoYu/aC6lLGFP38AOmci0A1J+MOtEVipIEPIDqdJInAvnqOdAkwFS vRgrwYwTzyI5ztHlh44XfJCggpgAqYycsvaCT9FvhSjdkjuQxtAimdMpH4cFQKovFwUZBEjFjcZ9 eJ+LBKT8cJ9ZqtNlJsLcn+EaJEEIGBnJOC6yiJDsjotJQHvq4VUDpJLnVyfy4E5ASqnMDozUuNBC 6FSt5KIf/vUULBDJPJL3clPQZfBEgWtPeeRCjMw58zOa12WaQCrgzPu6DCCFCzQQXSlopAiBWaql aSvGiMuajBlnnDE+K0EIVmj5r0gsQApfybGNMrEQAbroF/soEUEzVZcJgoAPyQ+xUJ1+G5iGGAyy DQmGiFrUDDJISIvjpkTW2KtEDZGVzvWvIDTqZMM+84tONRcgRXrq9Mj9ACkvuykUEXVRomHVBuuv z730xXz0yGPIm77sZS8jh1e84hVEd87ZZ+flwDuyBaRguMJ+sWHsBEj1teHewQCuJYq4oL7sC0KZ OE6idMkllsAFiEAXxx93XEyRpgKkMpRPX0sXLkCKUpD6eBceFZesai/ib3IRIBUuCtlhP9PZHHhR ovpF0NjwEyDqcU3lz+QYrEXjKxImC3AJYUl1B0gF0iVBnry1myPYaLHFokRy4C2hCkAqKEd3LsbP pctIea0JlYrZuElc1vb1Pi3WIhhZh6cGXYar1zQCdHmtg6d9R3TJqvZVYhEXgWdFqR4VJeqPUSJN BUgVG0YMsehiOq/Pp7xv7ZE1rEkRkTNxZTG4jsBrqdMkhr4ma5X5Po8CpKL9kE3s+NLHNQRvcRRx RByF9DZiGIb1f8zea7qAjmAuO7Lyr3qAJ12YNJpK1IShGvIQiVQEI5v6sMyGk5DTop6l2mLDUiqi BiFgB81NPyyy5BO0SXVNiqk963K2Go2jwiGY0szxGPRw96xBJhm64oZYsBR6EaKyEq20Qq+6Irn7 M8fx8NG0zhNJIIE1KrEMFjLzCFy75ZYvLL/cyNyzyb6cLlfgFKM3oDc7wLY8SoWhCvyCk4QxE9t5 pGDZzFPK1Jz3e486Sp0G2da3GlI3t7YaTPesCgosYtGcAcGlo3CtXMPKSBECCza1V+a2EpyIoozg 9W0pFkCqGW90GGhPB47H5GIk0uTtqCC/jfbi2nLFHdj4KOGNs+MIqMMlEuiQGbPG22Y0D0gVfxQg xZmyGd3YOFssB50tDGIGtAxGZGqvtNjigs3wGln/UVgLkMrUntZZmuBqvlJGkC8TsfiCuB5ewB0T AdKWWXurwyvCeRUgFeK5CbCDuEgmMUBB/prjYJyQB2/FnNCDIyyQAOfLxfCVIB0nghgFIQAFSdKY QXDSovEcTj0qIkWDPwvuDLhBtqkBAca6VHkI9Gf1sbbAQdoBVlxeRiHTKlN7RXQBhYIQcQU9Gy6H fV7eXHC+6cN+yUiVoJKYzTbCBYgZ9qFAA1w5zoTGpFjKNEeAFOyYaZGmEiP/TIuk3fI07JeAzd4K kMpNZSU/+Ou8CfGQDKghmQpBynaYdKPu4MhSbXAGeowfGIAZYeDscov5VltVMiA9xaXOkpFqxVRP o5T9RjNSeT82nNVLmmgq0Z9es1yPPbd6YtjPErSkZ1hCuAAg+J+kl9SWjBQdtYCRpjGYqb1mgHeT Z8Namb1VCe2E/VyZ3gKkWsgg7JeMVAH36iSi2HBLiXp+6hwBUqMZqSKB0lzEXpaUFSXeftttjD+I GRzBPjZpkB6pgKuPDauQsnRhFqgLExHvrd9hsEVMEIbhsXcy3iu4M+zj1zwmc4r2/QuaSLW6z9Uz 5ttGx04tJaLByk6zgX1tWOdNSkYTUnHo1C+4X2NCi8AiQwIMkGo621H0PILpdUldmB8DVQN3Iq5i w/jlMbhWfpiIkj70ToBUE90GSPF42McRSjgic4vwIu9kgoUeGXw+pMC+l3WHMuLCQslINZPEYiLC QFhEIhXBui3YpGk27DcH2LRhaM+Ykx/ghzO1V/zwKSefjAu67l0iPFhgHWKppx9IwQfvP+YYMN8y bRHFzAIDKhyyHssAjcxMGDNiT8XL8mkeECP7zXfwF+bUQDEm6E9dnazNqekVAKyCbFGoEFGyj6VH ELfNERQU4RThQJlOwArgAr35xtWaAI+sLx4d3P/So0wka0ud9O0pkniBEKy4OGFArycLAL6GYCLd 95HSK9QWPBfgyGWUjBRO3cwn/STjd5dVWaaxRXrd8vzzP6lb6rFxK8zaLk9x0O7rSxZ6JzSWKCJH gjD41X3vEDLHylN4gccnjUQFdbqQChabR/AmxGM+VFV6V9AGLy/qJABo1BAkC3XV2eylfITknMr1 53wEoEJa85pwwn/JkLkfLuhuyy22AM2DPHRRIyrjLTZWQoVH3IHOTLwICxcji7FGR078i76drxRd fARxwdwSJ1rh1vli1PKqWikuBsF8JUwACHoNgwpa+rD+euvBncgAZXDBq3rkBY+gZLhT6wSI8ayE 9aaCbjLabH9ACywt43I8esQXZ+GO+VZJPnhXQTJXEI/5fBoj0uZ8WVJEXnZHKbHHywbWVifIvUVT XvBUhM6OWYAdfqOmsM/vw52aDvv+1QoXWfw+gUhR4N2gwmvhAo8AKPojJS8Lh5nSLVFfwfu+8hVe OIRFid6E20ZG/48+yo/bKIEqC/u0L27FYvGrOT2UTBLGCnbRQ1WiqqJE7OvjCINW9ejkybToBcQz fsWZt37BPDyK3OAwyQamEma9P7JGat55Zct+/vPHv/EuvYMhUSUz0ArIWbAC8oLhVBIlCjYWYGma Dau/ZcPUCnihJ7sksNjChUk076s/CIOOWJEA9utf/6oMFbTLIMlTcbDDy80ujHHEmKkp7KMB11ki RiO4MMoyyPSjmQr1lNh5oZH52dFvIwrjbJjNWHMdJUaq+qa2Hs+E/eIXWuT8/dmadEMbCrPYvKlE PZGLEJ69X9ineh4GYWpL/rg4IoQlg8XAYsNh0KV+/ZfPV48AYX2Vzkt0HvmXqKFAv0EHNkMaRfse bbH55ln8LnYoqJtHidq98oor8g0HIyGuYsMxY1XJ3xAgvjbacEPaKR4sSej4EwLxQ6xJxreMP9XJ RxEgCmOKRhSWlNGp19iwxOqIH/7Vr/z5+9//Tt6aH473pn0sy9nruSOm+MTCgOAVjgiPxRFZciDJ 5zWDLjFIu1hLizoCOg3JkpRCP4HowoGkBXbDmpb65WQRBdUs+474TAqfeuopLRsG1zTE4ZMPNwX8 FT9s5hwXrGuIAGhYVT39QAonRreAMy2CwATX3PIACvGnDkD6PI4w0EQJfssJuy+g5oMvP/ypI2Ua VfKGDeUFVl4wDQSmA3hfi55mKFA0JHLwPtxZHinLhwaBSS+Jvgqy7Dz1GqMp+shm60KjIkxnKHpi cGIVb5KL+xMJMueIHk7BTcEVjoQO/fZy74k3U0gJN6Srg4acFIipD5tsUqcxDS1wW7wM0GlHUBtG gJI6ZAmZ+hK5Qa7up6BuaSxFProWqdqNQPj0yIVUA27dKZ8fC3h6Kb/pAik8tWYuOz6owZ++uZVY VjxTFQmKqhVmCERbgbbIplmdGVVZTKZsiDFQQy0tU5AmBAyDYLO9mrbNSaIv54ULxqZ7F/bxaw2s lDX2CcFitcKFd3CRBe+e8uPLL7ccymXpOYsy/Y9Orhw7ISbsc98ibkiFeMgKJeFCWTaWOUSgBJgo BTUt402YadGyvMI+Yrg28SPBlY8TdAv7ckKcmha9bwghVGd4SphEKkFlyI4M3U0NXFiTfUIO+7AU ONtkX1ZJF9MiqZpPNGLBPngKe+WLgWhfu4TTZB+wzhyQoChWGd8raCC0ww7bx+NneRnvLOgWLqBk cCEzgFqUvMRXtI9g9dCd+wp6jSRNJXDugly+u0SMf9VsRK6q6EJBEIcX0i656bzFhmlEWdGO2Yso alMw5udfeQ5zFhID4g0exUv0k63EhiiVDySDMIzFteL7/Ce1Ya/Rvn6EToYhnBgBNm3YR4Vs2FPq A+tZdWFf3jpfdWkR3EG8AaFc7+jnmY+vpSMc7lGPFpPspKA5My8x/oRDnhCSThdWgwylienYCS9N 9aa3dEYkmdZsJm/0NV6IEqG3bd/61vTQKJENE07Thmlfj0AMS5bQld7I6NSYuWCpjKJRiE7Uojkf PUSJKgeJmuwzP0ncGP/nL/83G6ZEIBsxsWGQq+mIQJCYhxZ5eyOcwj4vMer/b2RFJkM43qJ9tPGB xJtVR6AYR1G6MKaEhvRuxlNsGI+x4XRhF/k3bZgYs9wqNox9VmdwggUmysz0Gjdf8PznQ/+RBpJE InuUzDrrLH5AITTVtGFK5EXjMMUvvMszye6oJ9twRPtIzVfq4cK/uPA+j8rIvQ+85mUt6giZWOT9 mDrPw+nRvoLkmT6IGDaPMD8iN3xxmF7TdFJxLRveYdSG0xPh2l4/zOy75yamMBpO+WuTAkhNObnT 7ZtM0IdyubIaNKKACPUZN01gW8Rn+sZvEXRgU9MJ9QrjBtUaRMpmu0TrjEcZsXkE3sQlinhB1Glm /hXUY1PQvzIuWZzBhaEZVEqFeZq0jff1TxkpjlX9Lj/86aYsrsUd3IqX0WBUp2BzdXlmhbxZWoSM k68OJNIVCxeWTRiPxgXrwyrkwlLWeKtwoaAaYItSJ05DmGo5YuQZNRYuSJsDUop8xEv31ekFqKW5 GJZb4XEKMX74k0yy6pmUeLTSonqSqgkXQHkpiGbDO2SkRVQhrxBjHIJ4j8KFwUkpaDM9YIhyEfbR k04688yR6KgJjN98802k4cp+/QoaJ5SCXvdOZi3RCfs22RdFgqQRw/wK+/Lw2Y0zXGBfkCt1eg2W zcjVa0bS6iQ39xlwSTqGfX68yX7ms9Kif5Fd2GeNYd8LMWDCMQag+nwfmoDhKSxCkqWgFSoaSt5F DQyvacPUBAjGJoXVADKVALtuMst8dgdvqZC48EKbqS1vTokNF2Jiw0WJTRvW72LDngaDYq0UhIAL +/AQFhCMfRSymbA/kue77z43SxcWKZtdONG0sG8IgX161BwNakttZO4FZtksiOWiRHPZ4f1fNnzj jb02rFrs0FHpibxByZFEwlEiatGcgUeRKkjkfmEfhm4qsdiwGooNK9trw77fSRf2NKOawn5mryRp sIwM2KggORJ2x/1Mr+uSxhulIOjQdER6VmEfI7HhdGH/Emkp2GvDUWJs2PtM1x2XQBCdqooBx0Ny R4GSn2z4Yf0rflhxtkpNamO6GlWwKDFwme4KMZqAEaFMNXufOgr7OkLYFxF0Ybz7OjXulP1oyJss BE3eMTJPQQTzEqFfhslNw62mDbPGpvHHjBMvFFEcI3Wx+XQLhJ4xjOeImOAeXSiXblmCkB8MvTzK bE5xmn4Imc2CZU4hrr888iOuJO+rs7cJjxIUm6USRUqLyYqXF8roKh4ceeVRq4lmqQCaputvsd+c GeEjmhIIpknZsXgPMeMzkoR5ruZ6CAU10eSiOaXSYr9MqaTFJhdhv7xfmmgSFo0MoMSw32ShzGyW aNrLfhF4UxdN3vsqscl+yxqLHsdRfRodR4m97CcAROl9m4hNjqPBcXhX+WA23KQq5lE6Y1/VF2m3 eO/twn0ZGav/lmrHYj9KHMuGB+Z9HPaftDP2dUTjMFIk1ithVhEwNDAjTKuvLxrLhvt24SLeJ+3C qG2606b76u3FwZdFXE1TiW8pTrXXCfd1LMVLeD8D7PEDSssPK46YCqSeMXhiuiW0HFpc3Er9USVQ JVAlUCVQJfC0SyCorgKp6RafPGMYt0ZKrjUn+tWrSqBKoEqgSqBKYJJIwFy25QwVSD1j8MR0S6hF V7CUvFS9qgSqBKoEqgSqBCaPBMQmn2YPvAJ44sJ6XWw+cbKtNVcJVAlUCVQJVAlUCUzjEqhAahpX cGWvSqBKoEqgSqBKoEpg4iRQgdTEybbWXCVQJVAlUCVQJVAlMI1LoAKpaVzBlb0qgSqBKoEqgSqB KoGJk0AFUhMn2+m0Ztvi2f/NdcGnPmU7eH8602YwWWSPRzu/OT8kNdgZz59uZmP3wS4Hm9j3z06D /nUYqr3yuq9etOOiXTRti2rnlVBlUaRN+TRhF7suh/aoyvahEak9D23cYsd2u7AMxnsIQ1V4z2WP voFrU5D0Rs4BPO88G/HZiT5V2SH9E584TyvOoun4lY1tGIfFe2HTyRunn3Za2LfFqG0h7XY4sBAc JGAzTFV97GMfs5knNfndexr6APXbNZ5RMfiQar/d5sEPA1TowI3zzh3RyxPKP9Wmi/aHHKCqUoR5 24od46eNMu46/fTT7Aw58PkKqdlGl6piVHbItEtk2YW4C6kp68uvs88ecSxMq3ttDumyZyzeXYTA BlDrFKMuZs/j0TvV+E4tFPoMyHag6s/5sAOQbdsnwuSm9Nbi8Wy26aaGbCswQJ0hzLaZNEUCYd9v AunuVFVOjLEoZPPbfPVgvA/G2pSXqkBqymVV33wSCSSgOtHCUQkuhwbYD9fRCjrwYLITRZyS++xn P9s5JCp3OQ/Hn47ggC0Gq1Mp9DjOyXEWzodxxESXE3VCA8JsPey8CId1CMm5qRUScBiCkxwGhpLq EeQcVBeROibCNsFEasvggdkHwlSFd0dVpFpnJ9t0fuAKBQzHZTiNxNETdppJPVpx3plzP3Lw5cCV O0njgP33L7w7x55vHbi2FPTtD305OCXsO/PHkTiO4xjY9WPQSYKqcvAFjTMDvx3e10XvIRUWn222 2RyQElKdA2ivbV9RDSwBCnL0B1t14krqdFpIF95R4nxPR7vkqNPU6cAf5x/nWK2BL+cNOM7IyUUM ni05UWDgqloFQWcU8iTOihlY6aVO0NZJKXh3OgqDZwO8ln+JZWCCQROHqzhd2/EPqQSA4EkcQOTw JYffDVAzTOb0npe97GX2KC9cM7BZZ53VETQDewDHlDkThtJJAPvxKg7j6gijMWjE6GShWJTDarg+ J1nZcXQA3ie6SAVSEy3h6aV+PVO6yIni0I+44jL25ffFgJKlmFpZqNNRLa9+9audZGkjE2cjCFdO bpLl6uj+jKGNdx0Jxwt07/D4UqFoZEgqSIfNv/3tb04pcbCUJqaW8fK+bX/BCIO8iJRrPuKII5zF VuDaADUTnVMd4EgBINVKJ8BSXdISCANHjKGlu4rfFwgh4I4jSBp3BH2O6yZhx3s5I2gArpthTzJy 1112oaCw71QKsQQW7FItA1CVfKHD12zZ7HfHNGSIAVJHDqM95ZSQCkKJ2SVBOwDBtA+JOvausO9U PmC3Y4dCGPTgIJrQKfw7ea0jkMK7qgzM5Ev86EhhU1YGOZIcYjPTcs7MAGJsFim82y6SdgwhSBio 6gKk8C6t5VTNkuFmTpJ8OTF9MIIJMAdIS74WYUJXzgDtcqpYvB8F8c/Y5wD97u5UJQsdUIiwWBRn 5RBoxykOBiIHk9iUl6pAasplVd8cTwJ6jmMynW9VEtr6qiMFROguA2hZfTU41EkQNcQ3xyGZJMXd XRlGYN19fZMM6QepCDm53IT8jPNE1i6kGoTxHfxIqYTP4qA7BpWMyAvooTvnv8p7dakWYBJKywAa LMP+wBi68OtoZ9EuhJlEgKugwC4iBaAdkVvwrqqwf+6555iV6FJtylI3rgGp7lWVGhiAU8byJ5W9 dqmlOkpAOhOQYlSCtMwu+GtypyPBQXhCqV7gEEmheigJOXp38DYn0JG8VnGTekYjSOVVHJrexezV jHfoWeD//ve+t+iii7IBR8vJ/XQBUjFLBxgbm4V4rThkXVquC7WcMxftWOICdHhX2dkus5BFtpLH 2O/i7ZtqwrsBZJMw8mx6wuGaRMfaKpDqKMBa/HEJsPhNNt5YEqIpEX1e8OvS8yGnXXfd1RShCTgu zyjNCHVyAikQxwQHgkU7XFsbtPXWW3d0KyKocVgXAfY10BaQ8g4g1TGiSJcJ+ed/8pMycEKULBdN dVzQgzBB9MADDrA2wgWkkmdHp493gK+AyMiH7oaSQJogICV9EjrJdvHFFsNCF79z6y23AD3sc889 9thxxx3Fp+68/+EPI0BKqo++TEjJRusCXYhM2QkCUs72ftOb3sSQeBUJuY79i1KkeUYOmX4CSAHr XEH3qC9L6rxeoxG4x4nRlgp0x+hWc26//fYgL/Ga533nnnuSRndNqWG4QMqAGZAaCmFPQSUVSD0F Qp4umhgBUpts0gJS3TmHS/h6KwakJfbdd19LerfccsuJAFJG5+bROhIszC+77LLWbjsKVFzh9Tr6 6CaQkoS/bfQy4tdEl3mTvkBq/85Dcyu4JbpEETHF2NTq4I7sU4doZFC+2OhlKlbeqIWBplZlfYHU 1FYy1vsTAaRM7ZkhjeqlOgxXHOLUhWBZw5lmmomCXvnKV0pIdASmoYRSwNP5TOSPXs2EXxdSW0AK 4JNCMynZpU5rlk2ZWcJ1yxe+IFrLfAw8WVbQnpEDMRYgBfd0Xx6ncpUAfJwqrCbFpdd3VxbaOFV5 PrK1RMwIqjvgixyGC6TM6wVIYVm2j/FbMnXvvfdyL91xfxf76Vu2Aqmhi3Q6rZC5WxA6EUBqiy22 MLo97rhj9SueRSsTAaROOOGE3XffvWPgB25MF+rtMIQpnoE/hCk2ZGovGSkX72+sr9oZZphBFOwS TXuBlMWh++y9d0f2hSiEqRyCnG+++Qb+yKDZhXyeKc6J0y5AzZxUx8XmHDGMi9SJ6KgTAaRMuVpw TfUuK9vMmnWMpqb2VlppJcLUW60+7FhbxJipPdPllhxZDd0xEVtU0wJS1sdA6gJ2F90JyTPOOCNq yRM6f8UrXnHyySd3qbCULUBqKLUFQ1hmahhp3jyOZSg1+15BcotsJaEPP/zwjr2+kDRcICWdn2lN Ph+ooiwA3RctvhEZlnUNRZippAKpIQpzuq5Kn7do0WKmZojKCsQuAwgLOLbaaiuVG4Zm2Gcllmmj 7rL+2le/KsNRRrdmD43OO/oUtYF9l19+uQXRFiJ02aMhDH7q/PPNbFpq5jeUJvgJ1b6Osdy+y3LO LDYvmjJ3YO2RpRIdpYpCS0+uuuoq0wfYR23HChWH8KRkTBX5bRJKIqHLF4sqYZB8cWt2TD5yKF/X kySP3x1AN+XGLOFpwnRBEl30nmqz2Dzr9zt+ClDoBHOtPCNbPZRddexHpVr1bLPN1pxA7gSudfli Vw/1nZo+xaLIU+bs2GOPNcE3lBSa8YOJ1+7rAgv7hOlLPesZfF7A7w3ru0Ubc5iFJ8YDDzywzBp3 76qWRQKmHRPGhQxTru9///vphQ1kEKX++eef33c2w7Ku7iyXGiqQGqIwp/equDmpcn5KF83lmwtB a+CAyiOLo759LUHOlJnvisWVLhNb4J3e6HtAn1UbQ4dUWe7uQEoPR6ol5zq8L5i6j/VhR98qm9Ms IoWBNtxwwy5jU+HT1lbiva8sU611GL656yLSmD72KQjOsypWwmwo/k4ezgfbH/3oR9Epw493M5td ehpYf+cdd8B5aitShSO7pCVwKoiqDYD2kakJOL/Nb3Y3ALjZ5A7tqNCIv7uOWBRcYhoOlFRnd6wf vcuTSRiwK3Wag+6O9lQro6kTcSCmn6Ipc1v67MAZKbxbam2OjGqKCWWbEk10Wc+HX1xfd+218847 Lxuw9mgoxo9IVCFv9tlnNzjpMiJtdhlysJrNxC6uuyPp8E471l3MM888XJPf3ccSnP9uu+0G55VO amrPnh3lM8YuTmDoZSuQGrpIp+sKjcYkkOz2kcsMgj42cDiRhOedRSZDk/jrww87zJ+mjQbe9UQ9 ggeso565Rq+Q6s9jjj6mu/KsZlhvvfXke0CK7rWpQeyULSsiFUjE6S4fBCHM/EiTdwPTYY0j+X3A V96o4+eKRXTHHXecWddjjjmGBPB+/fXXd+E91QpIFlybJC1SBSW7TPYhyRBCbZEqW/IbAOoepaR4 1ZYKu2z2U+Rp6k3aoGhfMqZ7yBeYTecVxhnAUMxJEE3HDPsRrxmugRdc411CSyU2JSkLgwBod+aZ e26mNXCHNYa0x1txKVYgdVzIVSjhPGWPDHu67HnRy5dhJMzHugZmuRSka2A3mip2BQN1h33yr7LR pZMaocHQA0eT7pyOU0MFUhMq3umxcljKnmm5jB66uGnO6LGf/lSOp0yK61r+dHX5JsgQSg3wBERV SDV91iWUFk3jlwTAiKEMylMtcFboRHZHJMHBYbzJ+xDXHHBz2DfKHxb7f/rTH8ERzpoEuvNe1CSO qq1ItaPqKR3LoZBgUzMb6GL8IRUwZauMM5V3MftUiPH0oPA+lCktbGK2MK7XDyXaRemF/UjAgrn/ +e//Hsyxhnd0mtcrqomEXV1QL35xXbQ/FNUXHjk9XHfs9S2JYZYcumxx14R6eC/GH7tqSngwZaUU 3ksnRfBQ7KoLPWOVrUBqIqRa66wSqBKoEqgSqBKoEpguJFCB1HSh5spklUCVQJVAlUCVQJXAREig AqmJkOozuE4Zb+nTelUJVAlUCVQJVAlMQglMwvhagdQkVMrTSZLFIj64MNlfryqBKoEqgSqBKoHJ IwHrpSbnSqkKpJ5O1DIJ27b41Hd2I8cd1KtKoEqgSqBKoEpg0kjAAaaPPvroJFxyPi0AKbNRvmjw hVfze0sfDbnj24Rc2c6x9SVR34IF3GSb/75HxY1T0IchSqVp/3Y/X/YpBls+4GKs9kGpV5VAlUCV QJVAlcDkkQBEZ8KkAqn+qAD4gFdyQSHlKh98ElxuNl+LNP1rbwkHsa266qo2vC7fczricbXVVlv6 icuGRquvvrqbhQJgyEfFToW0ya89JFtfgMNA1157rV37bCxr95EmAtMiddp6Z6211nLGQvMcDI/s H6ghB65pefnll//gBz84lE9MQzakWOTQNCa8kMxQvo+tQGryeI1KSZVAlUCVQJVAkUAFUmMmVoAA 2y0CJbYxhGlWfOJaZeWVHaCdvT3sFQsneQKjeM2/3oSKlHUoAbhj9+dLLrnEvoV2QE4Ru/eCMm7a Dt/RbJDNnHPO2dwPGopyyK6mnX3tbBOAqWyhploAyGGWcJLz3ey05nyuwoCtpR335hggJ4E4q8je bmUvFuDGCSHPec5zjjzySO3a5/f++78+rCMhgTkntkY8MKJtqUOS+m3joV3i6r7xcQVS1W1VCVQJ VAlUCUxCCVQgNd4MldPIbbX83Oc+99BDD5UcyiW145yNJIosMfvUpxw7dr7Ngk1Ggjj+tAIOhrDx sTNcnfbgNYdwOfrAgUSQkARgbrogJEeA2Xv3Fz//ee4AJVdcccWss86a7WLPPPNM27yWkwfsfga3 OcNVBshv+ymDaDnNW3pp//33sxE+kvwJTtlo/7rrrku1gJSjFp///Offdddd4zE89c/U7HCDPfZ4 R4Rz4QUX5GwH9Oyyyy7OEID87H7bfXu9CqQmofuoJFUJVAlUCVQJVCA1HnYYPZlymxe+8IVf/vKX A0f864SdAqRKYYesPetZz4J7CkJy+I7juy3rcQeEmmWWWWx+31oL9cMf/tDu8g4sKwkbu9k6VRse ChxxFAk05pTEFDzvvPP8mdMcTZnJfjmPM004Ns6m9dJXyXvBNPJPTsIq84wBUqChO933NQ6b6rny yiu33377Ag2LQJCXrFtOP6hAqvqaKoEqgSqBKoFpUgIVSI0HpMAXM1MBUrDO4YcfLg8EEzhGvjUv 5qRuQKocWO2pTMxMM81kms8KoVNOOeVFL3qRQ6+SPSrXjTfeCGDJXZV1RU6xcF6bKyeCSSApKGWV 5eoOytXKGWec4bdqYbWXvvSlZvTyJ4TnsKcchWFOcO03vtFp6iUj5aQ5Zc0kQlSqHcq83q233uo8 XfOSZUuPXojmdE9HaFUgNU26j8pUlUCVQJVAlUAFUk8OpJ797GeDLJtusonJMl/glwJN0NACUt5x ps9hhx26zz77nDR6QTyST81TkxR3xrUMk7m8UqdSJsIAKYjNTQkkQMpJkwFSVqAj5vTTTw9yWmON NZw/L93V5AHgc5Dqyiuv7BD1QiGgI1m15ZZbAm3vete7LK5yImaXI5zSooVfVmI59H6brbf231vf 8hZnrbcE+mAFUtXNVAlUCVQJVAlMuxKoQOrJgZQ5sp123PGAAw6YbbbZHnnkkRQwB2flkyRQwEov kHLTdBuQZOm3N2WnrLluHu0pJ7TddttZO2VZeiGib0bKAqwAKcBrrIxUyTz5QhAUs/q79fUcXJXD yVEFqC2yyCKZPexyfeITn1CPCcT3HHlk/jNN2QJ2FUhNu96jclYlUCVQJVAl8B8VSD05kDK195Wv fEUG6Nxzz3XmcwqYsbIOXXYnq5eOP/54EEeGprc6L1hBNfPMM5toa4IbyScf2ckSZRYvl/27d9hh h7nnntu3e/68+eabIbATTjghBX1tZx16WjFLaOsEX8lldbkLpDPXJheluXFm7jRh0dLss89u2XsX FKWsNVsLL7QwmFhg3DrrrOOLwma1FUhVN1MlUCVQJVAlMA1LoAKp8bAEaOJDvACp1ns2PrB2e8MN Nwxk8Vmfj/t8std6DYqyoMrndVaCFxCWdyzQXnjhhffdZ59mmgpguvWWW8whql/rdk9YcMEFbZma ItJgkIqv4aA6N+GtM884I8kqBW2F4BtA3/H17tuktq/ed1+SZwDca17zGuuW7E3QEUj5NnDHHXYo E4iYtePDpZdcMnFAir1KpMnbYd/vZs/0p5t2z/JC65HX3MGvpxb49xYERtX52GOP9RZUFtJ1yee1 HIGXfaGpoH97C3o/BXvdh5e1pSAs20sMCtGJ2r5c4M7TsdhXZ1/20WCyWMG+XAzMPrivRcX7sq85 jU4t+1HiWOxHiX3ZJ8xxlPik7ONlMCX2Zb8osS/749vwWEps2nCvKY6vROxPDzY8vhL7Gv/ANhwl 9u3CT70NxxENwH4cUa8NM7YnteFxHNFYfpjdFj88tTbcxQ9PrSNC21T54QqkxsQS8IGPzsyCWZZk nbiNnRhcedtiKd/2+6bvIx/5iLktiGrvvfcmzZKbue++r3zgAx/wyGUzqEyrNS+JnGWWWcbnda37 gI6VVXJd1rZbMy4d1UwvyffAZIcddpitPnfdddeyZovhWvlkJZYpyCOOOMILWi8rlnxbh07zj+5b 1YTas846q2xPNTCckhsDNJsrsXozUr7aW3KJJaTBBm4lBbP9gQ4vL4gL6+W5sGZX5LxsYUVovp1s PfKaO5b820YLftVDmgXVKVlInmTLHzUfxfP6bsDqtIceeqjliBUkWPr1b29BjCtFfayiVdDL2tKi dlXS4gKF6PThAo5avsbLuMM+TltPMUgmAD35tOqMU6AsU8Myqb3s++gBF3Y16+WCgcm2fuD97zep 3cvFZZd9Dhd2iG21qIlvPfigjUIkR3ujl1ZMPSMVvu9VovEAAz7ttNP6KtF9T73Ty/7tt9+ebUpa XGAfDShBj51Eetm/9tprsC/d28s+rvUjEiCHXvbt9PbuQw4hvV72TXD7NITMW80hxss2k0Pq3Xff 3deG6Vf37GUfy7Fh35e02B/fhlkgGz7m6KPZZC8XseGrrryyxYU32Xyx4ZYpFhuWBe/l4nEbPuWU Xhv2MhvWT33BM44N9yqRJC02JdW+NnzDDTcwxbFs2NpQeuxrw9ZCYL+/DX/rW2zGaHYwGz59DBs2 /mTDX/3q4Dbc64iuueYapmgZSV8bFrzY8Pe+N4YNv/vdglFfG+YxxrFhhtprw/Q74odHbfjHP/43 F82EYsOqZcO9PfELX/gCJV7Uzw8/bsPHHNPXhi2hGbHhq64ax4bjB5pmTFYXXnihFvvasMUw8cO9 PTF+uGnDFUiNB6R8H5c9BXbYfvvddtutuahIHogd6L0cIpjFvzc3Ch9JLN16y+677+6jNuGtL2Sh 0auuurJvWghoOO/c8+Ak9TfzVWiV9ZEeA7B4RmULiAHysgmndVfoce2+227Wqoc9UIzb8oL7Elpq aG3EMBjKwRrMp5fmssh9r732yleEZh6ZmptWhs0444y6nN981sCb6AdIYRNeBG3BBew3e4WhlcAm L2irrdYj/YfuLEeTRLS3VsvXGKzwlWZmfdgIjzbrpGKNvvrVr7aoX/Bu9Sgv77///vYP8y/CmgW9 qR9iXNnv9kAQL/t2UkHRvZWyMqak9Be84AVLLbWU363o5WXcYR+n+G0+xbIlax6RT2v4hX30LLro oqqFXVrs40KwxL5tLHrZF0rnmGMOE9OiVyvs4YK94UIXaBXUHA/rQwq5TzJs+S8FN954Yy2KKC1N Yfnzn//88573PJ+Xth5lLOs+FXunJRwsq02dam4Ro3U0GBEZZvT6fS/zpLjQW1tKxC+upYdJwELG lt834CExBUmv1SIJQ3U+EyHzXi/s5Te+8Y1Ipa8Wj6wUFKBEU/a97NM4q2DDLKSlRIaRHVjYVS/7 UOBcc83FGu1O16tEbgEXBmC9SmTzSinbiyPJSn9R0AitZW9Uc/3116Ozrw17GXcWnuK014atFvCI fHq5iA2TKtm24qWXIR7sWxfRUiKt0R0N0mMvAqNEjh0XHFSrRU2wFjZjs5u+NrzRRhtpkefvdUSx YQdIjGXDnva1Ydss074NmfvasN6kT/W1YTACF5xtq2Bs2EY8fW2YrGLDnHOvDdt8x2xMbLjVhdkb HSHViKjXhm30Q4m03OuI2Eax4VYXVqfplL42TP4skC9ljfxqq0/hQhgay4YFu/jhjCebPlNBH3Jp sa8NixQc5mtf+1q9sq8fbtpwBVLjQQgwpXzY3xcBlBd6P/sf51Fpcpz9nFK87wtjPWqSmt/N4k1e hriPlMBsmdeWW2zhv63e/GYj0VTu40Hwws2tt9pq5513fvPoO3x9RyCl7xlcgoPGLi1nqnchZttt t4XneoezXhbv+dnecbCXDWUkFw2VWp6d+9BD9tlnb3i6N5mBGJO5wol/WwXjvt/+trfp4b0Zqcce +6m2xDzttkjFBQrRybP3xmAv4w77vbkcDJKJBOHxxx3Xi8DQYzeyHXfcsTeZ4WWJJVz4GrSXfYN4 qB3IePjhh1tuyMsyK7jgN1stelM21EiADfQGIQVZAlKF2172oXODAWPWXiX+5Cc/dt/T3ljiZbVR oppbXGQkihL0SBS1uEA5+lkpaN7LvuEvsGh40JvM8LIgin2prBb7ohd3v9NOOwlvvSmZ2DD2e/OR seHkv3vZ9zQ2LDa0bCM2jJixbXgfNtwLB3FhQ2Hat61urxLZvKHgGDb8mC9/tSgX0teGRehxbFg/ tTVMi4tRG76ZZMinV4kUd9BBB5EqJ9OSKsoN0hAzjg3TIxtuAQKtnH322dg3Mulrw4adDt3qTSsq KOqzt15Qm9wwK5U862fDP5HnGMuGBe+3bLONcV2vKY5vwxdddBH2e20Y5Q8//B1gca93vrMXDRcb lsrqa8M8Br8xlg0z1F4bpsQptOFWtWQlOYoLSaBe9g1ozfmMZcPy0JR44YV9bNgHYbHh3oyUVuTb KPHqq6/utWF5tfjh3gS/lw2fmjZcgdRguZha6nEJtLBmE6L1AruBUVSZ2mOvOryBTm/fzoDDo7GW Ornvaa9PTB/wSPfou0bKiMSoa6zVRQqOtUhIqd7RDDpHuPjJTxTshUpNLlrDoMcLjrLfy0XS5h71 XSfhKUo87cvF08D+FCixl313xlHik7I/vhKhtL5rpMZRIoMZX4ljav/J2B9LiZPKhgv7vXJLT+zL /gQpcXwbpsThd+EnU2IvFoxJj6XEKenCA9vwWAXHV+J4HmzY7D89fniUi6n1w71KrECqQqJnhgTq ETF9gUW9WSVQJVAlUCXw9EqgAqlnBoyoVNob3fSKBG+9qgSqBKoEqgSqBCaPBEybyoh3mXKZoBBv 6dj/m6Cqa7XPRAlYyy8lbrKgXlUCVQJVAlUCVQKTSgJW6w9r8fEQA3QFUkMU5jRSFTOtV5VAlUCV QJVAlcAklMAkDLQVSE1CpVSSqgSqBKoEqgSqBKoEnhkSqEDqmaGnSmWVQJVAlUCVQJVAlcAklEAF UpNQKZWkKoEqgSqBKoEqgSqBZ4YEKpB6ZujpGURlNvl1+frPxvT2Dhl4e3cn3tjy25ca5dQg2/Kq 1k07kQ4sExvQ2zPQLoj+tY8cCgeuqhS0T4zabCz517/+NTcdxehONifsuDryN7/5TUSKWtv3W/tZ WhmA8kKY2lKtLV4GqKdZxBZfYb+cLqAVf2Z/0Y7s0/6weC80OxKAAYR99dv1w+7bAwsBg7QcImNU fvtUu/vnRQyeGBl8SLXVZ+8Rn1NFNsajl1ToUrlvdaeqktbL2PdVfPpU6vRDj+iod8uKVYVaXKuw S5dvEfzHP/6x5Vi6sE/LfAgKndcU7ftpi7IudeI9emeZqYcXZVHq5w9z8OvUXvpmVK+3lrK2sEpD Ax8vhjAkRenF+IfiVBFJjLEoRPLbKB+M96mV1dS+X4HU1Eqsvj+eBHhPZyM65tnl6AabgK+wwgrN wxOnSnwOT3BuxiyzzGKn6ax5dM6GP1Xee771lNcMiKAqx1mo337iHTsnwuzLrDbHZttrO5T4+HG5 5ZZz6guBdDlvkSe1zXpE6vAKmyM7stqmxlPOb+tNOnKMD2qd55Bq7WU8sI7i4tWgQqeDi3lpjstz 7AP27cvcJfaL8baoDu82N99g/fVt1T0w7ynoPCibLFNW2HfsSQ7NHLhaDGJTVXPOOSc5+NfvN73p TV3wbohxqgaDn2222ULqIossYpPrLvIUkKgplp86Z511VvvUD8y7gsAZZtX5qle9KnXqXBtssEEX s1etrbdVFfYdKm8L7C5ENstyLPPMM4+amVZHtKdaEMQ5LXh3RfvYd7B98/DWqaXcITbIUxVDTVmt OC1H/SutuOJgvRUcWWD++VXLi5bB7QePP54BoJxMppbIvA+VOvuVpsL+XKNexSbvHZ2qmjlqe77H ojiTm2++md/uiFAH4/FJS1Ug9aQiqi9MqQSMnrfYYguHSAiiLv329a9/vSO0Bh7rc8SOB3nJS14C puiuYqoDGf3prJjW2YhTSuLoe5wIlOP8VGHJWGpg8pqNcm1iiXMPS/DgRp2mstJKK3XJSPGejjFx ZEdEapznIKB55523C47k4Byeuthii2Vs6nJWhrMduqQlqH799dZz/omYGrFg3xGnAgyau8QqZ0Q4 PSO8O3zGqWTlaMupUnp5GQpx/jEwKokS9p0eyKi6ACkMSiGoyok9tHPPPff4TSZdGA/Bf/jDH5yt 8b73vi+kUhmLcgLPYLxHL07fc457YX+Pd7yDgXUhVVnJkoUWWkioC51OuHvd617XMYeky6vKqY4O PIX+u3T5lrhs8uLgHQMJjJeUz8AiVcPiiy+Od0fWQOdswGlIBlFd8C7enZgE3/sRwuS9DNLe8IY3 OMlxsBw/eqjeIaHNjBS7deoL3DYw6kWYtJY6QXzsS275zal2sSj8SsM7OiZnw7sMANZYYw122z19 PrCixylYgdRESHV6rFN3EuPFpNIh3RHzjCG6IBUdSSBx3pZg71AtHd5QD1brLmL+yCine86gUGL8 ZMhYwrwprdVXX12GpotDcUKZY8iaA1A+S80dg4qjAJdeeumSzBetnSj83ve+t4tUhTo+2vm7qcQm ftg3D9uFffUIdWhLJZpwhmtHIAXfO5EaIinMilWOCHTwXBf2U1ZYgifMbnevqtQAPor6+ZPKllxi CafgdalfnniVVVYRVnVV6Fm+E1rtUqGyTGiJJZZg7WI8c5U9kqXo3rno3alwekFH8lrF4TzH8IGS RxxxRHfeA6SgWxUan7ABEu4IpBD829/+1ul1BichnpXqX3d88YuDoahUYpxDmA5SLJVI9rP8jpA3 lYNQ2GcJQ1GWJDcADfKmNpZgKMUDdGF/KIT1raQCqYmT7fRVM9i00YYbfvrTn26yLflhMNHF9M86 6yzexASHY3R1LSkfh60aV3UXrqSOA9KH4kFCjLG+4CENg2vSEO2Mn4yrupAKPvJ6HbFILwGGthIG ZbDrBeKVlOrSkMC8ysorS/Zgn8adCY39LlmukA3eyUgZhrrkeKDVgYfOqRCAFvZaK0LQ2VFTqRyF JqHkILsovVXW+MSZr7lJZaZlOwIpuRPT7mLSGWecAUEa53TnPWDCjDPxArvgvimYLuYUftXw5je/ Wa8fojxVdeGFF0p06aTGZgfsf0BHOkGHFVdccWRV3Pe+t+iii7IBuRlC6JKRCr8ODz7ppJOMmlDI kepQEjMdRXHppZfiPXk43m+3t7/dCdwd60xxa6Sw3z3Dl9qMnw3Lh0LYU1BJBVJPgZCniyZ4pU02 2aQFpLpzDkhJyejqRx31HlP7ElRGqBMBpIzVOg6gOTsTheuvv744J5DwpPfee28XEEl63GgBUgZn Ap5L1Dda7VJzXyC1/377dYkoyhqSGjRbbMvpr7nmmlrpQmSMR3rDBIcFUi6Le6zk6Lj2AlWwSBNE drfSUsNEACn2b2ge1ROsyR2TR11oltKbYYYZTEHOOOOMRindV8QjJgjP2iDXfPPN1x1Ah8EWkPKn hjoaFfs577zzLLZjWjD6vvvuW+ajB5MqASZJXIAUgNJxRjuUWIFg3HjVVVdxTZtuson1Uh1T0dEU XG7ekDAtGzj88MM5k8EYb5UaLpDadtttzT/EBkDV4voAtS5uaiic9lZSgdQECXa6q5Y3MdCZCCBl Cl+2/IADDpA1MXo2fTYRQApEMzzt2EUlS2R67r77bsN9mQn/drQDqbgAKZc10ep0yZ+LpmbNBq68 L5Dab999O7IP6qHN7J4VM6JplyndwpogJwslv+Wy9oiN+TEw4wri3STUMwhIyRRasx/Vy6FeeeWV HXNyJp5ipaZ1zBsOBUglI2VtkGl3k4/Dis0tICWgbrbZZmaNuxiAVPQ8c88900wzLbjAAlZeWx8t QdWlwlK2AKmh1KYSqtlwww3N7v3lz3+GUztafqHqnLPPtkCCbJkWp9qx15dqhwukfL0RIMUDbPvW txbX5yOGYSW9hqUm9VQgNURhTtdVGSbycZ/85CebCQNdVHDt0lFlpLbccksOxboTkwVa0ZEuueSS 7rK+79+n9o499lhzKF1IRZKRqLURJjggCdG6+zfAxo4SEgmc0l3yMeZlJGYsmukyKdkCUuYgLBax or8j++bLLL2Sh7NWJotFuqvJp1v8aT6AQifxWinfpVq8I7JFm4F+97E+qn41OrUnP9GFwlZZ8zsm taneJZnUEUWpnAmtvPLKhGmUb1nPUEgNkMruDFKSHbOGhSQGudVWb+YEcgc+Y/wm0QammQMx+c6K fPtJnpaHS/lYJdblC7t/Aanvfz9TewOT1yrI7/mEBZCSPFt22WWH9d2iZVJGp8YSRqfdR48TBKSs NOfl6IUQrOmkLG5fvvPaa68ZlnUNS00VSA1RkrWqkTlyn/qDERLRuSwWAYMGHp7yepZxqKEEOT8M 0Qx8uwyjeWejHPHe+N4cREg1e2KaoyOSQJVqfbroozCf7HWPzaYIzT6ccMIJRaTcn6VIA3+rzEzx aFAuJyFjlGp5atG6e/inL5GJ6wd2pT2GEpyskZI84EPRKSHhmzU4oEtnA0B99WmCmCSLVAHW0087 rUu1dK02WB+QAnn9/scTHzB2qZYMM7WtQhCqi9mHDDVYx2ZND2Gqcyg6Ui1bAqRMaqtT5+rYj0Iq 2tQm5HMC0ZR1cloB1AYTKd6lS3XP5qcGutg73vEOSe4uM4ZxKRYwAVJsoHvHLwzCpgZ4vtu46KKL /vynPw3GeKsUqGfDC2Da7g/ds+bhnXbMOGPfEMXv7uvDZNwlpTKtmctYmvZNdw5FCMOtpGakhivP 6b02yWdYyog/11prrWUmYuBOJSpnJYcZriAAk/qWd9hSwRhlYFlzxyK9gPeiF73Ih3shdY7ZZ993 n65zW0iSgXvda187++yzD+vTLfXIFRWRGpgaoHdJbpsps9YY73BkqoUguy9ijTqEZ7koexSJTwMr qFnQAil7yUCT6MS7dcddeE/NMmenn3662opUTWtCPwMTLOQLxmpbYvHFX/CCFwgnfiO7e/YIhnjF K15hIK5CH8B2XGaOQWzSu+0eYvm+h+0OeuCG7bff3s4UvlhUp5HPwLs7NlVwzjnnqE33t51SNGV6 y55STRg0VSoL7y9+8YsZVclqWC+VHbCsEJ+q2povM3uL4m2nQghS0SZMO667KpWPfMSz0Ub0ZV57 YPJ6C0pKMdShpKPo2rCEdmhfnXTkN5fVPW/E2q2UKp0UmoSrhghShyjPCqSGKMxa1YgE7r77Lh+G 5Lrhhhu6dCfBGA6zxLJsnGNexp9udll/Y3BzzTXX2N3RVlKFVAn/LqG06B6/Vp/IGHUPoqVO8y+F ThtydlzJKyWD/SbvAw/xey0epAB/b7/99mH5u+9+95HsIkMCeB84u9kiVTpKbUWqHVUv2knEqs0K IYL1r9+33nprlyRHCJaQYPCMM+x3MftUCIaqkAGE9y4DkiJSbN52260Y16fUKeM1lERXlF7YHxHv pZeCO/rvYK72D3/4/TXXXI1OoKTAx0iYS+my02M2Jyva1/27qz48ohOeMJ3dffzQFJq8jpS5FQiD SbJZiq7xTjtNj9qUcJcmZBBLJ6W4YXmVLiT1LVuB1NBFWiusEqgSqBKoEqgSqBKYXiRQgdT0ounK Z5VAlUCVQJVAlUCVwNAlUIHU0EVaK6wSqBKoEqgSqBKoEpheJFCB1PSi6cpnlUCVQJVAlUCVQJXA 0CVQgdTQRVorrBKoEqgSqBKoEqgSmF4kUIHU9KLpymeVQJVAlUCVQJVAlcDQJVCB1NBFWiusEqgS qBKoEqgSqBKYXiRQgdT0ounKZ5VAlUCVQJVAlUCVwNAlUIHU0EVaK6wSqBKoEqgSqBKoEpheJFCB 1PSi6cpnlUCVQJVAlUCVQJXA0CVQgdTQRVorrBKoEqgSqBKoEqgSmF4kUIHU9KLpymeVQJVAlUCV QJVAlcDQJVCB1NBFWiusEqgSqBKoEqgSqBKYXiRQgdT0ounKZ5VAlUCVQJVAlUCVwNAlUIHU0EVa K6wSqBKoEqgSqBKoEpheJFCB1PSi6cpnlUCVQJVAlUCVQJXA0CVQgdTQRVorrBKoEqgSqBKoEqgS mF4kUIHU9KLpymeVQJVAlUCVQJVAlcDQJVCB1NBFWiusEqgSqBKoEqgSqBKYXiRQgdT0ounKZ5VA lUCVQJVAlUCVwNAlUIHU0EVaK6wSqBKoEqgSqBKoEpheJFCB1PSi6Snk8//+7//+p15VAlUCVQJV AlUCk1ICUxjLnsrXKpB6KqX9DGjrj3/84w9/+MMf1atKoEqgSqBKoEpgMkng0Ucffeyxx/73f/93 soXSCqQmm0aeZnp+//vff/e73/3+5L5+MAXXf/zHf0xuJip1VQLDlwCzn4LO8YPehqekYO1Tw1fY pK9xSgyDyT01fHzve9/70Y8erUBqolCCBOR//dd//eMf/zAz1WzDn3/9619/N3r9/e9/bzWfp6CD R62C3lThH/7whz//+c///d//3SpIkX/5y1887W0xbyriqZr/9re/9dY8UVIYRr1oZqw6z2S+dNrv fQ/eG/Oa/CxMZvFW2p7REmD84/WN0WFSL4OjfWq8gp72LfiMllUlfkokMJhFTUnNU/sOC5Qgq0Cq f6iHNv40eplXal5QTgrANLnffA1YgVHglV/84hdf//rXP/e5z51xxhmqKm1AVz/5yU/e9a53Lb74 4kssscRxxx33y1/+sujAU1o8/PDDl19++Y997GN+N9Wjocsvv2yNNdZ4+9vffttttzWr1e63v/3t vffee9VVVz3vvPN++tOfNqGS37/97W9vueWWtdde+/Wvf/2pp55auOiIc/75z3+iiiha9YB6RWjg XW8r0J6CvXCwLz0FSBlkmONz9bX1PPJO79OxCqZI8yrFS5HytFlzq5TU7tvetusiiyz8xH+LLLbY ovmvefM973nPz3/+82bNGVqF4PFbbL3QLJjiTTqTAJiSOpsFe+sMSeOLNOoYgIuWmgbWxTjstwRb ZFKaLjIfn8dxCrbY7yWmCKdXv72W3FeJLS4GNv4WF70Cb9XcEs5YFtXkopdHnvDDH/7woovqCK6F /Wh0jZFuMnp74a233rrVDRU89NB3e9gs0iw72rMWecc7dtf7Stkpt+Fx2B9KT2xZ1JPWOXAXHsCG p9YUh27DvR1qShxRfJHodt11173uda+Na2VZsYpRE3vcAy+88MKrrLLKV7/6VRCnGRemxIabXXhK XJ/3K5DqDyQgDzFvueWWW2mllV73utct+cT12te+docddggyuPXWW5deemlPlllmmZVXXhlA8SZ8 A1V88IMf3G233fxLsZ4CMaWZBx54AJrZfPPNmcIVV1yR3zSRFwza3vjGN55yyilf+MIXjj766E03 3RTqKrgNwNL6tddee+WVV6622mpQWoAIar/85S+vsfrq5557roL77bffjjvu+Jvf/KY0KnjzUzvv vPPFF1/sBQgaYusIodQAjX3qU596wxvecOmll5baECPTtsUWWxSh7bTTTjBTeQHNCp5wwgnAInFN CRkFSJmN/vHo1Wvf7rBmj7zTG2n6FlTE+ylVfpSoUGbh8yhX6WOtgiS8wgrLv/vd7/7c5y696KJP X3TRRZdecgkFXXrpJX67c/nll1PBNttsAzcjplSoOb8De0pDpfIWL62CXiucpp5cXsuVHl5qa3FR eGkR04yLpXhfkfZy4bVeLorcUskYuhiP/RQpxORHEy832ffb+4ULku0VeFNu0X4vpolFFZGmiVKw rxIL4unVhU7Xn4sG7h9LiePIrWmQfY2/yQXTKFz4MY7xJ3D2sj/KRZ+CpT/2ap8j2muvvTbYYP3P f/5yPeGSSz7LXYxel1x88WdG/nfJJe8/5pjFF1+sqV+y+s///M8tt9yCx7vqqqtSYKQ/PXGpSv/i 68RLkGtqbbgv++Nw0WvDfY2/yC1yaPaavtpvvtDXhpPtyNWUbavg1Nrw+Oz3aj/+ZGptOD2xOLF/ N8URfDOWB4soml24CMEPzvbTn/70QgstyBa4VkGNYTAGP0Z976c/85mLzj//k3PNNdedd94JZJcu zPr9flIbHkeJpSe2tI+RmpHqH8rvv/9+kf65z32upNE1T1wnn3zyAgssIK4ro/fCNJ5su+22VnXJ El137bVJL33nO9+Bhe+77745Zp9jwQUX5BFKGxdccMGzn/3sgw46CODwpuD6ghe8QK7IC+bygKdX vvKVckv+VPMMM8xw9tlnJ7ektvnnn//QQw/NFB58tuEGG6DBI7mfd77zna95zWsYjT/lwF7+8pcD W2lUte94xzsWW2yxG2+8YQozQFMCbm644QYQ6ogjjthqq63e9773lSJo23777UG6IjSpNQTIXeUd 2AsAPfHEE6XWPvnJT05JWwFSP/vZz3hkgBVsBQdBzOJN/EbPsssuC/vK9ulpTUfj6Vvf+lYSW2ut tb7yla+kY7t54403rrDCCgYySy21FJKgXv+ec845GtJPdtllFylDclPQv0ssvngGzZ5y4su8/vXe B51hazV4Z6aZZrrqyiuBZjaA2g022ADYfdvb3kZH6JGkPOqoo97ylrfAlEceeaQiLsXRgLZ77rnn W9/61nrrrTfS0BJLqC1UHXbYYYUX1e65554puOKKK95+++1bbrnlN7/5zZAEl3s/TyUAjj/++A99 6EOJYRBtKJQEdb3pTW965JFHEjPQRh0p5WKcLPP888835vPCww8/vP7669PyZpttBuI3weuvfvUr GkwpBAt1OL3++uvVuckmmyy+2GIaChda33fffVlmNIKdAw84gJwNUagsSqQR6VvaCftUrCDBsius uQ455JBwp84ohazCe+r8/Oc/737o+fjHP/7e977XvwqiWRPozyNKuf3228DZ+EovnHbaaVTIbPxo mg2SMqpJQTq65pqrmUQI/vWvf33M0UfnEcIwwubZZOIZXriOPMU7CR9wwAFGF+9///tjLRiMUlZf ffVikETED+QF1wc+8IGPfOQjnA8iR831x/wM9pFUikSkCl544YUK4sLgrclFItlGG22UOsnh5ptv ZoTeuejTn1Zb04Z1H0M7qlcn+3/ooW8z4BSk3Msuu2y3t7+defOB7NZNSoxS9EfWqOA3vvGNdddd t2XDxx577MEHH7T33ntlXQFR6DvpjIZ/hnwUgSrjkBtuuL6wz4YlzmeeeeazzjrrqNExrSLS7Yhk kETx4x/9mEjZ6gbrrw+KaTSksuEDDzyQzFs2zOz1ytgwiX3iE5+ghXT5NKoJBuwRs2fDKmzaMMRW bJj2OZk0pzjeifRL994bqESJqlpu2WWpPrpzTYkNG2vFKlysl7vwr45mTB7bLl1Yx4cGwouavUYj 2jz99NNbNoxlbjZ1MlE+mQ2j/4wzTlck7EeJXEoMWJ3+/drXvlZseP/9949UCZzZN22YlNZcc82m DatEh0qLxx77LxtG7c9//rPtttsuj5T64hdvN96OY+GIwKCiRE6Y6/Nvco0Eu+GGG6agvMMdd9yB 5je+cS3+jUXhBfHY/MxnPoNCAiEEpZZYYvGbbrpJQykYG959992V+uhHPxobLj0xNlzY14TQwNi4 3KL3qJIfFs5SZ/HDCdmT7ZoUi83BFw73hS98od5OQPJM7jz44IMLLbRQgFS5RJRnPetZ4EtLjiQ+ 99xzyzE2k0Nq4Ago1cSc+S+BiuuhdWVBEDjJI9bgTyFW6zx40M/NN9+08cYbswy/FRSHeBm1+VP9 gBRDz+InPgL+E3uCkcUb4E+yBKKCZoYFnNkc/6UbaKgJpAgHdgRDizSknbiAshqMn/rsZz/LzWFt qoCU7nTLLV/gU0BPMLE4KcZNgMCrDv+85z2PxySQJpBS8Morrphn7nlmnHHGe++9N7FQ9+Ad5pln HuKS+UOhP6mGoCjOO/oq73nSSSdBpXCJjg2qashTsYGTFb1oYZ111uG1UfX85z9fR1Utv8DNSSvO 8NIZ3E9zPMVhhx26++67CQ9SdIAmfAkl0ym4LLsJec8xxxx6OC5e9apXcSJvfvObuQ/NqY3vc9/U rfv8pqjPQcwyyyzkzGvw3YCF2tRpYpcxgOMgEYTNHbAo77vDNYvlr371q3X7Ub/2c4rAuyIpKKoR ERqKO0YngDjvvPNGyJEq5+59vSMFvcOz4+Kyz32OPcz5qlcJ/7KnWtQp5EHlDIqyRGj2wH8RlwFl GnLzrrvumnXWWdW2xx576DWUQjIkgH0X7jSH9znnnFMkhjBmm202QwuaJXA4Rj/yNFzwlVRmTKIg sQtycNWZZ56JGNqMA80cgeIChqipvxgSGPCEwcwFuK9rC05iOY2zat4WI9gX5oWEKFG7AMoML32p YRV2dEk92n0y94gcCHzLLbbQZxk8JCf2MyTRkR5pkDSwz0hIgC1RovtqFoY93WeffTSHpBEbvvJK g2zqYMPNobxH+jhsgQuqL1wopZdB/5SOdxdszSBdzAlHfrBhTCGYDWMw6BPvAjD5kzMukESYRnGg j2GA0AJg6SzCHo7w+Oo55wRk8f6lL30pNqzjsGFciJQI0HdMwCnLhnGkiGpPP+00wY8eSUz0nW22 Wd+06abnNGwY+895znPOOedspm6Y2rRhcmDDWkTGLLO8Eu/RRbHhkxs2rDn2oKdHremMBjOMUHHB EtCkFEbOHanTkAbx6fJsktx0WBgutkp0ylKfFomLbTBOSrnji19MEoV/O/jgg5m3+0UXseG3jNqw yvnqkz7yEZX3tWE1x4aPOeYYyBXWMRwKrHRHL9ZBCihs2vB7jjyytDia5P4BJbLVpg3rjFw0AuAk 2ufldF5yUycow2BUSCOojZ/5lw1vuSUb1g05JdZCXIj0zuyzz15sWAaIDZNJrw2TACXyrp6ih3vk mnQNHoM62M9GG25YlLjrrrsSqVkLpZBkrG5cERvWJSE5EMFkTrJN9933FdQm5UE7gZiqFXn5Z3Ir NjzffPMpxQ45GWMY2ucKYsMcCyAbX02Jhpq0TIlsLx3QFT+sY8aG8YgR9TBUHXCyoSj0TAogZeqK FwBlZAuMpbgAavNDn2/ldbgkQIrCWqLU8XqBFBwjfgjYFKBzgrSCaHJOWqQqWvSDrQMotM4756ke 8p3vPMQI1GDkpKzJx0waAnkUzwg80ij7FgP45dCj40EeTJAF61ewdvd5vSanrIqfLXcQI64TVO4g HoO8VWtZPVKNLaYKSOlRRx3FVxzJ6wmxOm1Jnosr9AIHcA0CrcDZhFme8uw8Iwlw68bNhEybmZck UvRzEJZtbbfttsSu9yqiu1599dX6JBjKsxiviDQZPOnVvIn3uQZjUzOVm276pgKkVO59xIhA3qQO tSll/oI39+fdd99Nm4EIOjOqOF94fYH551e/USPXyQD4EUlH7+Dl6Pe9Dx4Cm/Rkd2j5lFNO5sLw wj5hR/XkkZrJnzV+8Ytf5AJ4K2x63wBAAFaDiCgIESbuIADhOcT4V2KJd0AJZ5qMlEbd4YvFEq7E TQVpjWvTSgpqlwuGVHiThx56CErwg5lxZJ5yjk0gReziugEDgimRbWTCgja5OTYM2xlbc9nslosn NxdHKTwbYJCMHoESrRgHq00NrF2psA9Daxpa0juSkBPVRB1PSUNbBx90kIF4wkx44VWNZTFYUnHq N6MkaCFMKWXxxfVz94ihVlaklSb7dHHN1VfrhpiSszH4jmTgY3/qsIjhssVm1sK/m5ugVqaFflxQ DSWCj5qLLqhPiwlRSRLEhsm52HD8O6GZ16ApXIzgs499LMav4O677abFYF8XOUAbxj+aYJm8QWwY 5kYVnOQpU/GajqAtNYcLfAErXFaCkMuYTRdgZlyQYCwIaRQXOCJYpkVTnIBKRoHUofvvvx8Yp62m DdMpVMFaQGGuUqK3acP6BUsgBHiLtSCMRcWG9RRwxx3WpUVdpmXDyZG0bXjHHWPDlJhUOqcEEHMp 2AcsyD9QGEpQPxUYL5GbqLnq6GDABVyyDX2kdGGlkME5Z+qKo9D3k9zVSvIZWoRWWYJ+zbGwYS9r pa8Nq1l3IFVdgHgBPiM0utCFmZOmdeGSIWbDCOi1YaEkNsxyYsN6fWxY/Zykp7TPCctiGnFpRS/G IPbZsDeJItqH9mLDv/3Nb7bZemtjA9rnWNib91EVG44j0qF6bVg9pGEcqB+lJyL7mGOOBojJ4cYb blAQj0WJ5MMU6dprTLppw7wrlws2rb32GzXqYifGD4ihymBBdbJYUmLk/iw2rAMCRmxYSsl4gPYN bNgwxyIXGCGXcR0l8pyQnytKxOx7jzpKXrbYsPu8AZa1OAm/35pEQMo0HBBgBGY0wHYLXCC1Irip AlKUd/zxx3EQkLWIwuPrBq3F2t7hYqjWCK8X9PA70ic8VAErhSomwuYMMXmBQp4OA+eJ37wVE1xt 1VVhrGHlpTQNoTeBVBNjaYX98aQ6RqvFAYCU7ickf+zUU8Ukvdc0RJnd01tEQR6KR5Ae0z3KMAIB zJ0L9j5z56/1z2QySJ630ouOOPxwMVvwBp2JKEDKgFvIASYEeHkL0uP45DE8xa+oI4Mo+sKRGjUO A6SEE9WqnLMzxNG0Rg16EpA+ePzxFEFcWiyfGumcnKzmUMWtyKvpz1TP3YCDnG9CoEEzvjiaFMSI Iuj3AxKCDApw9EKa8wJXyHphaL/FG4EhrTAPjUJIcDxhpk7/xulkGUHgoJet6uPWAZcMgr3AsxBU kwtcp0U1Y1x4gGvhThXyyFopKS58kRXfzXpJOLlJLcIlhqfIGEG3yyyjcoqA8wI3zWfxieSQmM0d pxXVZkagOWrEmkAO5/kh6VLyXsnr8LCayMIkNUMn2771rYko+o4iSSiCvLguBqagl8OmIjxyk/2k RoBak3q4QF5ZF4I1RSJYHUFZjIvZcgDeIV50Ki5K8fvNSQTCVAQB0Y4a2DBdU5RSseEAqSB7psJv GMrr6QoGe7G9Zu6WTr0ck2NO66y9Dptnw2wSVeCdeOkRm9dNOJ+S99K6EE7U4rrAllWPWoSNtIUw SA4XxYb9udSSSzItGEXPOvzww8zuCc86TjNlQjiCEFLpi803p6UwjjYSA1wMGsHH2DCYUmzY+2zb 02YGutiwals2TKdNG4a/k2IxdsI+VwwwYZ/Zg3f4lf7Xsyil2DAzM0FGieRQujAyYjZREymBX8yD h2e30UVsWKRg/ziFZvR0rbBhZYEAmvIoClWzm0Y1sWE2z7rcxz6wQgK0U4CUmqkPzC027E5SMvps XxvGhSLUgX1gGtgiQDQDsngBm9SPvF4bVpA25RSIi2OhO++QamzY6gIUJiUfRooNI0lUkhmKNKIa //JgJAaGGtC2MqlxRGqgAjZcukbGFTDZKiuv7CaSoCJmj30GqSNEF2xYhyLepg1jLTYM0MuUs2G+ iA2rhA1zFOnv/qUg7RILmMXA1Ok+Bcl8a6JJKsZddY3UmAm5ZKQgX5GSqUlZc8F5WycRIAXXgJWp AlJ6qdU2FKl+E21ZScMcCx0Qhkk9QYiP6F3SRIU8PvxOcy3SvSwfo6Dw30TH4rEMuXUGTI3KOXrD F7F/WKnIsYAUKfG5JlZAnF7cNrVAil8wmGP3sqmEIEBaV5H1HC6xAf7QG/HF0Fth3vswFsekgy24 wAICXpZAChV6su4RIKXbWMwKMCVFr3tTsWEcIKVDwq+GPhl0chycjg4ZIDVS8HOfW2CB+S+++DOB BbSsVCKEobmOqivCvoBUJmv4ykTlcvFcogWqVMXVeqoVFWZACVJIsaQ/50IJberzmuAE47wStsul Es6O801eTXqDDWslC878EDvjoYK9ypXRPCKZEyB19913WYGSoV6mRRhhiEncKpci7JayBCFl1QO1 CwNxf55SoslEzitDc8RnJRMEpiAyWAsgpUK9gGtLvoq0EY/UACna8TKJuUNcjKE51RXZuoM242y5 n2In8eAJ2F6juHzAAYLIT+jITKUwDgtqOiwXBoUQCC8fDRRd+BFnCkiJXv7Nwo6mZFSCVICJvQFS rAtVSeP5gVljg8TmlhJVmzkFkZ64vECwbLikYz0y7pIfkieAoiQbWGbCGHFplFRbXLAo1iV+x4Z1 YYxTk7irlCAU2F2aCFU05V/9iPfzfoAUvs495xywA786C44saeeCACnvk+HVV18j9B500LugTymW XhvGvjrZcIJrYX8USG1lvoYZsGGPksDrtWENlfFD04ZVGBsmLmlgwTKi0AT7RCT2A6SwwxVoxSPW y7r0Ea5ANB2x4TvvjA2r3BojUTza125pLnwxPOkxVsf7gYBgih9hqtiw3n35ZZc1bRiD2C+oPcYZ G/YawvgfXGNfb4qQC4yLDUuftGwY/fiNDQdAN60R6OEwsR8gxR4g+8AOqgRBJF0yE9qyYaTGhgGp wCBe8cEHR2w44kqnaNmwhqQzwfTWegy9Jj5KbemkwV7l8j5xxYZLd1PKJworLL+cImpm8Mwe+0ab mkBbAVJNGyaxpg0DZ0QXIEU4MDTGY4FIEly0yyqAP3Ye3ExKwLcRSHRdtO9PjdaMVH9EESD1ohe9 iHnJGOl1ZWmU0GIQzPskXaSrC5BUOCVTe4bgUhdSvslpGd9YXGI4XibCRHdYGxro3WKKE9cojynq tNrKfB8HDWe04Jc+YxI3H9bxTSjPuGFCgRRAI3fKb+okfWcSpxZI6WBs2qoC9g1H0gtsEUikexhq MPeXvvSlVMZ9SFd8crSTByIIkIRMOGCrWU6uMOM5ZTOa5Ikyi0QsJQeQ0BhIlNF5+o8e5Xd6UYCU H/rkyiuvBMi6z+UZIWlIcxp92cteJvWoKzaBFNrAET3fZdhtQImXZLxpCo8ZjaEnHbgXSMWtNIHU SNlLLuEZWQh2iIKxaVc9vCqli53eKR6/ACmt+I0SBY1TlRVmlLIWwNS2+WVY/8UvfrGETcBBAVIK YqpwISYRFO8TZCCAFVmVtIpMuIF4Fo2qU4vQqmrj61UYIKUGrIV9F6kGUUEGAkC4oMHMarWAVHG4 ivcCqfJUWV2DqNEDRTGtrP1XeaKvIKQG7hVfRMPqvCY6Yr8XSKkWFwVIqQTywyMG/Zv5PkaiUbyM AKnRbxpwgXGsFSCloNEwf12UyKjInENgw+ZTWjasQg3JcEuZI88wSTBTg3oKkMIFj2Hig6agWPYG OjDvYsO8SjJVAY59gVTklrSlS/EAqYzI8e5R4JrmAqQQgDxea6+93tkXSBUbLkAq9r/xqCkSsmzH Bz84knpXlT4bG1Zny4ZR3rJhAhcLldI9e204qCsjmQApFeIiudhw4QUeNcgg/d2jJpByU2qWSFFL pKCMTKTQ4M5LXvISSudpDb8ZfCyq2HBmkYoNh+UWkCpWqmAckcqxL1IU9r2jrGQ/+48NW3DGhnVe 9wuQetyGt9662LC8oNm1sD8CpI4+OuynGxYgFRvmeYoNy8zFhr08AqTOO69pwwVItWyYP4FaMrPZ BFLhsQmk/DbAaDoiSjT90gJSXpNU9nUC+HLFFZ/nTJg99nUBHQHURkAyUq3BQMuGcR0gVWw4vZgr xjXv5F+ynW3WWUVVdRYgRW5eY1oj2t94Y9oX7IaYmxhWaJ4UU3tQjmxKgFQLbFIPMMSjZe22fuhP /q418SeimAyiZgisTAXqQkKsOd1s18mvWVWX9UxZzM5fi7tZNt5sFwYydKBa7+RReYoGNcg6ghrZ yKpZkO0KPyeeeILXmKB5AYpv7sjQUW29GSkQ0ChBvCk7SPWi9akCUtm8lGREdNImPTPuAIoRZCKT OGRtJr/GoK2/0cn5NWLnhhTUu5R917sONJRU9hWveAUv05wZCZBq5Rh0qkwNBEiV94uP068KkHrs pz/VsT/96Qt1TpVDrnu9852as6hT03wB9QVI7bvvfr/73e95Rl7JCh70wH+AF0epuQKkmikW/kKP 5f7KNBwa4u69Lz0AO8b1X3fdteokfHdgiMQSbwZIZUFS6Cc0qxBkpIK0ZLxRInMAg5qDMHvCucjw A5306750gqCSkSIVQGnEq6A4oSCfQqp82TceeICgggxgkdBZ/Bdf4x2N0pRS6rG2PQssilcNkCp3 irT9KECqOaWbqb0yLZJgjzvvEA4/mFmnMoIPYvOn7kkjEki0z2yMbXQNSnGfuIRwfUo9QuNB73qX 2RyRQKCSV7DoijRiXYU8dWY0z6dLlWlaCkSpA/bfH/rRClAbshGTjFThUcHrr7uO3w/ZRMdyKFFw lbSD9sxBMGmGxJw8YjQW8iMSL4yQCgRs9OMCLzJbfketmRZBG+vSL6hSJRyOkJZsUwYD7hfjD5Ci etPTxVoymoe8CsvqLECqqaNE9wCp8KtmZm5qTxfLLFKppNgwIAVePGHD18WGZe6trPB9QEBzGQyU PBlxZWoPs9qKDSvIhi2gYcNeoNNiw/x5bLjZhQOkevs+3m94AkgVGyZteJRaeRV2DlUjVYJfF/Yv dQgNHBELQQkjN6mt/qapqLa5HCdIQmqQDTcnjIoNR1YIYFS68J133FHY77XhfNlgNkpVcKfow4bV L70kjYrs9dZd14BBDimqwU4BUpEJpgxKCY0NeKdpw9zgJQ0bTkaqACN8ZWrvXzY8qkR8seE777zD QjdwJMn4tFUmmhmwyYRANJiSeSvIAiWxON58FNxEYKMZqUuXX345gmXqDD5d2L86Au54A+LSofDS tGFjsaYNU3oBUsUk0MByXj7TTCQWHyXo6DXQPOIt1jQsRyqN+KEzsi6QK+vGOkbSoRd/+oGUwM9K GKWeDI/Tq85c+CR00wGcqVkzazwJ12CdfeeF//rnP82OSzZKMxgMGZ142Z98NPDErOVpgB6xkwtT uZW8+axPmKEwk4k6/J577KEI0xcLg0IANdCBVVGeRyaGuZh834c2wQnmM++rP3v6rgMPzMeGLo3K W4I1wiFHjKpvfvMbQ8xDwjQCUhEOFCVFx2MWFMU0e6cpEQDPCUtTYj3QoSEI1pg4lrNcEfsCQFLx elGm/DzSuywjMKtoDgh8sRLIa/AQb5tkCdrK+kHFg1DJHMElHZV+pZVMiinecnP6p56jFYuX//qX v+iTOrZPyhHAGIAeDSmCWmXpkTkhGKIyqytvlO3pyYrqM3LKpAPiDTHNBqI2g2BkeIR9EESOxAua UDPKVctfPPDA/SST2JkN8YmLddF1MtJo43q4G17JnTIJyMmyQOaHGLaXjzoZsyjrT7atTi+j0CXN JjyccMLI2iYjdeIyHvVbjFcQL4bCEiHxd1oxSZSgFdSSvBowwW49Klxw+uw5uJZjVaEYDGf4UdgP NsICMkiGv1Y8XMTvEymBxzBciMeC/qJpP5BqiIkkj/wLGHGRuiEy8kV0iPEv8lSl42iaSRBOgDhF k4xoB5H/8Q9/ML8mOjJdRKZF6mAGoo73eV6dVw0pmF3ljJeyhYd2Scx6EcVzgqQi/kWVkKwsHosS g7NVQkp9bZhI5fMYIWYLF1dddSW+5BI85Yj0d5NBhYus+0GzdtmwRdaKa5fx+zP5GP/yUSphY+iJ cHw17GaSK/6lceBe58JO0lElOnqZiDK9lYwFPvbdd2+ibtmwgoAm04IdgVRKbNqwhCj3e/LJI9+Q MiRVZbF5WRGVZIZl/oYEGo0NE7joGBtGMBsmXkXUrCHOyjccYV+3wr45AZPm2E86KlwQgvez2LzY cHqiEC7dJbSXLuwFIANhSuXzuuKI2BhvzKTTIkZUq6f0tWEm17Rh07VlVloTtKMLU3ccUZCW+t/+ trdxdL02TDjkudPo7hLFFGFNNhy3EPZlzhgJbZac4sMPf2dksLrnnqhNQf6EDYtNQYTapXQYUW2x 4aCi2DDX2rJhN8lKCODwuaDw6B1YjQdTkOjAEUFE/d6MB9NlaAqz/vXpg5FAunA86jrrrG1nMgV1 WLoo7OsI7FliGNf8qshLbsWGGb+JuWLDlC7+Mp5iw/FChoWEr/vE8rXCwaoZs+U7G/cVt1oG71nb OiWB7Cl+Z1IAKYJ797sPgT8oO0OWIgVqpgzdjHkJA6bPm2hUTxYyWQ99AKoWWvrhT+miTHIxFCa4 9+gLYlJZaU4xKlRAi9538fhS2QE9EJUxJX+toEu7+dzAI4bCPhTkbVOQNUukFYK1e//9X/cCMMeb DGWluVGOUJ1xs/GEH5yUvsHCuBWBHPFuugx6+I4yU8nFuwnVGXP4hsJvyGP8qUZCMLqCQpJT0Ulc Ij2cqnPq4cYE3EGSRhyEJDOq+B0SlhwyOSU6ZtoC+25KChKRN9UMhAnP6hfjhTeajSd1+UTQAFTl WiH8hBlPk7vWu2AsDfkB4qy66ipibagS/zSkT2qUIqAT7n7FFVfYZ5+95aKFYW1BvdyHH14mTHyB RDQIZMvTCGPGuyEmQ0+6g935ZQWJlwfxm38hOo4DnanTlR/5mhcBZoV23mmnTDdQij6fYMkh0sVb 3rIN+ktBNYOhnBquZfVMCWW5Dy8pC4UwVLG67C/aLKjRTIAiiWHwg1rEIFTtZjJnXJvhKXeWAbGa 0WYAoCFoGBdUYxW/5BZvyLxL5skPGXgyQYBM8H777ptNpBLUKZdk9niCfVSRcNjnCoVSkCjLS9Xg X/Yml+nDBeNX3Tyt+JeXFM7ZJEb0d7rwfooojpeTPnISefKwQiP2m0rMl1ypSmxDv/cVpKOR3S7O OScZMk7AI/kkA3TM5uv3RDUcCerqTEE/FJRPQpUsAnAQG8Y109L9M0mNWjMaZmYLF+CgniVe0iPP wM4L47igXzJXD2KISCsSh4ZnhAbBpxLmQWXcCN69Hy4YGKvIvF72mDCdJJqy3vL9LNpY8kjmY731 aEpz+dZSEs37ojV8A9g1bRgB2L/pphulALHTtCg8St5IpVOiJD1ptGw4E8GyfehsFvTn7bffxpcy LaXgyNgw2mLDqKJfTljrirNJTiDp25glG+aXTLCaTkWV3EMepScal0LnRfsZ8VIlQWmReIMtCFOd KucliFqL/7Lh9ddXBCCIDWOEl1Bn4aLYMGmjnFdhYC958Ytl9QQjnSXpIjZMCy0bZi2sgrUYxbCx EQseVaLPzRiW2JT+qBQWgAAbc2GfKwiP8aIK4evfbPjcc2PD0LNHOqmuSkex4fBrxNJrw1nETYlc wQ7bb8/+Y5BMC3nBl0yoyf7I+vFdduHGkQSIt2zYU+5loYUWZOTM5rOjX+qFAB1B52J+o6msxfmB PfYYWYpebJhVFBt+x+678wArrrACGzaqVJxgGS0HTuAJAW7mq/ORhj77WZCracPkgx3uDhdDzE0M C289/UBqWJxMw/XoqAyUJWXcHJMSd4F0fiqBJ5deJ3lbVkrBjrmvF/EXfiiuw4wjK6iFH+eC84Vq 0IzivKTRoWGuH2Bc+nN8hPcV4Dc5ID8BJk1wW7xqPjviKFVlKKy4MKz/W1UkaDWBlHfU7+Wt3vxm bDaBlFDKqYUq7+jzgNSVV17BWYzOyxyouWSkuEhsAo7LLPN6A0ThxOBMW4qP1DC6OgolaIMkQAqd 32seHTv67W6GyPHgKk8pF7nF68URQwZC++PPttjCWDaDYCEzE5cjXGy1Fd4FiQjQU87d4LjUaXnU 9ddfpyDP5X3azQImlagfba73vfe9cYuEXLhAs3EbMtRMwpDE1qNKUTMcE8ctqbb9qLjyiXIiFgkH 5WQPW1pQlVYUhIwL+8kjjnAR+ey0U5bHhQuOGGjAXWHfdF6ZRMAjT1d43H+//dyxIRndsQ0JubTi X+LdcQeufnu14RHZXHYpKG+RCcQSTQv79geiu4x0lXrkkYfVUwqCnpnP8oLf7kfLCPjyE1PGeTqy HquhRFlMA3QjcnSiqteGVRVxJQMaLgDu2LyOhgtwGSIsxOgmmcbypsCAhWLDzc9gyZYqRbtSkPxZ YIxN9td9rQh+CCg7GSrFYNCTNUPeIVJdQN+RkRKEpEAkAHbaKbh9Z2ACeQb6WJPQZUJqK0oEIjUB SBlhqsf7elZSrYinC4lUg9j1119PqBtZ2ffEpTPSfmxYN/l6jw0TlxcYpBIE67NNxhNxxSzZsIZw ERs+8ogjmzNEtCmaFu2rQZ9iwMw4jiUxGJFMfcQRbbcdwKdFH/xH+6k5+7D0t+Ett+Tr8i0qqdIa BtOFOZMAKShN000bdtMn4ep33zgfAe7o8k0bTkIrq5GwkKkVvbXsxump/m5I7FHRxUdGp01ipbrM v9nw6G4pcVOewlVNJfKocUSeYief9eSC3uLMPYWWsJMFmrnkmRhqXC4j4e3LI9kNKc8553yVwOHS TZiQynWWpDBc+qPNkuGzZhcGx//NhkfZjw1nToASM/JhmWkaR5wJDRIpAO1PNQDWRfvwYDrFUNIT wwUMFUgNV54TVVtZqtVas9V7v4XWxyo4FqH8b76MyOxDOm3ulCvrT+OVEumbV5l90Df0T48y5cRl NF9TsNTfaqK5iiLxsllQN7aZsZTPBz5gu6ijbftkIswCWxeH7s6JJ5yw1lpr6rFZjVvKKhhnGg+e fHKu5txW+HKnWTB4KBcGm2ULI8EZpRQumqV6GYmEU6QvbaGqJWRvFmdaJJxGsz6p+X6vEkNVi31S KroYn/ep0mPspIirtFKaCC9xozGVwkiRdiJKUxfNJXRj6TEOt6X6pr21lKiJzAZGF7023GsqzSbK XFWzpzS7ScuGm3rBaYv9Yo19eS9c9PI+ukZqr6WXft0RRxyuO9gKTnfIf/qJbqKDgNfZJaTZp+S2 N998szVWX01S3yRdKSX7PtK3DnqX7alku1dZZeVWZ59CG24115raa6m+qaa+eiSx4liKIyoSTn8c p/8Gvozli5oajCNSWxcb7tt/mzxOlQ2XftHriDK6KC+0fFGzQ7Ws0UCmWbCpDoYBBMul2VCGVRx5 5BHsKs7WaGfUTo6BtmedZRZ5pszrtTzqWDbcjA69SoRL48qaeow66K4CqYnCGbXeYUkg60ua3XWy /eYF3ve+92688UYmnjbcsP9/m266iZmdvsuoJxs7lZ4qgWFJIMlIu5Zb1NK3a+gyvtKzjqKMKNJ0 smvm18YuuD4gZSotmaR6TScS4GxN3UrOjWUYzMwlGVlyfhMqmQzkKpAaVriv9UyUBMwOWBcCS03m K9Mo419ZGj+Zuai0VQkMVwIMXu7kyXrGyOeKrXYV1F+etKCwWvvUcFU2+WvLfN/4V5LNTwEvsfAK pCYq/Nd6hyUBiySy4dMkv6R5x78mOf2VvCqBCZLAk/WMka87+14DF5wgRmq1k0QCT2oY+dzyqblM HdbF5sMK97WeKoEqgSqBKoEqgSqBKoGnXwJ1sfnTr4NKQZVAlUCVQJVAlUCVwDNUAhVIPUMVV8mu EqgSqBKoEqgSqBJ4+iVQgdTTr4NKQV8JmAi3kbWt8Ox8Uy67ldxzz735z65Rf/zjn6r0qgQGk4Dt m61dnYTrLQZjZxouRU1DPGhrGhZUZe3pkkAFUk+X5Ke1dn3cYYM4OxrbBhNvNpH3256B9uluHe08 5Zxfdtnl9pK2YbE9zXOSlL107QOey7bCmpjy2vJmIcz3umXnUju/gWXo9x341FaY932xYo9HNdgL MXdsl4p9l61TO35mYhUnQGmjTrvh+WjFbniDEVkIw6wKbUmMZtX6rdoudSoLkeAUvzZ7VKHLBuId GQ9JPiiLaZWzzDuSmuK2wPZJ/8DG2UsDZrGMcaZF+75+7XuI+JQT72MoteHdlrzUNBT2fU2iwqJ3 9Y9/1MGUUItxW4c3Vc8ShoVQc1SoXXmnhJIpfEc/ipX6GC0Lpaew4Div0bWtKdVpi1FnS3TE6Nlv Uz/lmtKo+tkVIesI5YiOqSUb49F+eqjLrmlTW0nrfYTZXZM8XchjqByLcNDRABJQWH7o9NvhUR1J nbjiFUhNnGynr5rt3Qf0OM3AxrU4N4J0Iq8zIpwhMHAAsGm4s9IEJ26Fu+edudQRkx29XjbDywYA UnaNczQmwjbfbLNgPpcNmm06h347oQ+gNi7DVoeOUHW2GuCYGvjoVVZeWUP2Vu5yyiZPZztFp4s4 h8cuQeR5zTXXDEBkKUKYDvdVoRNn0exUDb9t6t2lTmW5ORs3O6bXqSkqdDlqlzS6Yykn2ADNSLXt fkciFacLZsMvO4ZlheWX5/T9HgqYwKzjZTDuoCRbmTvUpaDqwci2I7baDB6cerTYootKxw5WT7OU fbRtyFn0rn7b8XdEEnCDnbKbqmelhNwxlOpBCaWcgC2s/IZUunSlyIFS7H6uq+Kd17J9ucNMOgoW HEenY2TU6Rwtm4w71KVL4OeI6N0RtHaBD22cVU7dcXR0QVdTSzYZOlWMl15wtNe79IKBa0vrdsxx 2qNzXVzIUz/HgtSB0V6q5fQ4ZAfLhM5lRg+GNz6ZWpafmvcrkHpq5Dztt2KsY982x1E5b4GzyyBV p+K4B/anTtJwopYgytM5dsoPp579C0i9bMb7739gaiUbwmApPqXEeDkeGzrbordAq6mtFlh0AILj 0G0Nn7LcqDNh+FPAZWAJqCcnn4NThs5+OJ2q+NapJTLvG0Fm/27nFUJUMITfAzNeaMCjqgRp87Aq dPkhBHavGePOuIAjxafutckdOvCRZTrsjznBkQ5//OhJJw0mzFIqh8vmAGPQ35l6EqgdqWVLarMX ORvwo0tgLnQK+Z+//HInmjHLqMmO54y/i4kqa4sp5xzfcccdqZMc7NNob6Eu1TrihmqEfDav71MZ kX73kUc6akr3gXehNHTyKk4VdERSxzp1KIecyseoEzRHKrjTRV8Sh3aUd0JLST/rtlyWsRn3NfDg BElOXzHEtcdNXIpjbRzC04V9OAwqlYiyuTnEI5PkSKs1Vl+9I5ASUJgQG4hFyfC9YZll/NuF1Ikr W4HUxMl2+qpZ397sTW8Smw1GM3SOb9VjBxbEFVdc+dznPpeNOo7AsVPPetazCooayUgNBKQQg1Td XtgrTsoZUg546pg/kOuSihBCwi+H4qRP+/x2iSXqwbtzP1KJPJ+hv1MLBxZpsyCcx9139HfNCuGG pZZaSjjJTRMToktHqarHeRQOgJM1MRPn5K+OvEMSqhJHBVF7eecYiu5E8vvAU3gX80AKCbmOQCqc 2jbakZoduW4Wd9ab3EkJ85KpJNzRSnUl7EOQaYhROUDXoeBdwASlUI0etNlmm9l4HUynuO5TsY6W K2YPrxxyyMEdkQR+IRLgSZf3G4UOpXbWb8eexXgcRefU6oiUhFdaaSXTZwOjqNTjUMINN9ywTDo7 5FFSqot1AVIGOWb3zGlagIFOA2Aj1Y7sY1NuzwmPoY13FU0My7uQOnFlK5CaONlOXzWze2GJk+L1 nD2pF1naooNxhQMLogApJ4Q7g3ZYQAo9uj0gJTkhfhj3q9yJmx09FJZFerwLHvyUgSnHp/8PzH4K OsdeIiqHs+ZYLjMpHetMce6+GVC71ynyLbnkkuZfUtWwgBTVSEkS6Tprrz2U2T0C5OudTiyoCCSi YHfehb0111zTHHE0lTPCOqKTUOUIYQfEdqew1GCKREbKEq4cki3z4YjZjvXLyFrIaBFPqUfih/13 AVKqIkMpk4suuogQ9KyhWP5NN90ESej70ZQO1R1GAxOSu1IyqTPn3HXXvnOCuSYOSlUQP3l2RxJs fo011shZKy7idZpWF+0b3YFNckWWXkhIswSqd+xxdyBlZI598jQmN2++8korIbsLqRNXtgKpiZPt 9FVzgBSXxzsbiTqmXgeYICBlhcfznve8gTNSFMO/i3nm3TgpQ2fLmLpHU84O79Lm1nKKo0a98hMd lxsjlWMCI8xxuOaff34IYCjhZOKAFDfK8blIePXVV++YlVFcED300EPJlkitbunooDEO6jFRUYT2 TeuY2+oe89QgNq+7zjrRlLys+rtX2wJSo5+y/rqjBCSMXzbDDFa0WBdoQZvFKJa5dPRWvUBKvrM7 TKd3q/fkjQjTqW56Vkc6FbfwQJc3CRVNCdUdTVSdurl8jIns1AlG8ADdtQ/kcU2+imCo6627rg7V UfVINdY1m4lI2mcDsnGSqV2kyvNLFiKsACnUdlx1hx7VbrfddpZzzTtqqHLbphG6s9+F03HKViA1 QYKd7qoNkLI8nPswi290DkYYpA49I2Wy77MXXyxCdwFSyZdIRPPRVt40c91dNMeD6PC+MXGcGU8N THSpLWX5ff70odGLYKW7Dam7VzsRQEpAsvzI2qOsPIUpZf46hhPD5Ve8/OWWyAj5ALR1rCXjNbAQ qKl8pQgBdDHRQgM2TWpIGUZTV155JSzFugYmshRsZqTkTiwcEbG6VGtqz+pg2SNLreWPIbMutaVs 34wUYNExI0U1+VSFeAN8u5OKJEkUlhlNSfeaN+xYLe+HTrOQqZMbJNiOvAdMcE2WHDEkk+bWs3ek U/HPXvxZAxKeZL/99mNa3TF0IakAqe5EhncyNKcvjlhp7uuN7rO6QyGsbyUVSE2cbKevmtm9ZQEy UtgWUcwdGPgOC0hZDFvWSAFSUujCSUcgZeUmIiXhrUIwguyeOsI4fyf9fuutt5o3gaiGAqR8s4b9 ZKEQKS1vhDoU25qgNVK+VBekXZk57UKqj3QOO+wwS8T46NRJvDJeQ1FWF8J6y1I9jFu+YOD9wfSO Y/200lwjpUIbgXSEkqb2AnHUdswxx5g3757j1OV19rJGSsxjpZB0dzAxXDWpzSpGqY6yPhKQ6rjW Xp1m8OHm8mENqPqGN7yhO++cKtf0qU+dz02ZOhwKkLKMNeNGaNKsruV3w/oUTk7O1F7HzVmKussa KT4E6iVeZt9x9cXQbalUWIHUxMl2+qpZINloo43OO/dcPlQvle8xcSaB3GXKzBopH+z4pNbHz0aN EhI+sfZNLIi2/vrrdQRSRrcW3Bia///s3QW8bkX1P/4fKtLd3d2dUtIdSnfnpaW7S1K6G5SULumU FFAsVERARf2Krd/v//8+Z8G42fs5zz33medwz+HOfuHxuXvvWbNq1nxmzeyZrbbaylCyK9bSzs3l 04OOCpzqSiLavN6444574QUXGDuK15Ywy3bkcBujZ9R8XwmXSEj4nf9VOZbYWm/65JNPICieZqIo /dD555/v6/RqygRCNStnye1gw1KycQsusIAlYjgkvsXmYHrm4hv4Bqmtt97a9JYfLp/aWdOdA6To zYL9JZZYIjI9TCYzYX4zszeVOtKJskvwKSmrt9azZvpAjp/3VRaOHGvMMWEISAKre+21l48iMyuy RmqmmWbSmqQk0aThzK/2Ej9Ck+9gFllkEa01PyEnOEvA+2jxo496trvjTjvuuOPFF1+cifkiHQvn WQ8uGZ8/VYo3wlpyeuGFF4qi6Iv5lkjK9g1OLFWAVGYLKsU/1oChLZRjQsegPIZoAqs1Ujkbvl17 7XVik27DHLwxWeQkjHrRzJ/aw6QlF3i25UkXk8aCiMGoSX0zEV1xDiDSxzvSBjCKflrUg4JyKFOm KI8aJscff3yJE78l/HJoKisWi/gwnx4FQf1ox/uHBSe2y7J/0mSTTZa+3BFS5Q/GG3dc2b74Qmrw XDCTjzQt4dJLEd8A2tcGmUFfn4eUZSL04IfLd+Z21smZ2oPzQDF2HzZsWIDR448/zpZF1iB3rEwg zN4fTO/LteBTwhioGoQoiowymhZH26mEHrDqq9j8uV1YX9ukQ5TRNCdlQNUV8WOGS5h65umnOzZQ KijiWWeJWkrC2fOFR2V+CAySau+sb/UVF7WAPROXY/iE44/Hp6G4pVH+CZ5SrLCfuetVvg5bUihA aoAUO8qRlX01Cpc2j0l3fR4AZIIjJytjTahexOhZ3sglue3yT8sFtFiPXnxxhHc2rxoG6BHuc3a6 appZ5ySGQpP5oSSIG+GBPmYJLY0ymM5f0yD55FMA1OzzxGR+uPI3aBHx7exu4PjQgw8i+OQTT+SY nuCgM3fCalrPpApOpQpsd2X5URdbaWw8zeg8ivhG55koCm8ER8oOt/QQZuIA8FlO+hDgQ5ACcRs9 Pe+i5Hd+9auOtUFSGWh2MaUVfPL/rsCIjllqUzCOBtKOKBOr2ld+LVxdqzeWeOLxx9Hkpd0SPya2 OFVmdjNkJDVbs77UTtzhY+7kzBsg0iP4E0+wPh+gVWE/3/mFZXziLT58NtaNjeMzk2f5ti5AaoB0 WMgOiAZEkPfee//ee+8zAde8fMDy8MOP/PGPWYelDAjfhWjRQNFA0UDRwKikgZKRGpWs/bmTtVvD vs+dYopARQNFA0UDRQOfkQYKkPqMFF2qKRooGigaKBooGiga+PxpoACpz59NsySKvdRMmZeraKBo oGigaKBoYFBpwGLzQTgRUYBUFuz4/BW2GtF3PXYAKlfRQNFA0UDRQNHA4NGArwSsjs9fyd71jvtz AqRA1LiqCko3Wz6NN9s8Sk9bKr2vgv2ptOtW7CJBn6xrNjYvGcyXz5XbD5Lsj2CLFAczDWYpCm9F A93VAIf3DRrnb986fA5Zq1dB7WW4BX3f112GC7XBrwHAZbgZKZMYtiP5DGSJIwILkOpij/9fUrpV m4Lstttuvr1MX1zbasVGKbbAj8vmyPvss4998asc2Nj3qquuUtB3m7WPKpnKN5z77ruv40Kbn4bK Ljq5wk5uPkuubpIGRdnzZt999rHLmUr9tbt/zrfKA6KvtkQHP5CyEYA9KjfZZJOvf/1rX291fe1r X9tss80uvfRSfcNn0LZLFUUDg0QDHP6G66/ffPPNNYGWTUOTcXabk2HsG1nlWUE7H9oLqq825f6m m25iszGtb5AIW9j4DDQAtdhsxN76fXsUR/ua3d1s71dzqoFgrwCpPntv4OOqK6/cf//9nU8J7jjp PS4HXzscIzbjsUUHuOOmTXgdGQEh+WecNG4EZvsvx44edNBBJ510ku1fAxLZt9CxXLav9chfe4XZ 3evhhx9KfNidArQClb5x4IHqEiOq297YWi3IKutH9dBp7rL7brsdcsjBdnJDQaeeoFJsnjbaaKPZ 119ZEnXxiFm7v6jOLjJVVRLWye1JaWBfc8dneweQIm0c0h6cDX4gZVi8xBKL2956zz33OOCA/b/x 6Wu//fbda689bQS82WabQsAD0ZgLzaKBwamB99//QKOww+qwYXvtvPPOPcGt5zpQvNpll539t/vu uwlQXhDEqikEBW1La482bcdr+++3X7QqcUNsFJyRdd6LfVyNWgen7IWrgdCAYCs1MMUUk3MAHsWv UrjVWQu2/u6www52zZXFgLoGgocqzQKk2gEppnIi6Re+8AWHtTFMXCDwrLPMEgf3QLvSP27aldFk pF0ZYSnpJZt0XXDBBY4QiV10IQYbYZuZUuSll14CqqJWCAk1ew2nvdcgHskk+/na70vB0047zRGz aStqlTqIAwwHU0QcvMl4xebXMJMtvG0Fa7JWwVNPOWXaaaaxS1hUhKwB35e//OV0pyspJbLYfxZS dCKs2hNNKNNJSUYDSWl+YzVhKTIKpgqSTu6tP8wMfiBl9GxPTid5gcKOLoetXYceciiXoKXLL79c jvCYo482gJZwHuiGXegXDQweDRg5wD3Dhu1pp1mLHc8//wJjORHDqkeNxcydm3ZhXWCB+Xtx1H/n YhTcYIMNTjvtVLs+ur75zTPF22F7DVOWdOecc66Ckutf+cqy775bZvcGj8EHnBNAykl/DrzSL3Aq UzfhGMOG7S27IQNiS2QBea655rR5ZgFS/elhB/AdiERWeayxxrI9bqoGTnLWRO2UCYhHvkcWOl5z FpWd6e1wHeBJjsrJ85JAtTlUll5qySUlsdLmsHzC1BuE5JGCNmOVr5KUioIAGTowSiAn4MxJsXEA rUk9mXMJpzhOyCnfztB1fEcszxogIGWX5O23396GuYcddpi0fFKR6EaE6sFbcCGsmY4gdRgCOOhY AMfJQRj9MeHgB1K/fucdQ2enI+sJiO8wCtkpR/LByksttZQDzohw6CGH8KgCpAY80JYKBpMG4KE9 9thdSonnGzTKT4uNo48+OvAUmSRBzME7LYHUhhtucNxxx1rtIMaaN++dOv+6uCHcicOoXXLJxcst JyNVgNRgMvkA89ILpK4ycAXE7QO/2aabRvfnr/7UyUXORBKHHbFXgNT/60//OqDvyKBILAeQkj26 8cYb9YVM6JSx2rHkTpcEpEz5BT9SMpIxzo2CFYAYsMZ5T7IytdM5ZB2nnXZaECSlahyNZLLPFeuf bG+vdoe3R9rJnJ1a5Lr8lpRaccUVkQ28ItthT23IBimHVJhnnGvOOVOyBw+ij9Sac0adAwredetD zaBjNHDMMcckWwB5J554IkWlO6b/qkDKfQVjwtG5Xf0x4tACUrPOOivTW83mUD96uOnGG03qwZcF SA1wgC3kB6MGqkDKGmHrE0z6W6lpAGZcKrneHkidfNJJ119/vVBs/UCckK2PdHBsAVKD0difCU8B pJZddtlnnn4GqjYDAGrrPU3a6E+32GILfavptgKkBsVXewGkpHbkpR2mCOfKRQcIqPX9NSDlBfFC 7oFRpZGsFoKHHBlbWwAO0ziaTQ4jUZNY0vUCUoZubvIGBaU0AkgBK8CQk+cDSElHwWqxJCu4crkP mlg0YISXFqqDLBJd+nKkpEl4nmPAu3XmmqplVKtAqqYige/QQw+Vja8dwYsrefvPH5ASSRy7y3Ym Up3EqZ+47LLLHMNXMlKfSYwtlQw6DVSBlE/zJBK0CCFOoLvv3nuhqPZA6pvfPEOXKVCkxYUma8S9 YXvtJXNfMlKDzt4Dz1AAKcvjrD9ea621wOtUp0f8hIf88IdvFiA1iIAU7GLx00orrTTJJJOkI1Ql XV5//fWUdKkBqUAShk1m5c444wwzWdZLWaVUzWNBFdtss41FQlYaJSBVz0j1Ailpm4AgwFwzI1Ut rlKZzAXmn1/uqopa3IecjOfclEt3cjVUF1itK1cTSAVZ8lpnBkfKxtVyeJ5+XoGUNmz9o6l6CUVA 6qc/+QkHsB7/w99/WDJSAx9jSw2DTgMVIPUbR/Muv/zyZl7cnHPOOY03TM+1B1JCqOy7z3Sq2xwY nwhl7rhfpvYGnckHmKFPgNRKfMMqGn1Z7JSRNkSw8E5nXYDUIAJSoEycca0v1HQDIjgC2iIYE1ix eskPEEeCsYpLYvZKWssyIGsCLEOurpGShLSGHZquToHFcvIZZpghKrIo2+Sdj1Ni7u+SSy4Zb7zx YgJRPknayXcusQwrLtgO6vI1X6yUqjETiTSCzDPPPJalx+KqrlwtgZR8GIZ5+a677lpNxaUaP5dA 6tprr2FQ5qNeE5qAlDPSQSs3tXZTrmWN1ADH2EJ+0GkgASkZdysQjB633HJLXaChqSGoDg+WarNG qiWQCiELkBp0xv5MGGoCKfH2tltvNclzyimnnHvuuXpJC3LmnnuuskZq5K+RgjysbbRe2Noj3b90 TprUY54xxhjDPH3KFUlc+TCtCV+ef/55qWyf5iUQlkDPAgssAGRU93MCmEwFTj755JbXeM1gS/bI 1lNRRFZcihtq8ZrYJB5xmsj0RALMB5+u+KKwepmRNNUYd2RBZ5t1Nh18rGfvytUEUji0MszMHfRQ m9HLBFLYRpM4zQZrkEpFfe3SpO152nJPEdRiGWzLrTIZTsGWG7tpvQrGHjax2JzUMW4GnjgJPcPc UbYKpNTVlxReVl1fewySrr0U7cVvKQVWQ/yWMTDEbz6iqxC/5UcxIUXLj9Jj7NjeiMRvaYvhGrGv /U7bGDHEJ0vLGttIEUZsI34bI7YR36MOjJh8uI0Rh+vDtbJtjOjNNj4cLTGJn4CUWGfoaEbPhzKL LLKwvz6mEeu8HEAqbJGMqKDF5mlqr/qVRjUj5as9m30Otwm31Ezy4ab124vfHx9uWWN/fHhEjZh8 uGXBvnw4GbHrPjzcONzSFfvjwwlAx9SeXX54lDSnBm4exkpcky1yH5IFPmWYd955pDzN8/S1O0b/ fbim2FocLtsftAMSL7zwvI+trJE67thjtfP0bZ0yZugtObIM3ADr5ptv9r2ATJL1xUEOrNHO77rr Lmsk7dvE3tBx7ZM9X+RZDnX22WfXOGBanmGg9u1vf9vaLKsyE9JCVupLSsNqTRtvmm1MnxNaf+MD OttmXHLxxaCY7JfaU86Jz/nW74477nD/vPPOI5StB6riZMIpn/djOBGBnHzKB4OSJaCnlYBNDXhk Cbyvl/tTeyw219Luu+8+YMWEZg0S+SejWHBmHq2JltwxuUlvUGmtDXsE7KL58MMPt8RnlHbTTTcB o7WCXrYKCv+m8PyuASm5Zfgb2PUomnECUhq2utSo3lqNqpBW5DbfvfPOphReJh0Zm7vMeZlO0KSf phTIsj7xpceaUuCTFL6sbBakc7t1cEU/mgUhRQWffuqpphTgo48zfKnajJhe5vxY1YM2jWj1MfF5 b0sjRpvyTtOIqKGJcksj4oQRE6hNYdHLTz31FCnI0pSC1GSngWYv62UJYwVpr1nQ7mi0TectxWcj Rmzpwyx73bXXiiptfJiHNG3R1od/Ej781lstfJj3koInN6Xg80qJJ83u2cs6KgoX9Gqs4k0rYyYt Lh7F9gf77NPzabrvqqg0tvj31Ba1l116qaYhwC688EKvvPwyzSQfDiBl+wOzAUIWc7ijk/a+36qI jNSKK66g7WNmuD5cE4QUH/vw00933YfvvvvuznzYx/wtmzAf1qba+DDQ0NKH9VDtfVhw7syHGbSv OHzvvS3iMN+IODyiPqwB8mGCyF8iEhmpFVZYHinDdbl/HuWS8hRdYSlLStja3LFIq2BnPow4t2xp xFocLkCqz05cN2/7AKujzKDBueb1KTS9DdwIoKauwIUFF1wQkmDa9PGdH4xnMbgEEg/W+Jubx3NB U4Fp0VU1T2N8oOplll7GkkwJpCqLvsjjiKussopUFl9MNardKnL7amAVPy6163WirJk+rRo+c59E GqQ7+R/uiWgivgtlAdEPEZArS4mZc7QZBDgVL/jOUVouLZOiSTfvufvuJRZf3GZLfosdwFYbRBVA SlNRlxyhNRa1QQYNaGYW76+88sq1DIqG52Xw0cSoumqpF0EZnEXTdAP61VCLT5X6BE+OUIdRizVe tmmq3bnsBed3FUgF/vDBNmhrK3MdKlIJSIGw6lIQuq1thYA3SvMNAW6bKSIvM73xFklr2Q4Ciixj jTkm/dRoEp9H2evLQj3dRm0PaM4JnUuvymXWdgrFM0Dg26ipp54adqmJL2BZ+kYKA8Ga3lQHnUw2 6aRzzTUXIrVeX0EDDwrnITVL6Vxvv/1209kaTnMQ6WWNkYnps6Ycj1BDE+UaM2rHA05sz4ar2uDb y/gnhS9PMVa1PnnBGt/Vygq/8cbrtXjqZUMXBWmvpreY1Z1ooonovNkjenmtNdccc4wx2Kvpw0AG +7JyMwtIOYsvvjgf5iFNH+ZLjMivaswQP/kwrNn0YSM9UoApTSPyefut8P/ovarK8XL4sLbT9GFx AJ98OFJrWNp772G+dBFFleJU2Ai76PAsM6AKPZa9YEA64lsPEMwEkLL9gZSDNaZWWwJPXoaZ7KFg cUUsNvd+iL/jDjs2m7DqWNC+es3hByP6vJoUlp82xbeiw+Sj3EbTh72MMTWahejLh5dbbrmWPsy3 eTgfruUd0fFFdmyY0jRiex8+/PDDSWH1fU0KetZyp55qql4ffqPmw17W6hWU12n6MFQqX7jQggtp MjXrszidY5W9mj4MfI899tgtfZjfRhxu48O+hWoGIh4ouy8O+0q9Z9TaC6TMAPiSySyeAbmG4w53 gjXFQH0f/2E78UT4irWq9UD0wQdgPSO29GE9hTisxTXzysTXy5BRpWHEAqTaZUOsQwJcrO/x11UD Q/5pTwSI6i8ffdT8As6jKNVmYss7LU/nAXGi6uqe5olR4AlLQEm1rCJufszpRx9hqVY1NnoeN+73 JxvU1zvA2bzzzquLMkfpqzQ//DXAVZFwyYndictv23ukrwgBxLivp5lvvvn80Lrab3EeQEqsMbRV ChashSFN1CjBWMQSsabrexnU0yr0cLWu1MvCARFsEthEYFqIkCEmNsdeXhbN559vPms4eiYyeqf2 br75JkFfixVH5plnXmlLsm+x+eZiFhGOPPIICUVAU11q1OxrYUgfbFgJdOK2mW/HKulgZZLWutKA IDSjY2iGb6FHrIGhfXBQI+tl4wGGg92b4hv+rr7aanKfUHstCnsZhlBQjrNWUHX6YKDHKkCqqMUv L0swwPQCbs2IxAepOcM2W2/dnN5yx/cZTOydGhykGQGUSm302pQC55LHOrAmGvayFRWkIEsNEChF aulk8/IyeTXxvQyBKUh7NYXTMD3bPIzOm8NZL2sLxGevpg8L3+zrY4WmD7N4+HBz2YeX+ZJGeEgr H9ZwQDcgRtqmaUTeSwqe3DQin1eK/zeBlJf5sIJpLjvBrJjUxiduw0z6RfuYWyeqOXBR3Y/+jx68 ufZaa7u5zjrrcGluf+cddxBfGw9mAkidfPJJ2o472o4RWly4Iou25mu+1VZbVRMOH24ake1YkB2b PuxlYzxNmA/XjBg+zGesOm3pw0aACy6wQBsf9qF0Sx+2B01fPiwFEsPylj6sNfX6cD2NjXNggvg+ YasV7BkLvf66pfo00ExleTl8WEBu+jAcCdry4eZgIHyYKZtwsCcO3303m/Jh3wLUUoD8oS8fjqGg JmwhaVN8Psziyy+3XPhwAKmll17KuJ0PaMLJMYgDlHMwIzhTexCV8KWsSN4MRMbAamzpw3oKDglp NQe0PXF4xx3JeO8ncbgAqRwgMaqXhfOkkVyx73D8DuAIS8U/01VdCgZRpYLpR/MMmap+0z5SzaBW battnvaMgPs+wLI56Exkezdbbn3ypbtpK2atS+dx9NFH6RL0kXHdeecd6bdBmMFW787m7wczfZFt V2NI2Iof99qL36cUbZkZrkr7OhS0M2aofbg1tlwIEhmONjL29Qi14Sq8zxrb+EbGo/aW6jozn95O /FPk27Sa9g2qasSY2oMDIGBdb7SIT/6/p40Ykp1xxunzzNNzREzViLGz+U477SjFpWAq8gmFO+BO ubRll11GN9xxgxopBTszYl8RrH086axBDbcltmlQndXY/6gYQMoInOf0OsZ/w2xP1L3jDk717W/f PMMM0xuXQm/tGtSnj3f81IxEv5twAVKjOhgaKvJXgVRf/WX7rjRidAd9cD8LGn1uscXmM88806yO EJpl5tlnn63yn1szu2+a7OCDDjLe6pjVWk9TA5Ht4OAAi99UbD/1NkIFB4Jmx7YYuIJ9IuyhaUQO L1lijfkcc1gXOls0kPgvtRENB9J6++2fx6xfeIWCUoyVNjVrtVlFm5p5ppm23XYbPevQcv6BC0Qj 1KCGqA/LEoFKdjcIX5pttk85RnIwSSNrBwGpAYr8SdUFSA0VIDGq8wlImV/gr4P5kjy3zNaihL4u Ty3gHcwiFN6KBgZCA9a5t28amow5uGbV2stw25R2NxA8F5qDWQMm+8zVtgm2Hlku8tmIgJlf/OLt lgt1Rm7PPSj2kRq5Kii1VzVgXZHBk9HqYL4MfQyV2l/eGcwiFN6KBgZCA/1pGhpOs+r+FCxtaiBM NshpWmA3vFjb8/wzk8KMRAFSBbQMdg3wUauvrKMqV9FA0UDRQNFA0cBg08Ag7ERLRmoQGqWwVDRQ NFA0UDRQNFA0MDQ0UIDU0LBT4bJooGigaKBooGigaGAQaqAAqUFolMJSj2oWWSIAAP/0SURBVAZs 2fW3v/39d7/7/Qcf/Lb2n5su+5r84x//LMoqGuhMA3YVaZ6V2RmpUmpANcBMaW+8Aa2oEC8a6EwD BUh1prdSqq4BO1r54s9a9djgCgyyc5V/+tvx3u4PPviQbdycP+D727TpqN9zzz2P7eCcIPbGG2+O qCVaMiZMY96VNoUfUbL2ZSUsCmljWKvN3HHZ+qtjDQQbto21874LcfuE9bX3bD95xhg+UQt7BeXq 9mP9pNN8jaSJIJr5gkcVeAtWW26c2zG3Trmx22H7bdVGiHi4FsH9peT8Uw14Y5gp7NVF8blQ2F0V nL9jt0/6aZp+hFTX5mWatLO/TeO6RRCdqvgaV3Of5w7qYv1wfqrgVAJCB0RSERYJuycEWQ1cHa+2 Jni11eO2K7JjO4U7gmeGu1CCDiUiajiq3x1LnWOIfpYtQKqfiiqvDUcDzklcaKGeg3HiJESubxtl +4vYsLh5unM/tXn11dfYfdtWb7Zxd1JQXE5UcJPjOv/h+99/sZ+k0mvyWLbfxZgDIlJCIva5ttmx 7bNHlKD3BY7DDjsUBUfxvPzyS0HB1oXON1CR3UFzOqp//fOfjjmzb7vd7Z06ZztmewF3wGQqYisg m6EjaLN7PPvhcsxODk1lRXz7oZMXn0GThiUOM8kq7mSJOHPJqXP51ALi6O1s0m0bbpHa7650J4R1 cg7B+byNobfYYovM3tRm4qiR3bDBiEIryBcfBd28I//sl4043fJ5O1bnUKY9wlZN70QvDS2HZnhU 4DPbhVOF3wyX35sS38FwtEp85x05TbWzVl+VTgSwe7tzYNHU3m2q5FyjHOB78UUX4ZCN7IQZFZHd 6T2U7MQe+4x3plvBWfBceKGFbFAejdR+mzl8JjZsReaQCcS32267rozKnCpLfJ4ffDqWzb48+dbv TG/DLVWA1HBVVF7olwZsJeLYQedJ2VicuwuCTsFzgpgjCztuqN/5zi2TTzaZYCd5oJW6hFSxQJjm uOOPP8FLL73cL+YqL2HMISfTTTed3Z9TNkJgctIC4rZ+GFGC8b7zxTR7h5SlM6r1Lo4TmWGGGR55 +OGc9u9YCSNyWnXtuOOOzs9KsbUzVoU5YBS1o48+OvYs9rt5GOWIEifjY48+SrF65eAW544wMrIc UVK19311bw9JJ44xXI4mg6zN/eBIIBKrzhME+1zfOu+8TCaJCUxccfnlBHeeiQ5PH5A5deiTctSc vOGgDO7aFVRKTEfnwriO3UBcd+VsREfg5WQRGAU0mWaaaZxhF6bXZh36kSm+8/WYhqWYyVGMfkhC 20ko01JAJERi7BRNwIk6p5xySiZN48YNN9yQf6IJoIMpDpnJmY4UiAAm7d0xhcGbYMUHHGXofJuO KePTiUMgWojvcpiscxUzxVdcuHMkEWU6dsLgJJ+g3c6Qsk9s8OmwMuMToSCf8kBQKEBqILQ6KtIU iB0XJS47+uqll3qyMjb8MCvn9ImO1eEUgi996UtghJA62mijfbH3csCTY6Q6BlKYEYacRuwY0RTo gQln59lTrmNWFSS1o+sc9hlEJH7ACB1MZt/vnFS8RT+nCpkJMSWHz1TWeSCOePv3v//VFWqISMBg z8lxQdC4XOeXkGXHtUBmTmqTjpLxkp7smE4UxM99TvK+557DDjus5xive++F9W1HmUnWdJ7u03HF 6EhAxsGC+bKjpjd1xFsme9XicdxedMYaKQSgc80BUugQn63t3BgV+aezBfltx4MoRGAmptGJ6lBx iG3GylepqAJJB2M2SXLyrvFPpnpFOacp2Nc7WgF3dQRkx3AnmBGOKNAZdvFPwYonCFyZZFEgcgpK wqDd8DPFV1wCXvMUnB0eD5zlp3g5JM+ESoM3owi79UNX+awOBIUCpAZCq6MiTS0zjkQ1FBP7NANB iutrYB2r47bbeoCUQYm5LbkuiMqJYDo/ia4cIIUfu/HiLYb4ODfBYZCa2ZcIzaafnCSKjss20LPO OmvHSfikNMed7rnHngKTAOqCpXKwadUWYnTmuLlmWZ2c3jTmdl3mYU0d5vd8EeuNyOVmdAMdu1Mq yDocwLnUOvtTTz01c81ZkA0kIdkTZiK1mbiuUDYycdRxvtSJAjiim48V3C7JD76aSV8SwvyLCc1q LZpDZq9Pgaf3XrvssguAntlCgzdAyvhBBjHEh1fys1yapMYurRs0JX6eeuqpfG6NGIWmAD2BJBJU 7dhe1113nbUN0tLB6o477nDyySd3TC0VpEMakD+T7Rai82f3SC0PfeWVVwafZk6lz/MdNV/SlhQK kBogxY5yZANISTvLP1spIqaYmJhtttnygVTP8ebvvishoZXutddePS7be3U2tZe6PbMPkJnkgSVH pk50gZk2owFTkM6cJ7uop/uX6s8fmYkdzk53sLzLoisZr/wAHZIOEJAC9fR/LirNz0jFWmNwRzA1 9ypFkS++3kiMZix+xaNOOaULHQl58WYMHZayjD2/Lwkz1YAUQJmpgQ8++AAysz4sWDWzk5k0xWQT SMny5sN0dmd9abMHH3iAycDfzEaquC4Z2ST+rbfemi++Zg7iC4Ch0gMPPDC/4WNVC9pxhx1kYYWp vffe28wpvJ6pAflsk7mWYZg6hKgOPeSQzEx88CMbB0kDlMKp9Uw5q0KDIKPAkT4tWmnFFZleFu3y yy/PnCzOVF2b4gVIDZxuRy3KAaRkYv0Qmi05tGzIGCIfSMlvW9YgfyCsWGrdFSDFNhInZh61TLno aq47x2zCx4ILLBAHoTvlUweQQy3K6jVNPF104YX+E0mNIL///Y9TPpnEuw6kKNPyC9NGVt26JPlE 7cysjDNTrTMzbwJEjj/++PrmruQPEiCDejMX7ycrgDh33HFHWMooXya1K1iqCqTkUaBqQ5Qc0/Mo QJ/bB6v77LNP/iqZAQJSjz32WKzew7NpIxgoR/DUoAzJLDAP8SFpWCqfLD+HpYKmucJDDjkk0/MD TAhNsjJaFphirjyfTyuZkBJJQElXpi8FPz4IEPDHGGOM5ZZbTgTQTi07y4SnilvJt/VWW5111lmT TTbZSSee2JXWlK/AlhQKkBogxY5yZANIXXvttdGuZKHlTqwVzQdSOiTZI2ukfBICmXULSD399NMW teiZLAnX63flM3jLI+RgnnnmGQuknJbelSBlJsKy/UhCYNJQUijsint1HUiZz7JGCtg9s/eSkMvU Kql1SGb0zj///LPOPNMHVlY0+3SxK+J3lwgMfdRRR/l2KchaLMVX8/MHSFWBlJY1x+yzp8nTzkRw OLGPNJNpDjroIE0sM8vVcmovrcTqjM8BKmX+kXOmbl7GyzLETPEZ+tBDD02LrGXlTWpnTmtGexea wFxhypI748l8nZjai3GjvOywYcPA00zZsQTg+hrgxBNPPPuss6wONOgVpjJxZOpQ/BAATRq8++tf 54s/QBQKkBogxY5yZLl7fLdCcmltaVizGzPPPHPOIBKGGH300WWkAKkvfOELsFRCUZlTe5g0wWHY tPvuu+v4RZOuGEzskJOThBedzzvvvK4koo1upWSsaxHv0O8KkIpVXBabo2ZpV/wzXwNwpPGoAN0t gjDT/vvvn9aFIGsRnhSCQ1Lzue0uBSDSsMGHRZI9+OwKkAo1mtrmS/E7cn7pg4bORDBL7uuqABNo dgVIQRJ6+mR666623WYbXy9mpiU6E7B9KS400UQTScmE+JqqZYiZ/i/FNf3004O8sW1et4BU5OHA XDFQsBKy8hViGAZIBYx+/PHHgB5pvxyyEkVApAxfms0U8y23t4NDjlaVtUQkRua4lZfS8PP31MiR tE3ZAqQGSLGjHFn7kUw55ZRmx2M9oO7E5+XyBzlA6oYbbtQ5GX9L7fiW3mQE+t3KSGHSXKHF7Kuv vnpm4qRqbF2dVIRI3ZV0FMrHHHOMr5b0dsK067BDD/3Zz36a417WvwtJSMnD61Bte+N3IOCcC8jz Mbkv1ekTQQxn7qIkZWgOwgpWXz4GY6oAKewfBq/kZDpzxOyrbAApgwfLoom/0047+tQ055s1FUHP SIHRwFNY36oRC1zSd5GdCWJxGJo+Wgyaew8blrlDFTFRG3vssfXQQdNEj/ThIERRNCYRa6Y4iW9m 01cRnWkylQJxZpxxRkMyqJf4/spzd0V8eEJSSpjqSjrKIgEL7SeffHKxNJjnrvGRRGcaAJ60dJN6 8GjaL9Dku61qOKrdvzojqxQFTjXVVDa8kED1T+v3Z5h+en7Vlb0VOuaqr4IFSHVdpaMoQesM9KPG drEVk1y0NJIZmZxthK655lrjPAmeYcP20lxdc801ZwJS+uwXXuj52rzjy0SMZae33HJLV0JesCGf D/P51qbjbUhr4ujkQAp/rWClgY53ukpkjepYCjXjSCjND1f6yrpjZUI5RvnHHnusL9URNIDOXNMg 78KdbHHkO6DgShU6AFUY73ZldN6xsM2C7K7bEO59CUh8DpA5taEKi7eQMmNo7inMZIEU+pkbSlkX bK7EMj7uhGZSb8faAKQA3GR6NKGo//yn54SDQXhZWy3V7S9lYrUrAEWU45mavM9L0fSVcbdCCiAl hyRMdWXkIHpwJ60+LQ8wStHErGftzFLc3t4cTK+9p4lsulWLIJOz+MzyShTwFmsiTZ0bmdBD/lfA nUnavlQBUgOh1UKzOxp4/fU3BDu7kqTLmO/ggw+J/4SDd94ZvLPm3VFBoVI0UDRQNFA0MLg1UIDU 4LbPKMydRTuxLqTNZZHDKKyhInrRQNFA0UDRwMjXQAFSI98GhYOigaKBooGigaKBooEhqoECpIao 4QrbRQNFA0UDRQNFA0UDI18DBUiNfBsUDooGigaKBooGigaKBoaoBgqQGqKGK2wXDRQNFA0UDRQN FA2MfA0UIDXybVA4KBooGigaKBooGigaGKIaKEBqiBqusF00UDRQNFA0UDRQNDDyNVCA1Mi3QeGg aKBooGigaKBooGhgiGqgAKkharjCdtFA0UDRQNFA0UDRwMjXQAFSI98GhYOigaKBooGigaKBooEh qoECpIao4QrbRQNFA0UDRQNFA0UDI18DBUiNfBsUDooGigaKBooGigaKBoaoBgqQGqKGK2wXDRQN FA0UDRQNFA2MfA0UIDXybVA4KBooGigaKBooGigaGKIaKEBqiBqusF00UDRQNFA0UDRQNDDyNVCA 1Mi3QeGgaKBooGigaKBooGhgiGqgAKkharjCdtFA0UDRQNFA0UDRwMjXQAFSI98GhYOigaKBooGi gaKBooEhqoECpIao4QrbRQNFA0UDRQNFA0UDI18DBUiNfBsUDooGigaKBooGigaKBoaoBgqQGqKG G0C2/69cRQNFA0UDRQNFA4NSAwPY+XVKugCpTjX3OS33l7/85d133/1NuYoGigaKBooGigYGmQY+ +OAD6G6wdb8FSA02i4xkfv7whz/86Ec/+nG5igaKBooGigaKBgaTBt5666233377f//3f0dyN9mo /vMDpCIH2dSvm/TuavO0fcGWNguyfUHj9pUONieo8vPHP/5Rw/lpuYoGigaKBooGigYGkwZ+8pOf /OIXvyhAqjWESLAjEE+6Ekxp+UI8/de//vXXv/71Zz/72dNPP3XXXXf94x//qNbx5z//+bzzzttg gw023HDD66677m9/+1t6qviHH354/vnnb7755t/5znd+//vfVwv++9//fvLJJ7fffvtjjjnmjTde /89//lMtKNl5yimnbLPNNnfffff//M//1KT65z//+eqrr+yyyy4bb7yxSv/+9793BTm1gW5NjVVr bI/5arwVIDWY4kbhpWigaKBooGjgYw0UINUnltDNX3DBBTvuuONuu+221VZbbb7ZZvHflltuecIJ JwQwev7557fcYgs3t9tuO69tu+22nn7/+98Hdy699NIjjjji7LPPXm655VZccUUzU6km6GrXXXdd c801jzrqqEMPPXTVVVf9xje+8d5778ULVgLtvPPOhx9++Mknn3zIIYfsvffeqSxcctFFF3mKgW9+ 85vw0GOPPZZQsOzitttsc/TRR5966qlKHXnkkdYVpUpBt8MOO2zPPff0F+VHH30UrsoHUrR0//33 A3YI1qip/YD99w+lHXfccZBlFfMpCMyR5dVXX+0PGwGk+Ouvf/1rs9Hvv/++VGqtHbvjvqeud955 51e/+pW/isRrUGY8ouqf//zn/rpZLRJPXb/85S9TKe94M+6j4H1/o9mk99MPNxNLrJwKsqlH/qan GItSTSnwFlJ4v8pGlH333Y/F91pf4lelTu9UxQ8p4lFVFhqr1piKJAFTqSjo/fQITQz7GxSq4jNZ iB+PkhGTHZFN4iTxm0ZUEJEo1RQ/WWRExWfulnYP/VStr4rf/OZjI2ImGTG8MaQIGZMU6f0QPBVJ elOWrpKZWvpwehrihw97M3y4ZsQ24qf3E8GaEcNMTSNW7Z5q7KcP17y0vRFVnTQT7bfqky19uGUT Jkj7JpykaOnD8ZRdUjwJH/a35sPNQOSFNk04iZ8CUVW31agS4ldjUYjPiFWHCev3x4fbG7Eau0L8 qhRNI0YcrjZhXFUbb7JjOGS11adHySH7H4fb+zA91FhtGYeTEVs24WqRqhTVVpNaYjiAf6q6ZKRa dOV6+m9/+9uzzDLLF77whS023/zwww6L/2AmN//0pz8p88Ybb0BLbi699NImIwGmI4844oc//KFE 0X333QcoyEVNNtlks8022+9+97tUx/XXXfelL30J1lGFNyWlxh577O9973teAG5kqiaccEIQzT9v vummiSaaSF4qslwozzvvvLvvvjughoH55psPbouUlewXhDT11FMztn+eccYZU045ZQI3QAzsNdNM M1188cXV7Fd/EEybd5599lnaOOigg5ZcckkZsuqb+KEZj0JpBx5wAJawHe/cc8890mZA5Nxzz33l lVf2h40AUvz++OOPJzUEJjOXGn90UZS2ySab0KdU3yWXXHLjjTeCs+7TCf0fesghPSnADTYAjl95 5RW8uf/EE08Qwf1NN910iy222GD99bfcYstbbrlFFItIKvrsteeeXnDtu88+UDI9//qdd+T8wOv1 119f4nCzzTbzlEQPPvhgtGRNywVf9rCywQZALcjLBEEWS2eeeabqdthhh4ceeqja+ElEqwQEyuHd WlxQHPhWr7Si16ogzJsPPPAATojzrW99K6ROl3Bw0De+ERlQIP7FF1+kjRDQmzfffDPxFbz22mtT QTGRBb/2ta8psvXWW/v79a9/HUyPSimcSq+++uqgudFGGz3++OMnnngilyOCdxiLCGELgtOMXGmE VB5L/CioXipVkb9qJOBLL73kZhQ0kuH8/gZXnvIZ4hu0eL8qvkfaWohvsFETX7Dbd999w4h77LEH 8RkxeiNvkjoKcphqQfzQKk8LIxrVPPXUU4YE0beRgo+FFIY0zzzzDOXwyTA99iiNBuL9MATiHDK8 hRRKocwcr7z8ciAwL7zwwgv0HOJ7GUuXXXZZcPXb3/6W+FFj+PDBBx9MzwQh/u233xZGvOKKK6pS eIoyqfnn/vvvL4akbth9NFWRjPjIww8zE59kRCy99tprfJgUxnU/r6C9kMVYri8fpo32Puxp04f1 Rk89+eTXe10OS9dccw0Hc4U4fNiAM5rwxz586KH4fOSRR4gWTVhj1CQR/+53v5uasOJiZhgRhaef fpqlwoh8+KqrrkriP/nkE3w1fDigGMpVHz7t1FODGTBC81TRTjvt9Fjv+6mt+S2qCCP0dvrppwcb cUWNmnDU6AVG5FeM4inx9QLR4rxw0003XXrJJTfccAMKTOYaNmwYp9pnn33efOONKpaq+rBSNR9+ 8803eQtBVBRNPvFDinPPPZfSBKJ77723Gm34MFcMH6aTqoAhxamnnBJSUIIGhfgPfvADjZdp3Ofb 7vvB28MhXboA991ElpiCxn777Wflq3qFx2ocZkSudeuttyYj8nNG3GbrrfmwIjXxL7/8chVtv912 qUjISApv9sThXpXqpGhYmAp0TgqhMqTQcTz33HNHH3UUqXXrMg4R8bTTcC1zRKHYaPsnHH98FCQL qYmPq7LYvHVXTi80OOaYY1JxekNwgUj069Uyp5122mijjSaC1wiJ4DPMMMMcc8xRnaHT5cw444xM BcDCFuutt94C88/PC5X96KOPACzJKgHOPx9++OExxhhDG4gpPPhjicUX17X4bWJu2WWXnWKKKV5/ /XX/5BM9abPNN48slBgEq+ktAiOLiSDLLjvvDN/0B7X0852XX35ZYCKO+C42VUvhh5YkyeIm9114 4YXTZKJ/HnjggT947TWNTTPrT3UBpDQAwGvaaaf94he/KFZGcii6WHbRlvbYfXdRQ7chTM8+++x6 QSbADPi1dW8H7I6n2vA000yjLLA76aSTilCLLLIIhvfdd5+ZZ55Z/6QUsv4ecMAB2iFqLi15tdVW Q1ZMP+mkk7Che/ZPiHafvfeGXDVL0TA6NgFFXS6Vuhhr+eWXj0Ghp7ALOA58i+OopdGzli9Fp3Fy J7lMk7zVgbWIc+mll6ho9NFH19tVU1wiHS9da6210Nxk442pK426+BIkx4uCJeKvt+66hPUCVtHU FS2zzDIKClJR0H0EDQA4J78aa6yxxNN11lmHF0W6As/8UKDhxhTurzhIk6B/pN90MDTm7+694i+2 6KIrrbRS2AKa16yw4am/fEBBLqGgEOaf3k9GnGeeeehfdfSGLA0bmWiSIEu1w/Do6aeeWmWVVUhB e4YZSW/EZ1DsET+MSEuaJGQQlgJAF1tsMQW1F9nfKOgRfvbYY3dMUpqyCrLIoosu6j6aeji9Av5D fPqZeOKJ77zzTgQ1N61S52QMhnIyIim00AUXXFAbJ/JXv/pVlI2ayI5/BZkeKg+a/nrKBMmHYbKq DwviPDA6FUbUDFdYYQVS0F6yfgji0oVQGs+JfEn0B8yB4WRENeKZFJqkLlYpHTxWtbU555yzlgnA rT6bD3NUWKfpw9wmfDipNPo2rHKApg+zJvTZ04Q/USljaYwYQJzbQNtVH+aN0003HTZQEwa9tsAC C8w666ya5PTTT09XwbC/Hu24ww6oMT8jGu7OP//8kVAxVK4akZMYuF5//fXaKYvQBrv3+PDuPV7M lBwsIoN64W+xnXI0BLVUm7CeFVnie7/aEkkR8AvBcH7KN/oVu9RoaJSYCesTRGiNGlkNoBlnnHEm nWQSRq+NIpIPH3H44VWFM6KwKYh9+ctfppyITglIkcKgUQTD6oUXXsirkxSq0yVpenzYOFn/leIJ KYz2WSpJwasnmWQS5jNe8oPSuOLkk09O81TNE4jgWnGFFfgDTY477rhQCD1MNdVUfJ7sorp2PWyv vXQTPXF4n338hU5C9uBZF8OH2dq/auIb1mpWnF9YTqzGwKyn1X8ShzG81FJLCcXsRQp+Dj997G97 7KFxTTDBBET4/gsvkILsa6yxxkQTTrjXXnstvvjiIiFmAkVBhHBeEh8RXPVzaqU/nV0X3xkUi80j XRRASq5IixUT2eCcc86prXni4nzR/ZoKuIjGUANSkXZiTmMLIZhpdauRrZE60kNoUX6AHVqdFJTO I6Au79FgtH+/AWf+rUMSgPxTnslASgOGnKyO0nI4lkgX/EgAjDfeeEb2Ru3ikfjYRVMhxdVqGan2 QCpqx6qRxwgBKVFYk1OdLl8rjbSEBvPKKy9za/2lWODSjxqaCIs0wPsJHjkDIQZjWpeIHEAK4hQf 4ddjjz2WMplVC4mZVpRNkpq61SlqPC7dvCaprTIBi+uPmVJApG36BxQM7wLbUbIojILqVGrEBqkk IEUKaQCmV9BfeY4UF/wAT0VPAoo4hkG1fJX8hCJGci7mTjNcPUji6acRhFD1GaJ8DOYUP+ecszfb dFMOw3vxo4ggCMonIAWTccUoGFBA5MIJv/WIt+gvvWwOlze67wWRK8aaVE3hZJTJgAn0TDhhCPHL ayG+Pl5UIgu93XTTjWxxxx13REEvSA3qvQxJVUQ0bHjNIz2QtO6cc8xRBVLCvWirszRrLNBXxVcL nch9ipvsHuJjRuIEq4b+xGdENwVxnUcAKfoxFt972LADDzwAz+RKCj/m6KO5UIROZRmRTTUlvkFL oqceN6TwFFIff/zxE5DSNcrihBGFhaDJFXECrvEW/gDE8xbdm/GSVszu4cOqCx/WQ2NAcFAj7anx vz78y1+GD0eGiZjQGLWEEVNKNbpMIsR0v4ajN0p2Z1BdoOFfSEHhMigYjlwvspIZ2jWyOhtjxVoG tD8+TKVaX82HZdpwEj5MakaMHJ7GBfFTZohPvUyvIb//3nvWSFBd+HAYka7IAhlwia985SuGiFQH zmqSogq2owmzC0VBHmFEbqDBkoXmjUs1efEk+bBGjazwS3Zu2fRhsqRmJXREE+aQcuHVJkyWgw86 yCO2kLaMIoH5OD9HjUCEeYgZphRYiMa7cOtRiI8xd6qpNf03I7q4VmQiEzblw0aDrF/zYe8YzYKV jIjbk048sTonzi58jC2wysQYS5mn3nzkq8mHRbYwIikITgo1chis8mrRQxMmte5prrnm0n5FhhWW X56fUyPAFEBKAORsDOEd7iquCiwswhbe152JwwzH0OIwz2TQQMOkCB9WUU9f84kPJ/FpKcTnvXjA ahTR1pg7xWERkkedd+65mCG4Aae/KRAJ2nRL6ueefRaCV+r2228H7KyK0RED7pghvuwX8QVG4jMi 5lUKBRYg1SeoCCBlzBEJVRBbg2z59ggBKZhJIzF+MhzR5hdaaCH4prpsXBXeYWN9vJjYXMzEnOwq DPlR44cLXnDB+csuswxknWhyZThPWNcNr7766rpV8beLeUhOXANSmpA0+GGHHqopuowtNKGajICU Lm2EgJQmqgfSM2mN+sLbbruNBqIvNIJJ4y1NyH2N3F/erwjkmgbNWojg8o0DDxQ11D7fvPP+4cMP sSpNpSVjiWK1NGQNxLWllPgRXBDRctAUxFdacUXvC9PattYIEEcvq/sxVga+I/RgBgWdZZraQ2Tt tdeW4Zc+1FAZxfg4ggKGgQzxRdAXvEwZVzMBfsuIeB8FTb3a66tCX8th9CiAoMx5ZHEUkWwjZozt Alu88frrglREKPdZhztxMyEsEgABpKgUMyKdH6KeLo3O3Y9JFk2jmvlwk07EYuLr4HWQEZSJ7wdb 4FBdcGos+0uJH7JjQC3K0lt04VEQTWgjTe2hoNXoX8EOb0YiJ4RiFL2jSM3xdGwRu91HXE4LFknJ S0ZRF6gataiC94raGg7TR+yOKCzfYI4m5fNDcHRQJgJd1cQXtWNqTxUwCqVFD8HEkYlUXJMH2hRc Yokl2NHLskqCshdYk02Ts1V92FM+bEBV9+FvfCM6VDzrLK22JIXeV+cR1g8Ta+wsoqsGEYzrGCiK 8EDJ75S9C0dVMJKO/up4FOT2WoHOr4qHkg9rAgTUu1R9WMMEEDVSTTUSAMFMWIqXkp0ayRszStye d1XzXp9qwr/5jSApZkZKIPktshjWtDUKKoUVrMH4y0cfrbbqqjpFL3MPAwaRMPFWbcJ8WJNProhy LELCj04xEkVNHw4GvGbgZPCgXpqpTqhxGNlKXoeyvj8SsYr0pGRWXBEYSomfwDQHHfQN5lAEncCI 4fzoeDOmICOtyHbGG7yXUaqjCMwIQVUfTo09BmYSP3zAsGTWWWatomEFaQDWETTgGAEkuZ96vU97 dAILyiiHD2NJw9dMUp41RiOUya964vCMM+Jcm9UHca0999jDACCA1DJLL018dIQRb3LIaXsDRVSh aaOpYZrz++jPf9Yz6rBSNg5xLQVgrfpw6IoUIDiExPk1gUhGhtvX4nAKRIrEPEM1exerIcliZMv6 ihsq4IpRNG3ZKcwQ36SESF7Ne7Ej8cvU3nCAlNymJDy7ysanuSqeF+mQKDxCQIrtea0eheGFIa1L N8aZqnwgLnbwpOa3darWbMSOJgSGjeDxueeaC4KuohYDDlLoMFTH6toVf+3iNF8TSOmVdYHG0/ob F5c1aKitxRtRIEX5WqZsuVaqycmORIjk+qQ2CSL80G20lnTxeBoGcaprLXsWRb73XhTUSHqaSi+Q 0q68GcsyPNWK9MGRoYlWFJf33TfXjp8AUvgBJSMhoQXqRWKlReo/UIu+3CX4brrJpho8IKVDjW4+ 3iQOyCWkIkjMlVdeuRro/YYVYjbQLJuoGoNdNEUBI0XAC5JgXFxFQZQhvIsvuqg6D0j86Nsi3UIQ wZHJJOGhXlV75B1uIwUi7wUT6FTEFzE31pN6DeyoTff4JzGFeO8rGMnCSC/FRV1yBkbGKdCH1DHU A6QU/GFvN1/tTmKFrwtjGo5Oyx0aFogTVFWLzAR1ER8ONi6PQO9N3Xx17VeIVhWfAxgpaYwbf/3r J55wglFmaIZHxaK3ELkqhYYZ3UOyb0gRS53IQlfyee7wJRgobMGpzj7rLICAztldYsabun+CeKTf 0sFEP930YXMlZ511Vl9GxJunUqSk0NbQrEJVIlCXjJp+CFgJqIo3UcuwKtAJRSUBKZMgXhNhYHp2 1HjB8QTOPvbhTf/rwzKRVR8GDfknMfXNOp6WPqxezICqMRYC2YGPwBb+WW3CLEJd0jmBh3CennoE gEKEzB1ASuMS/QLZEIEVIqlTa8Jckd3Dh2viIy5FBEPEMsSaD+MBeFXcWAgsUJ0oIbmVTOOHGnmd R7KhYnuIryKqgL2qgSgMgaY5ceKndFdV/AgjSpHlySee0BIZRcE0RUvPmnz4MKQePhyOFINGzUo3 z5lNtCWnDSMKFNqyvkBWTwAJbSiIE6OC8GEeK+yEFHyA54sMVefv0e177+FTq/eIOOwOSP3+d7+7 /PLLDAhjjVRESJ8P8HMag42YzF91GXhgo2clay+QUhfV4SeGMZFz1R51ixoLrqrDLS+jA0sRXxPQ xGgvgBRFicNNI5q00UykA0PemKxPF7eXN6HeAFIk9QMmxgzxGdSIsRr6woictiw2b42l0tTes888 o8/TXOk0XtXShDZ3Qneme6R8xLL+TO0ZrlldzmNii6lYI2Lwl8pqqDp1Ll5bieUFvsLDdI0PPfRg M6UkVoqMOpIaSNJVS70a9KAgUSnGWdZTg245k31NIKVJGG5qvbEDglU4AnENFI4okOLZ2qEuYc01 1jQFQKJoh/w7ASneDIjIcOjyWcclb2GYUgNSqf/TxrQizYA56NwP1FI4CyAlLqhF1h1Nwfe4Y48V JtyMZRYBpDhGrA2KBtwEUlVEJWqIaJYLmE80uW4Bh+BIOpeKmM9UPc6NgQQCyYCAC4gbtUuTmK3H hnfwE0tkSBErq0BkfIJT4vhDvSCgJZBKzKApcyYtIUjx4XnmnhsWAQJS7EZB5BKIDRyDWvRkLYFU YJQEpKixZyH54YfjU4ZAGCWLeNcEUiGdPrUGpKowxQt6R6NSyTYDYlPVVBT5mN5hd8+qFEN24kt4 6HfZHcMtgVRVfKGfyPowaFJ8p/NIJSYgxR9efeUVobPny4nDD2cybHCwJpAKsvhhFBwyEDOtv956 uJJXxn9gKWrhKgGk/KBSSosEQACpXh9+qObDxg81IFWVgp6N9GiPFJxWp5imaRDnrhNOMIEJCJ2H 6VeZrYCSCUhh6brrrsUzGQlIWAQJ4gV6NmNiLGQG6tprrgnHiJTbp3x4xx0jRxI+rGGqSCOlT20h +bCCVAGjJB9WKXVRSwJSQTyYwQkrcwxpLUCKulgcTvJIgzUUoZPQpwYYQMqPGFyFUwWQcgd7PDCa MBlha/8MIOVlg5OoUevmQjCE8AVIIc7/qz6soCLQGxTIc3BoPY3vUfQIIb4f5geFdI+8gIHIHLcE UmFE4oszAaRc3g9mzGERHyp1U87G8jV9v2hjEpngP/95z3ijF748bahf8+EENWRqrUmiHPHBDJQU aTIiNxMoJIpoUg7GIiFhRGuq+fC6664r7Nzyne+QoiWQSq5IfP4c2XFAyg+cky7AWdgFcX5+9113 ue/lGDVhKcVhQCrF4SiILKflUXzYQrfkwyluiKXcnvNrAmzKe1WUgBQejAZ9B5aaMCekxgBS3jRb QuEuemB9Fgwv0mMiG0A/hnMtgRQ2PCJCAVKtUQSkIlxaI6VFxZqe9J5kgGXgBiWxtklLk/IRGWuE 4AlRQ4KhComkaqwE33effWMjJf13+mrPHWbTDvm0sjVqcgZAusYpL1qzmYLikYxCpJ1qBVlas+fc 7sPdvE2oTaAwB0JF2SaQ6pkIn3POtBgLuAH+coCUYYdBp8SJLt/ADv8gowABgGoMOiFCBbgxODY9 L6Mu9IsOZkhpzKgojaejt6uOCxOQqg6zNB6Gg3o9BXR89QE66zysvDazE2CrCqRSP6oj0XcC3xHN 49LMoikSJJaR6mNIAcSQQuj0FE3i6ICJ5lEsbNflxBSSv8Zb7AgXChx6Vm8KGRGDYCzh1QtBE+Cw 6EFdxJS8NPNSFS3iHZqc4dxzzhGgebK+SnG9AkRVHdGqIoBUmhRASkhii9o6YmwQma7ULnL5p2aC TxlB3ZLwZxZG8OIttUX0mCG7l6kl4ngoLbI7EYiJT//SkAgSn00hab0j8RnIfN/H4i+7LPGZXrJd LcoqUs35RVzGW4gvQ0Bkgof4aHIV4uuwdR7giDclcjyyVJbyGSs6ctiiKX5AIuMZpgkz+cuLqlkZ DJA3gFSaclLKGB1uDh/GMGGrPqynpL1aGiB82E0zZdSbjDjFFJMDMTFPhH9NRutjBQT98M9AHnp6 TkixatR/4FalljPLhfNDGrCYwfy1bARt61GUDcMpYgKRfqo+jP/wYUCcLZIPqw7ICx+WyFGEQpJy wodZMKb2SISICIkZ3GKASxg+qTqmp0U5MRlLmBSBsRGIoQqkUkv0iOuCZchySLkEAhpGkhGKglE2 2nBDEqnR7xBfKFaXeKVek2gUJaWRfJh7sL44ZnEVY4WMJELQWDHyLt6HPtfofeQFnm/SjauQkUSS WM1AhAEOTC0c0m+tNcTXMPFPM5jENp9xkx2/suyy2Is0G1+t+XBvQ+sJdwHsDK7I5eJCRrPWzsa0 FJaACU21akThLlpx+DC/rfkwsho+/0+zkCmcpmZbBVIpACajYKkHSN19d4TQ6hVxOIBUuo9s+PDS n/iwtLR/hvNjA0LiJ9GE115rLWxrWfj8OA4/+6zi/JksVKegF4yrYzm/4kxm7EpM9uJR3mF3TMYU LbePrFhcDMSmGkvkrZNQobQCpFpjCWGUHq2R4jc39C4sTe+J4Mb9vpbXTzObSOFigHgBuhJWtHwG 49ZGJ6Kzf0qc0DUDGz1r1cZYwI0gJRzwKgXlvTj3uOOMayxoUkARMeX13g/6XCKCSV+t2qjoyiuu kHEFIOIzPS1N29bwrMo0ulKQEzBzFLR0nQi6FjhMjZymuoIqH0iZ6TAaqNKJjFT1q71mRgr4owey 9IcBwSu+cxZWhABxU0MywqZhoUcWwbAp4IKqZW5N8Ri+gKR+E9wP4wzNQBONQGYUgj0/9NzeOeaY owVo6bqEfkRhLS3WEsW0FITas/y5N9xH5sAdyID4CsY4T7NHVuiMj2zxEzMROmMG9U8pEEXYTtcS zIBlzI0NLZY4KjWo8yYxCWscKTT7LbgDyobXbO0p4jvuuAO/0oZVapC9/377kR1NlI1fKUel7qDf 88n0m28m8XHI9zDspnyDssFMTIsYvHLvCHMqijWhOrDUi1M495MZMlaOGkMQjmf4/uO33qJJy5Zj kQe9yY9Ko/Jz6nJ/qy23NDKJgpHJ04LsLqurgxoxFvf99Y4mQwno+GE23N8QH/NmCRkxIJGMV++6 jd+HFDAHiyOIKz/ICBYk8Ukd02rEJGzvSpeefo6SJSS8HNMNtE0zMctGCg1N8/H9jt/qjV3ckhSB Zl568UXKUbsVGGF93FoBKevMfOE21IKC6IGaGmOCJhYkEZ8P4zl8mN7Ch70fy4GbPqw400hf0UD0 1sTnRdJ+sgs4lz/jjXBwzFz44Z9uells0SlyadXhU40qArvdd4eK+B7e8KO/keGjf/2fN8OHmbvq wxy+pQ8b/Wu2VR++667/+rDQR13YlnbShOkkia8JM7HGhavwYQOz1BK9zy3DS9lIAxTiVFRtwvhB AaakpWREIBWYwLkgyYfZJT6JIL6bRkoY9j778lXWTD4MA8F/6Ksa2dAhE7uYSeJHQHD5wWThw14Q h61wkOKKBUAmncMu8YKKOLz2iw09gikkj2g7Ipgx9pFHHuG3XibW2mPVC5okI15//XV+Jx8O6/f4 8HHHWQDKh9FnI1b78Y/fCiNiAx3AFDOCQ6yFDyOiDE9weB9hkFpgYRq+Gj4s7IQPe1mwIn4wE1Kw Aik4Z0w4eufyyy4Ddv3wKLJKcUXaCWQMtSfsleIwcK8jI3Jkhd33fviw7pW8SmnX/smOfrupx+Tw IQXxpY3pWYjDCWENC/GQrG8BgO5PINJRIkIhyfqaJ5illwmESmqwEl4PsBXM4P+oI4/caccd8ZCM yP0EBC90cdlxf/rE/rwz8r/aoxQeA7UY4PIJf9OKKAKYYtMeRBwuBQiLYtSaAKmnvsN3P8YrMXDx T10dTIMy20C18QJkw2/CBrHmRhE1eupadZVVDFbiqZ4YrNYhxSNlDe61EI84gaCgIl4ST9dac00h MulaUPZPoUo4Fgiq22P2xx4t3+FAeHPFGjI/BIKYMSTRdttuS7R4QUgSB9OqeY3cTRBKRBOR/dYq tIE2nIgdQrwxNw+OMah2IkzAjmavtTr9kDCnRi3EpWHbnjRmQ3pWI+60kw7SqiOPBG5wASlxGSmd upf9U5Zbe9BVBySKZiOeGrxKLCuIuHYuLHrBpW9Q0PiVRfyg1SgYXaMRkpAqHimo9dofQd+mGzPi YVxRLKSwBkMKzYgKDhDFiKMrRSGWBQgTOlcYlOlheoGV10VBV2T7Tz7pJBFQDgbgiHROCMUHeG9g KV6KfiiHLHxPDxq7BJl5CZGjoP7SHIEAFLONV199lZcNBmgMD6GWSHFTI+XgIRROt5yTjwk6unbt BXhK4lthDc7SJ2Z0bOqlMaUsRnZZHaxvFr5xiwjKboYRoRk9tHhnRK5L0G2EjC6vTTLxJJRMsZbf ivVJfM5geayeycBajcTRQpP4jAjqERBBsDgWrYf4oCGFYI+/iacoEFxFIaCxiLrcJz7pBOIkhae0 LQp7mVE4UjCJJpNpm8znKRnNYXlZolotl15yqXnDcJjI5fDh8FIXIqKBHzGJDGFXfVgPoTnzEL04 arLUSYoYAfIW7EnKMn30Ky4//JO3fLu3H4KWeEIyIkc1M8KIgL5EHegQYwOK1U3qWWEXjY4Dc+OK D7+t/VZ9GEZJPszn+bDGy3+sKKCKqg+TkRG1U3uz0Q/r4yE1YZibNiJ/FjshJSMKzvQfKIreSEp1 sZQKndSEaZWAXv7EiOfrZQGIMKKbPCGMGCYWxwwyw4fFYT108mHB1rSg/BkQjM9IBkcg0hGYNeNj Ltb3zyQ+D8SYdXJ8WIiDsWD3kBFlsUug8PGHsGmcjCyFJPFBCto2Jpc3ii2XwohGBXxYjbTBt+Mj uKoPM5Mmj74xPD/RYMOIAi8GeIsggyuxS7v7JBD1fKTGMWJULPcWCK/hwz1YysQjHQarmiotoSYy i8M+oFaQsfBATKAt2QIDIJGGjSuejIe0q5lHKQ4v0huHWaEnyL79tvBY8+GYOseqirgrVzekSeLH h0caRRAX2KtxOL4VDXxsLyh8pibMGTgqhZBC89c06ErVlBxT8xH6YmgqDiQjaiZ6Xg2kAKnWPTi0 ARK5pEP8rakpttMEDjxt4pK4HwWDgqv6/V1scOBK21RiAk3vpPdrL3iz9sjLwZW/1Yqi3tpXcv7p piLdykBq+dKtglfkRf0QL2KxV4BFKx/ddGl11W3WjTvjvoSz/j5S1n19ERm2Mdy39sUlxGsGMZTR iqR5ObFOUbQ1ypEwMKaMSxcYyScvG6wYXqdHmr1gFPlb+MOwQ6CPsjpIpAIxeEH7setSKqgbiEyv d3Q/7mNJWY0ZLkwzNUqJWYRKBX1IZYij7XlZEQEoavGmoR4pYEpE/NCYI/ChJoyG1Hog7Plxww09 36x5Sl36Ue8rpawfBIx0mqAMuQZjujQVKaLXScyI3SKXUCWSUj6MG8woaFivIjd7l+j+MuJU1KJD CmWGcuhWLYkmtBeTOyGUDj5mQuOKZWRRUAhTS3qEBzE0OMenmKj29FSHYXRhlIkrl4jmHXahXv1c MMZ8fkDkYRpSAH89by+22HXXXhsLNRgu0dRZunPXd7/bI+nii2MmxPfXBjZqRw2Y8E+wQ9+WCuqc km+QQi1V8XVmiMBeitNwLF/DktEFW6gLUNaVhuxqWXihhcgefUBoxst8mNX+68O9e23EU3LZkLDq w26qVKNDTc+RpABVVWdgwG0wo23GjgYuP/zTzciC94CJc89NNGlSz8eIQJh3jOKAHtr2Jn+INotm +LAetC8f5jbhw17ggXUfvv76aMJUFOoCu/0mIBfSjyZ+9NCpCdd8WMHwRqRiCia4UjawV2rCfjBH oqm5pXaKuF42PaIxMa3qwyBjegpIwRBabohzSe+arV6A8nPeFU04WqK4FxDECzBBvH/22WcRUCDi qImmIShPjklzL0cKJD296MILBQ2WpXboLZb9efn5557DmIq8iWdPP+XD++7b4129avQOyAviKMWI pIsm71FPxFtsMU04dIUy964GIhCE/4eGjXXDh/k8KbRlQSPxyaNifBsjsai9p5b55gM90yIKFgzZ oxbhMTa/CM+XdeuJw4ssEnEYtlbQfY7a48PLLpt82JBVj7NkrysKO97n8FHLu7/+tT2/VE1MnOAc JKrGYT1RmjdkfcA3SaFUfPpAV6Y4dEz4CV1BTsmj1BI5yFRQoNNM1NWtjrXj1Eaz4MjPSHVRmM8r KchM/rl2VdEbPBdPa9tuQYTNgu29UIqLf8daxQiR0WG7k/qhwD3pSmt6IuD6Z/VpohNDrkjL+xEN O13xtEozFYzqUsEqY1FjkxlF4v1qLSFXvFwVJ4gk+vGjpfhRsCpvqijerzHj/TTWrBVMzETBKldV +qGfmkqrQrXRW7NgVaiWRqyJU7N+f8RvWj/ZXUeYzF0Tv6URqy9XTRzitzFivBCcJIvX3KaND7fU W0WK/56YlNSVKqp4+8ccJmvWakxMNl0xURsIHw6ttmQmHrX04eqjDprwiPpwcDhc8Vu2xFBsm0DU l/g1n+wl8l83C2aqNbaPJ5lGTG28fThNtdTCac35K4H2Y/s2jdhK/I8jdgq/LcNpy9BXC2KNCPap ziVJUSvVNGI0/AKkPq9Q5/MjV+x20wQrAQiquCfu1O5HCOvgUf8LVoNCiu/NGofLWF8yjlDBpgZa it/mtTYi9Efb/ddbTd6WBftj0JZu0J7V4YrfgRTtWW1PcLg6H1EjDpeZvvjpWOH9KVjrPrvehPvZ Eoer7fbKaSlFxwpv6ag1DvtZY81J2seTNsGzr4LD1Vt3I21/PKqDtp8jRdMxyld7nx+o8fmWxJyI PDN/LVfRQNFA0UDRQNHA4NGAhSKyViUj9fkGIZ8H6dLUXuR+y1U0UDRQNFA0UDQwGDRgXs8iqgKk Pg9Q4/MtQyztL1fRQNFA0UDRQNHAYNPAIERRIEFZbP75xkVFuqKBooGigaKBooGigQHUQAFSA6jc QrpooGigaKBooGigaODzrYECpD7f9i3SFQ0UDRQNFA0UDRQNDKAGCpAaQOWOgqQtsbKZXhyFUdun tANt2BYrDiuoHmtoObw7ro53jceYXUxRwCoiQc2ucc3DE0eIZ4da4DZO3vDXhX5XNuG1GVgQxC0m q/vNjhCH6WUbjCWpg3J1H9cOaBJz4MQnMm6ZLF/wqgbCWC6nEdiJrXYA+QgpIbk9PpN3oewb2BwH wFKYSUMIt4/mUN1beIT49HLT9DmCI5hkj0NXgn7w2TwMfoS45ZNBKszkyo8q1fYeNDWuEeKq+TIN MHQEvap6q2eddVAFu6R4Ej+6In4cYRQxKrPVh1DEx1gKeshmCl7VFbdHMI4zQTa/T+nAEP0pUoBU f7RU3umvBsQRpwE4LNMmub5T7W+xPt6zZ66jRVBz/EK8ojk5WsEdm+3a5bYz+jbntZ0uIo4uQQQp Zz85stA5Ep0RDMYcCuS4BnRQ9tdlL/jMvgRlfby9rVFD3LEMDjCxVXrHfEZBXxHbqjjxibidlHN6 FP2TzZRD/DlmnyPEtyl2V0KqoyEYyNk11bOYcjQgHNtb2YkfwadNt23t7eqYJoRnI2/6tEGzvXZs 8Ry65WC1PXJHqAp7+hMcKTtlO7YlaDKcz9FHiE71ZRt8L7TgQkiFsVzOQMwxPdmjySNlH3B7/2hc iLtjs+yORzt4dpYI8R0lFHy6bOTd/mCG4arFSQCpvQdNW6jXTnkfLpHaC+CITfznmGMO+6drWfZG D20ICDmQ14kRIXsyFu+yJeaIsld9307iTqZinYh4DrfJoRZlYR2HH1SDifOm2h9E1s9Kjc3oEJ/2 07elOyVrXP0s+xm/VoDUZ6zwz3l1RiegiXMJHMomZmV+YaE16j8csefL26Q421w5dcHJBh0nkPRt N914o3PdnfckCDqR3uEDcYRfx+bRN+s+nTWmz0PZeWdOLBEHDac6phkFHUHlwCnHnLkcgDPOOOM4 0TaTpsGu8z3EPlA1KDuhT4faMVkq1X/AIqAe8Z104Rw09KUoOqaZCjoUwmEg448/Ppo5HXMQZCl2 h3GdlBeyE9wph86g7ZhVfu5wWRH/6quu0is7YIfsVOHcjJwm4EtvZ8g4dJIa9dDcHqZ09F4O7uHw cDlU6gjLEN+ZaDkgkoA6OceugX1+gM6OveNdumr/zEnIObfEmTbJ+Z3q4/Q6UKBjMykY53k7dcSR QSF+nOaWQ5NHoSbiOfaHaZxtB6zgFubLEV9jN2pyYAsYwUUFFg7mkK4cVoEezq+xO/sFZRrOoRZl gUVDO8cUcvtQqWNGOW0OiESWXzksyCAHQb7qCCmHHuYMIfIlbUOhAKkBVe8oR1zjkZlwHJ6mJSGR 31AljaETp3uGKrWuAw44wFC1YxQVdPRwBqaAGiThyNLMYW50z4CU40iFqnnnndfJmobmch75QMr5 d4ZlEZGlExzF5TjefMcCHGUNU77EYVh6lI7jfgApRmcvitXrO8pUNrErQEow5QM6AOcYOig3U3Y6 dCScXiQJ61AwPuAcsY7FxxKAIl8COjhEzNBZz5oDoZKMTh+D8KjXKYogtTF6pviK6+Od2pbmSZ0f J8ubIzvsaOwESjoczeHEZnmcBCp9kgP4QkzBRMbIDxogO0iRCaSQAnCdi/fvf/8rquD2maZHhJ/z dukibs/6VJGjzyQ7/MSLcGvsBKEKLJlAKiiDekYm+RwmV9SCQHOeH3eEwWWXWSZzzENwMNoJkghi ldPK+RlF5/v/QFAoQGogtDrq0hSdnUCptwMgDEm7MoBwvLFzgqNZoi+XINmTqWJpM92eg+Ud+9rx FGGVB0BK5swJ6ubyxBTxDjjrCpCSMNtzjz3lkOLYRGS7gk4gSKeQpq4OkNJndxxb9XPO9NVF6UQN x3UnoCrx/TPTUtGbmtsVWE2d0HAmQRkdBqohEog/Jx+JJQR5FOIO1tXtdWsxh24ejjTxSgNdmSfF as8h6EsvDfGzPgwkP+Hq2PQIck45HkjX4EGrp0kwHeLPX4LjfF9JOHTgSBlEh+9mjqBw61hoU5Ds FQ0KZSd2ZzqVcMep5OCdOK5l5SgzcSIjZfzAkZZfbjm5LqM+Leu11zpcz1AV8OKLL8ZnV5gMsnLG GrtoHx7lXGQ5/nwg5bT4Sy+9NB0XK6jmQ/NMQ/dVvACpAVLsKEpWK9I9P/TQQ6lp5TdXAx2DZuli pI455hjBJT/No6efeuqpTb2ZKTMezV/FjDfZCIsiE5DSuzz77LOZ0YQbGeaa34yT7eWQjPW7kuqI 0+P1pkzmkveSSO/YWFiCSmPNaQApnV9XxNeR7L777mCEGLrqqqvedtttHTMZbRKfcmYE724T1cEz kLTEGGOM8bWNNgJ2M/kM9g455ODppptuookmMhyH0rpieogEQWutwCmpKSleAChHG1xdrohnmtC5 6qqr/DUdw7vygRSUY8oMq+OOM063Vsg9/PBDE0wwQYhvOZfGlb+ak7kZiPXHHHNM4nclcagRgaQJ SEn2y8blq5Sha0BKjMrE/e+//551V5oVowOpm222GVbz/R9uhqQj9Gn7tJFPM8fP25QtQGqAFDsq ktUaje3GHXfcueeaa7FFF9WjSCDnr7amSmRNb+lFJJAuuuiifOXKl1hwIMUtCw2cyfp0q4kmIJXP ZFCgVUssrTqKhUeSc4b++cR1e5NMMkn0Ja599t7bdGQ+2QSk8kkFBSkoXSkwIeM13njjWSdkbi6H +AABKX2nXCyUb+LVCiG9aVew2n777rvhBhuAjzfffLM1vOaMcmSPsmZJdPnXXHONtfC06ijyTJqA lKk9HuWv4YQOtVtAyiIhTGIVwzJJuvz8dipvKnuEptyhWbPMTGSozgjKqjizkKxv+eZuu+2WuYA9 WSQBqUwbVYtXgRR9GqXQSQ59n+8Q39o7gdpiKUg9h1oqCztqrRH6xGoz+/lrRbrCWJNIAVIDpNhR kawwJ6NrvcU1V1995ZVXWsmkCzR9nq+LQw89dJ999kHfCoyufGliOs+Cg+jqNFHThZlLI5OMXQdS 5jEtXY/+Q1Sl4fzpLaRMvvggSki1CsHVlflNZLsLpEgtYWCpBASJSZ2fRc1wQE5vGlN7NZQDo2cm ewApMMIYmhJAUgN0+bl8zze1Z14PHf4pH2mKJ0f24MfUHuisNcn1HnjggZdddlmm7AlIyUZLRUj2 dAtISUjonvGMoLyRIJCZPEMKIOtdI/VvuV7ByoLOfJXKkctIRWbL8juxpSupo2jyMbWX70uJQg1I WdQl359DP+YfoBytAI40gdCVHD+El9YyyvmZNc4cROXI2L5sAVIDp9tRi7JYbDWDHQRS/6Et3XDD DXqC/ET3D37wA1jKimALb/MjaXR1xs2RLRP+TGxZyZsfT2Ozk1hsntk5Je+R5JhyyilvvfVWBAOq dgtIyUZY24RsvuDBLVJpsXm++Liy2Mg3Zcni7hjs+qg+5ytoa004qgQn/wz85DIhBa3mtFgdJwAh H4MIlGYUoZPOTEuQF3Tg835gUtpg++23z193aAljWmzOUaVPeFSOD5AdNoVQ5eTkpWJJuN+ZYAJL MlLSPGEj1IAV9HPMpOx9vYvNY87d+EEV+fBUNw9JxN4EflvWJqRkzpchRQPxFcs999yT36CCIDrG JBtvvDHKoViZnsw0v9GyCf1YbG4oRXZOm8mw4j5ZRTa+/kZW0qsAqUznL8UHuwZMZ1h4YarI1H7w CqaI+6OPPjoslb9I8LDDDhtttNEyR07BmDapiY411lh6qfhszZfbk08+uSxajpaNcc0SSp+gDO7s uuuuXclJyJajJjFjWtMSUREqfR3TMbcorLLKKmbKLOdElu1y+tFgQ8/ERnJ7lonoqCxsygTQvnk2 Bp1hhhnSdg80bHOdscce24KJHCVwAAvjKJPsce226645PTTZGQhjvgf05RptiP4W4mQOzc3oEd9K PosO0eSrZjZ905Aju2ED69hLwpew0dXp9uxYce8993TsTuxyw/XX64/BR7qVQ/LbXGRmlhcFKW2T emGjtddeW4Qx19Mxnwr6nlQ2jml8whI+D6mb5Zfm7Jis4CbEjTnGGNYGxf5JFiDScHwh0TFZBeGb 9dZbD7fsboozfy2XJQ0glJGecBdalY6aYoopZCU75hPAtS5eq7edWCR6NVj7iSQNd0aZ6shuOtuY B59WiZx37rldmS7vjJ/2pUpGaiC0OirSNFzWcuzRktYc6EfhHgNKACU/02u8K0x3ZR1PJAyCsYj1 Rvm20sn8tN4Iz1y+iRiU9VL5ezSEGxHcxjz+glCyU9UttTr2M0s6ZOBduEXWeDcfSBFfXgeHIb4M XyZ6lobkTrJHaU2YKuQ4sa2KzE8XaUA/R/a4rIvvWJkKYswMUTAWaU4Y2u5EbuakJQhOA66YeEUK tDr7rLNyZIfzuDpWfVoVRpdFU0UmQNGOTJGH7MCE35koCh2zz5HkDhvxVcAic3Biay5higYsZgrx tSzi52wrILiRl+mFu0jCUbLfNJwJpARVgjOW8YMsV/5HNqLHySedRKWUkJyfNnLS/NKuBqLEZ51o 8mb6LMBIGu6sZbHOPXffbcyADlYxOWhRFAELkOrMyqVU0UDRQNFA0UDRQNFA0UABUsUHigaKBooG igaKBooGigY61UDJSHWquVKuaKBooGigaKBooGhglNdAAVKjvAt8WgEWtFro4NOzchUNFA0UDRQN FA0MHg3omyy9zV/Q2fVevwCprqt0aBO0UNQhJL5tKVfRQNFA0UDRQNHA4NGAs/befvvnmUv4B6KH LkBqILQ6hGmC/JqNjzjKVTRQNFA0UDRQNDB4NODzal+FFyA1IAjDV5F2AbETBriaVOwLTDvs2SAn Lh+6+xS5tv+KaSxf2Cpod42mbRgMBV+GN7fD8Y3rAw88gKb9wapf+Uo5PvXUk3ZhtnWsSv21f2D+ l/8DorU+iBYgNXiiRuGkaKBooGigaCBpoACpdmAAmrnppptuueUWR0DEgRUuIAY8Cphi9wtb1Lhp nx6vQSr+GajItiKnnHKKzY5XW201m23YeSU2bvGyfczsZBjXxBNPbJtEqCjxAQzZ98JOYjb323ff fW1WUd3xxYkEBx988FprrmkbtNNOOzU22YvLjnM29rDVpM0MnZpe3XcOGrPL3xe+8AU7nqnUnofe zNzeN9ULJtpEp7mns80A7S4TSnP4Q3P+2C5E1Os4pP4AsgKkStgqGigaKBooGhiEGihAqs9OXMdv pzUboY7+pS/NM/fccYSqa/7557fpfuzB9dhjj62w/PJu2uj2S1/6kt1+HTEt2QP6gAiTTTbZgw8+ aCsw2GudddaJcw1ljGy4J+fk8si+qE5FSChEpfZhc/IG/OSpbY5Vl7Y7s8MYPGQHWKjCVngOTAXd ImUFtVx44QVTTz21/eu85rBbTKbN3Lyj1Je//GU726pXLip/VzqVyo1BkEcccYTzIIHFqipVcfvt t9lPOZRGTLtKpuyahBnO7d9tH1sJuQKkBmFoKCwVDRQNFA0UDfRHAwVItevEoQEHcdtjHjaCTuKC VBz8GVvlAkxx047Jzgmxa6rfbgIrduV3boD10V6TegFx7rvvPkjC0zhNyQUhLbfccrJWQc0FPEk4 wSWx6f5dd90FjaWjYeE2hwYEZJFPWmyxxZyVG0kpewo78U22yYcM/gmdjDHGGPacDbIJSHXr+Osg K8+01JJLmkl03pwDQ6qqlB5z/pQ9oEM/4OMSSyyRTvgikWNE5eFstC9fVYBUf9pqeadooGigaKBo YBBqoACpdp040OPsM0AqJuYcWQDoUNmWW2750UcfVUsGkIrzwF0Qg4Km8OSEenaUv+cev0GNBKHi tRdeeAEmcxBYug9/OMYLWnLaohfgHhN/slCRQEJBLRY5+Q3kxdFUca679VK2w3eCrDc9OunEEyEw O+7HhBogJSf0xS9+UTLMvKRa+oNdhvsOnVCIGocNG+Y0txqQIppZv7gpHeXk1ASkFFGQ1M4qKkBq EMaFwlLRQNFA0UDRQD81UIDUcIAUEGNGTKrp9ttvd8izDBNQ0jw73UleVSAFvkBdDsoFevxw+qb8 0JJLLvnXv/61Wp9Dr8YZZxwAKN2Mo6RrQEpWLIAUsGKdk8PCAkjJPwFSTiH1TzXCJV4Dbh588AHr q84//1vpDKA4SXvqqaZyFrqzNiWQlOrK7F5w3gRSEmOyZQ5vN5nouvTSSx1mXlvejqsCpPrZUMtr RQNFA0UDRQODUwMFSA0fSEFIViPJr0wyyST0FQWgFnNqMY/mqgEpd8AUB45aLW7dt0SRjJRV59XT UiGeHXfcEeV09KlSgJQz1WtACtoI0GPlUy0jNd5440VGKl0+9LNOy3nX1ZwZmAW0gTVmAL2APqTl eNR2wo/IsyaQIh3xcQK3udZdZx3H+tbWmxcgNTiDQuGqaKBooGigaKD/GihAavhAytSe5U0///nP 11xzzbQq3D932WUXyaRYQB1Tew6arpIDJqAZk25O27ZeSlam+v2dR9JdX/3qVy3ZTqV867fooovO NNNM8S3bo48+OvbYY/sQLwo6DFxmy/HdkZECUyxyB4xScaV23XXXVVdZxVniNcFk0WICUZrKOnQF fXI4ImCp3btNIAWxLbzwwuYuQUOXxV4rrbRSLZNXgFT/G2p5s2igaKBooGhgcGqgAKl2+EBPH4vN JY1kUywJT0joySefHHfccS2EilzRsccea9LtvPPOq5FTCk5af/31F1hggZTNinc4hPXXVppXt4OC dYAzc3C+a/OObQWkrKwxj1yOJUdWGpmYw5idvuebb96DDjooFYddzCFaOAXt1XI/8FlKnvkhRTT9 9NPXNq/KAVUtgZTF5j/84Q+DrIVZ1cXmcbMzIGUZPghIxmaLctMjCm/Z2NzvqyBY7BHKbQq2fBQF /W35tA0zIUXLgh1LEQXbS9FSbx2L30YKChmE4rcxYl9660yK/ohffLivJtxxS+yg4KDy4Y5b4mcf iAZVHB7pRixAqh1+kOAxBWaNFECjzVeX+Dz33HOSOj7vB26AHlNpcAO4kMjBK4pYigTcWD9+5513 1tYkWX8944wzHn/ccTXQg6AtD8zEmQvbe++9pcESVALj9tprLzN9pvMQnHeeeX0NF8V9xAfMmbOT PLMDOCJqT2ukbEyFoAVe7mMSkPJRIXSVA56qZW1kcNxxx1XvQHWxpCxuEtZnes2MFCRq563+sBH7 SOl7yE75IFqtH/JP1XnkhWYX5Y5vJ20tEZqpXh6xoIlIO0q07Nt8p6mgptIsKB2o4Ouv/6BZ0PtK Kduyt1CXguptFsQhKSytaylFiE/Spvh04hGXaylFiN/cHd7LPA0zPoxoWVBa0dVS/B/84LVe8V9v FlRRG/ExqWBLI7YXn1rI6J1W4vcYsS/xw4gtxQ8j+sK0pRFD/J+2sj6NKUh7fYlP530ZsS/x2/tw Er+LPkzwvozYmQ8TOdOHWzZhInfmw6Ro48NhxDY+rNKWTZintQ9EfTXhNj4sILRpwrk+3BCDpUL8 N9v6cEvxR0oc7jsQjWQfLkCqz04cQDnwwANtWwAwTTfttAstuGA1pQQnmbCz+nuNNdaAhyysjg2c ghzEc8P115vbmmeeeaw353M2RKjVZGtN+ENwr92XlNKW9thjD2V9ZKfSKtKC7aAi03++wotNqqK4 cTP4hVvTgjPNOKP/Fl5oIWuz4qmZPnuK2rDK/dlmnc3aeZta5e9nb3ZSU3Rtu+22VoP5YWAULEFp Sy+1lGXm8YLlWRSVlAAVRQez+uqrm6/025CiqaKqZgJI+ZixZ9X81FODtvaIr7ZwEvkgQAIPOKs9 8po7tiG10Rel0VW1IOVQ6VRTTbXbbrtZ91bDWPRvmwnQUzytjXcxwwGmmGIKf2sFvcnoplCVbfb6 CqrLbmHQLYNWa8QbpMujIPgan17zshQphyQpeasFCXjjjTd6BCKTqBb78CNVyTVkUmtkMWN3VlLw xqb4Ijs3to+r7raWP/OyrTpIYT8ORKo1qu7ZZ5+BpH1vEQ5QfargdtttR+E+2KyxKkt69913S5eu vfbaLY3oPhP7DNabNSPahoNjoFxjJtxymWWWwY8+o2lErYz4ZKmJrxSp55tvPhqAlmri27tEIpb4 tFerkYbt5WtVJZ03cyReZiPis1dLH2ZEVm6K/847v+IVfJiH1IzIMfhSXz6s4YQP68Jr/BDZt8DE NwxrGpHP9+XDCoYPX3zxRTUj4u2hhx4KH66Zicm8rIXa4aWlD2vX4cNNI4YPGyvSbS3r7OUzzzwT M00fZrXwYXZs6cPWsBK/6cOq4C18xjZ4LX1Y0KNwXteXD6+77jpNI7777q/5MA9v6cOXX345H7aW o6UPa019+bC1JcQ/5JBDWvqwroQGmsM2L4cP+968lQ8/TtstfZi/sRFWbZfY9GH7MLMvH24GIv4g DvONlj6sr8TM7rvv3hRfFOXDvFFcbfrwUUcdOVwf5nvNQGQlTK8PX9z0YT1F+HAt0kYcTj4cHl6A VLtsSJhTU4yBbO2jM/8Ep7Q3NuaRtcRSZKTot69DoaGuP/7xD7UNEYIbEEeYVhZ6aG4ILvnEIbhv NcWFDvdyP9JRtYwUmkAPQdxHtlt7mts1VEsT2Tkxd/Rjtllnta4rRBC29F5uusQOtSdZBP24b0NO wcgPXXV1sVfTKgGk6NnOokrZz7NFA771Vmysv956zQbsZRFBjJbDa3ZCGrDdInxX2GzA1LXQQgvp FAHlZgO2Y+okE0/sbxNI6bR8N6BsE0h5WV2+XfABZg1IaZY6IXxaUtbshLxsmpj4IHITSNkc1SP6 qdHkFb94+20wWnTTCTWB1De/+U3M7Lnnns0oLPgC6HP2bgnWFN9IQ0FfWjT7YLPhfGPxxRZr2Qlt vfXWFK7baHZCltMJ0BB2q07oXfc5DLDVBFKooYlyy05IQhSOxFVTCvyTgiwaXRWc8VjjdbGbBloC KaMdBWmvJZDSWdJ5SyBlFIRV9mrZCTEiKzd9mMV5Bd/gITXxWZwvTTrppC19WMPhh7yxORhgcRvq ksKHLE0f9v5wfbg5GMCbTqjHh1dcsSWQIp2Iobvty4fppyWQos/pp5uuJZA644wzSCFh3zQiH4ai YoPiJhref//9NWFApFajwM5b+Iw1CUo1+2Cb4FB4nz481VSGjiPqw44F68CHcW7vaOJb6dE0opZr toQGmj7s5fDhloMBm+8YtIQP18RXIxtNPtlkzcEAkW+95Rb2benD/CHicEsftvyXSi0+bgmk5DJ4 Y8vBgGkfRjz6qKOagUjcDh9uCaR876XGCy+4oBmI9BT4/OpKK7UEUuutt56+JvlwAVL9mVYq77TW ALCocbrMR7j8ELPS14KwFCQZL4hKVURo+XncBzLM7/jhb3NTiWZGSnsW3CXzmqMrjxDxSMtpOZ8i +ff000+3nNrDgFRNXxMKBqZCastZIaFZwZaTYpqWUpKLfSXGFWzOCuGcJvGJ25ZSkI6MLSfF6MSj ltNJeGgjvqlJzJiqaK7ZIkWI33JqzwRlX+JTFyn6El80xGpf4nskh99SfPc9bTmziZpHLedTiI8T /LQxYsuJ3TAiDbQU/5VXXiZ+y1khbtbGiPk+XFOOfyYfbrnwro0PtzdiZz5M/DZGHAgfBhfCh5tu Ez7c0oh0pYiCzYndGJT25cMKhg+3DEQ/+lFPIMrx4ZZG7I8Pt2zC4cPNQJTEb+/DLSPYQPgwNiIO j5APe3m4PtyX+OpqE4f778MFSBWQNDQ0kM7ag8kMa5rhMgYcHvW12Fwmpq+CmqJHbZYbNwfWEVwU aVPQo+b0XLVgX4vN2xQcKeK3l6IvvQ1Xijbit/lioL0R21u/2SUM14hkH5WNOIqLPwh9uGXoax+I BpUR20Sw4cbhrgei0Ft+ICpAamjAiMJlObS4JQgoN4sGigaKBooGRq4GCpAqEGVoaACQigVe5Soa KBooGigaKBoYPBowCyzTlv/9Vtc74//n6jrRQnDoasDK+nRudPlRNFA0UDRQNFA0MHg00P6r85HV 8xYgNbI0X+otGigaKBooGigaKBoY8hooQGrIm7AIUDRQNFA0UDRQNFA0MLI0UIDUyNJ8qbdooGig aKBooGigaGDIa6AAqSFvwsEmgJWAceUzZk+sIFXdHCvdzKFfZTL9bm7KOkJVJMYSwa4oAQ9VPfid yWcIVWWypuERkjq9/NmI3xlvLUtV7Z6v1ZYelekANbt3q2V13fQ1h++W/w+QR3Vd/Gprqv7ObKcD IX6NZiaHqVnVVJrp9tXWWo32XSTbxTASpAqQ6rpKR2mC1qrbu3mrrbZyJIL9fDN1YUdBJ9VsscUW 9jVO3b8drm12rIrqUUIjVJF9Sh1ZgIKt0n0GgpoqHK149dVXjxCd6ssaubO0bUO84YYbouxkA5dz r/N3txdKHPiIPZcN8eysbYvCjvmMgvZ0ccYLPoOsy/bfOVGV3R0eEuJvvdXWIT71prOVchh27BI3 cKCHzQlz6FTL2iXIeVMhu4OV7r333ltuuaVj4g48ICx92sHZltMO3/CbKuxm3vJMhX5WZENnJ4S4 7HPovCmOSsMo55yDbkcfh64glUxP/BzTE9DpN7hyVonNsu1PTQl+u2Mf8HT8fD9Frr528803s3sy E4Y1W+rtgFQqEu29Kr5zI3LER5mTOwDHXv82fGca4kfLOvXUU3P6fuJvuumm6ITduZNDEWwonyO+ rTgdyeCKiOfkmRxqUVaIc3BZOHw4FbvXTrztrBbaE1UQxK1DBeJ4pc5IDXSpAqQGWsOjFn2ur/3b 1H/88ce3jUKm8KCS8x8cXua0iiAl5Dk8yxksmpbTBjqj75BpgW/CCSd07MZvP/hAsHZ4joP8qodh jyhlHYZzRfQfzuGaYIIJnI8m6jlD6re//e2Ikqq9T16oVBBxOeOMboX+TJq40uc5I0VPnyjnIAmf 0jihjCYplvgOxKABB/44VDuTVcVtGO3Uy9FGG60rcR/BABMsHrIzGR+DhDruUFn/kksucQYIA/3h D39wGM54443nIBHQPAdJEHyRRRZxeIgd9p0Gw+11qA7NNBLoWKuGNzvssAMvIm+I78j2HI8i4BWX Xz7xxBMj+61vnadxOVGOep3B4oC8HCSh1Ttx5atf/Wrwedhhh6HZPDV1hFQhaOjyHY5kvBdkNS4n 0I8QkdrLDjHT33N7HuXwU01gookmcpoKhJojvmOIVlhhBSAVt5tsvHEcuGlr+BxW7R3glJ4111xz ttlmI7vTaXKoRVkf9DlCUcDn/KFSGqCQHNkj1IvPBxxwQNAMp83vU/LlbUmhAKkBUuwoSlZUdaCe jkTT0j8JK5mKcEoJOg5eTUBKfkL33zGKCjo//GHPuWCCvpap15fyyeQzgNR3v/tdZz6irOezje/c c8+dOYLElbTWnnvsEX08rCOqJm3k8OxYBtAnnWt55JFHyKN0jCQCSD3yyCP2IXNknl37DP0du9YV IOVYQF0UAHHA/vtndiQ0JqUhcyDBkwK9RJczwvR8HYuP7F//+tdFF1nEURgB07913nldGZTvt99+ xx13HPoO/NYQMvMx4TDOOF9uueVSqgzgk1HIkZ31KZAayc5MUhRSaEsttVT706j6473gPkvFmxI/ zhJ2mEx/CrZ55/7779dUk3UMeDJNry6BjrcD6IYo8IQMeiaMQHOnnXY6/bTT2AWUBPUEFi3LMVmZ 4isO4Mrz5Vi8xoMo58Dm5JwCFOvn5GLRp0Anfjpw3W/RVXrPwYK6g3zxB4JCAVIDodVRl6aOWWvX oQooEhJ603xdaEKS29HsI6w4SjmTrDky57Qbn+lCMme1ghNNXebgxhtugCTgJ/EOlnIUa/78JiAF 6qWoB0t1ZVimN3XAcJp6g0332XvvjmOrrlTSCOKRLBFSyU4DxM/JnSQTm4U0jBZY9X/5SSknqenz 0lGVUYuheZwC3vGln+NRpIZ7TjnllHwMEZzA0M4JljGCqExHdsxetSAkseyyy3YRSAGRWr38maNF nL9rkEOfiy22WP68tsyW/Ba31PfD0NJ+pngylWC0UwVSUHU+kIIkOBUDaUcY7gqG3mabbaSjBJbl l1vOSA9WE1EdWZgpvuIXX3yxabiOG3uTARCK+AlI3XH77YZVXQRSakQNPM0fmedrryWFAqQGSLGj KFkRZMkllxRGo0P95S9/ka8IuROzD6Y2kPrOd75jwJeflnD0rG5eNDEdIwOfz6Ru3uAJ2QSkaMBg Wh+TSRwqBXH2770OPPBA4C+TYBRH1qgx7W6nA8jJSMXclkRUAlKQtB6lK2ukdHXyHDS8xuqrw2qZ 4lt4F8nITDq14pAZKGk909hjj22NSEr1ZdbC4issv7wedO21185ZGlVlA4YGd7QjKS5217geeOCB HD45+QILLABIWb8ov3XWWWdps2B6PpAyQWx8glXZiHzTh4yEDfENUUAo4mdiaDS5vdlh1h933HHP PvvsnPncZAjoWSBNQEpTEk/yM9wDAaQsXZp11lktDpOLBf7oFlbLzMnBeSYfWCdCH7LGKjleOqBl C5AaUPWOWsS1nFtvvdVMtjWSVh6YNTfB15WuVCvSzaO//vrra6L5aoV4pplmGokuiX3BGtvdGp8l IJXPZKKg5zM8dRmgWynys5/9NJ+4w9inn356Cy/0JdGd5CyUSfwkIJXPYVCAexZbdFEZFN0ek9FA Zk5i4ICU9UxrrbUW2LfzTjv58qArSSk903zzzsv5rZhhJpNH+YqFG0wQWyokjWR1YAxRci5AasEF FzTpBk6Z3Jx33nkBqSWWWCIfSBGcVrFqwHP33XfnMJnKAlJTTTUVmjLHuv/HHnssnyy3N+1oYNZj /Z13vvTSS7uSlMJYAlL5TCYKtYwUhJo5NA0g5fuSlVdeeZxxxvnWt76ViaKCVTHZ6DRCn7S03sQC xC7qoYukCpDqojJHdVKxTmjFFVcUpOJzmykmnzx/tTW16u+NcjRO35vIc+Qr2tSetMSf/vQnbfWy yy5bbbXVutLyMdZ1IGV17QsvvIBPl+hs/WlXUmi6OpCXPuO7sMxPtwYOSEEPxvrCKCb99YlAZs/X cmov36MMl4EJMIKZfBsl38kT8sma2pPfQtPUhhyPaal8mjG1J2cmhwSp+JtJMwEpHFIv6NMtIBVT e/FJrI9Vb7zxxvx4ElN79AlQwj0aV6b4iksUzTHHHGAuS1kjD6J1ZQD5GQApDK+/3nrUm6OEmNrz waZZXR7le6P8cSkKoLMEfIQ+qy0tkH/zzTdz+By4sgVIDZxuRznKvnozCWU9YGwrAqbI81vckDlZ To9WLxqaG+eBU5n9aFhFgzQcj/kdI2mfVacPAzPNlhabZ9JJxWXjLDfRQ0dU7RaQkpGK3jSMlR/4 guFYbN7xzhQ1pf3wzR9yofvuvTeYjE0WrEDKGZgKzeYgrrziiqrIzz7zjL4/x2RpsTkiupPddt31 hhtuyEfn1vABUmH6E0443mcc+ctE0mJzGoAqLGrOXHkj86QfhUgiL8UBoH+/8zNSsjsxcMIqDYPU XVxsjqYVh9azy0/nmF7ZWGwe0+4muLHdlS9CQvCvrrSS7TkyOawWry02N+j1KUMO/Q/ef793sfk7 iIj/Mv356UNtZ7311vOZaiy9KkAqx0Cl7JDRAHxjTLbLzjunWXxjMpse+RLY19GZWEo0MaX1hS98 wcgpv8u3nMXi5UknndQcvL4ZQV8aSlBlDs21fOHDMhHTELi1hj1/gRTz6zst6TCx5WNgfAIBJqcy 3QIQAUzNlFl1gWxXvoLW05scPO2004jv03rJg8zjRX2pYKYM2rN0PeSlYfMyEmkylDn5HpSl4jgn 2ePSm+bsIkb22PXjqCOPjJUcbOSflsbnLJeBb4jv26Uf/ahHA+YKrWdnuBzZdUjAGY8yoRNjfcqE zmXROnYqcHz//fbTpsySgxGU6TcEnOkAPgM0hNCbho3OPussKs3c/kB08umGfUk4UohvEYKEdM7n YLEO2gYQ2n40+YceesheFffcfXdmsDK646UzzjADZGaSKx9DmxY3HLX0wvRrcv7555svZ70EKyOl 1QsmMZ0tDsjIhoY7diqN3VyhyWIzeujD00Jf5sfaHTMz3IIlIzVcFZUX+qUBqQLdnh1KIncSYwhj nXXXXVeyNx9SGN/bmS1zVWwwJpiaJ8KYkBotH5KwmDdzWAaT6TzMbKLs00Kyd+Xjf4jEpUvW2yFr 6iQnPIUGzEFYz7HOOuvgFlnfheXT1J1YaJXEN72buaCbre0ixqOIH2yrgoaxLcLmLLonrI5T90n2 uK699tqc7BHGrIftYWzDDWMJl+/X+BjIkrPqnOA04IqNjtQCoDNcjuyAjoWGvB3YDZFlZVSRuUJO 8gl+iomYX7z9tgFVfjoKtGX9ZCauRaUU26941MdLQLnmSfyTTjwxfF5gIf79GVtJCW4QJLI2t4sm z7tsKWerqhwYjY5l+5wTt6ussoq/bJcju7KgOX2uuuqqYnVyfn6bk441LrXJE/GtZAqIb+EELwWm c6KKsmwk3NlECquctit7f2QqsK/iBUgNkGJHObJghD4jpopCeC0h7mSmo4KakFQlnqPfJmN4Rjwz 6kVXFyLHlRNHkoC4isvIr+saQNPVrYWxNfFzbKRsGKVml1RFpm7DB0J8VxdNH4wF/UzPD5+vGj1a WY7syfmT0aOWrmggyZ4peLXJV82UKXs1KNXEz4HR1YZftX5+s0IhWn234klqUzWtdkX8ZPSopSvi x4R+KCHH7TNj0XCLFyA1XBWVF4oGigaKBooGigaKBooGWmugAKniGUUDRQNFA0UDRQNFA0UDHWqg AKkOFVeKFQ0UDRQNFA0UDRQNFA0UIFV8oGigaKBooGigaKBooGigQw0UINWh4kqxooGigaKBooGi gaKBooECpIoPFA0UDRQNFA0UDRQNFA10qIECpDpUXClWNFA0UDRQNFA0UDRQNFCAVPGBooGigaKB ooGigaKBooEONVCAVIeKK8WKBooGigaKBooGigaKBgqQKj5QNFA0UDRQNFA0UDRQNNChBgqQ6lBx pVjRQNFA0UDRQNFA0UDRQAFSxQeKBooGigaKBooGigaKBjrUQAFSHSquFCsaKBooGigaKBooGiga KECq+EDRQNFA0UDRQNFA0UDRQIcaKECqQ8WVYkUDRQNFA0UDRQNFA0UDBUgVHygaKBooGigaKBoo Giga6FADBUh1qLhSrGigaKBooGigaKBooGigAKniA0UDRQNFA0UDRQNFA0UDHWqgAKkOFVeKFQ0U DRQNFA0UDRQNFA0UIFV8oGigaKBooGigaKBooGigQw0UINWh4kqxooGigaKBooGigaKBooECpIoP fEoDf//73z/88MM/lKtooGigaKBooGhgMGlA3/SnP/3p//7v/wZbt12A1GCzyEjmR6v50Y9+9ONy FQ0UDRQNFA0UDQwmDbz11ltvv/3z//3f/x3J3WSj+gKkBptFRjI/f/zjHzWcn5araKBooGigaKBo YDBp4Cc/+ckvfvGLAqS6jxJk+f7zn//89re/peKXXnrp3//+d7WOf/3rX/fcc89xxx13/PHHP/HE EzUD/O1vf/P01FNPffrpp/2uMffWWz8666yzbrjhhnfffbeWS/zzn/98yy23fPOb31TjP//5z1pB L//qV78677zzTjrppO9973vNF7qvhe5RLEBqMMWNwkvRQNFA0UDRwMcaKECqXVd///33X3jhhZdd dtk555wNncR19tln33777ZCQkrR45plnuvmtb33r8ssv/9Z554E4boJQkJCCV1xxxRZbbPG1r30N Dkg1ffDBB4isscYa66yzzpprrrn++ut70wxrvODNM844Y6+99tp0002/8Y1vnHPOOX/961/jEST0 wAMPuLnZZpvtPWzYAQcc8MYbbySy7733Hli22267bbnllh5deeWVVajk9zXXXHPUUUdh5utf//p1 111n1VEmznn77bdD/Lh+9rOftSRIojvuuKMGJb355JNPXnTRRb/85S/7w0YAKf7661//+v3eS+21 duxOPHK98847UKNLkXgN7nSflvCZClaLpLJYilJRpHr95je/cT+aTe2Rf7qZKKtFXfEOOh75qyCW mgV//vOfp4J+xwskrQlYFR9xb+IniVOVRS2hgWqRVG+SoqX4WA3xvVZjlQiJpZosSHmajJLEb1Mk EW8pfjIiQWpGDDtWxa9apPp+4jZkqVk/TMncwUmye19GDBnjqYIqioJJY00jVsVPBZMPVwWPpzUj 9uXDtYI1hySIKkKcEfVhDCRt9+XDNfGrLbFaJNm3ZpG+xFdvXz4cykkOyY7eDDeuGTHMoYpqY4yC 6f1mkcRqX7IEQX9DOX0Fojbit2yJNYesRhXmo7f2RmyK308frrp9tY3XWmJEsI59OKmrprFUI/rV eJLEr8ZtL3TgwzWHSTVGEG42YS+ER9FAeyOmVl+TomSkWvfjUMtpp502ySSTfOELX1h44YVX/eRa fPHFZ5999sA9Tz31FDzkyYwzzui1WWed1T+lkYCGSy655OijjwakUJhtttl+97vfpWpuvfXWccYZ B+KBxqAZcMo7SHlBwZtuumniiSd+5JFHoDHgbKqppnrk4Ycj88Qvl1566W233VaaihXnmmuufffd 93/+5388gpOAsymnnPLVV19F5Nhjj8WMvFRUipQM1kwzzXTEEUdYFicBlr8sTos95phjVltttaQZ 8vLCmjb/8pe/HH744fPOO+9HH32UHr3yyisQ6j777IPhq6++uv9ASqXXXnvt6aefft6557744ovV Zu/RD37wA8k2aFKq76677qLDu+++O+KpRnLxxRdDqBdccMHrr78eBd38/ve/D/tS1ymnnMLcfiD+ 6KOPKuUdcPPEE09EEEz098QTTrjqyis1M0+hQNS8L3F46imn+OGdZ599NgKxst5xByeuq666ii2Y gAUffPBBJaKik08+2VNYmUKCJX9ffvllnOCKJ1TDuvbP6Ndff30kMhUHo6+84oof/vCHWBJ6Xnnl 5RNOOCHEv++++1Tkr2Z/8803U4ub+PGCNy699NKf/OTHiD///POgcK8U/xX/iccf7xX/Z0zzKfFP PJHyg0/MCIJGGsGMizluvPHGF154ISIRJauOFOB7MhOyWKqJf+6557722mvxDiMSilpCCvj7scce u/POOwOpEB9LoVLKJ7jRgpVzYZEnnnicEdX43e9+t9qJIuuF888/Hz98IN5P4VuNwZKCDz/0UA0K 06pmFTUa7TATlwijKCj7y1JeePrpp6qWIguJGAjN9H6qURV00saHQ+ctfVhUST5clYJfPffcc2EL fzkwJcg6R3vpIdhrfU/ZnzfWfPi003q8OHz4uef+68OESj5M80zM/UJFKPMr4vPe5PbIMoqm3dNY TjwxGgij3HH7HUmxfmDgjDNOlxpPbh/K6fHhl//rw7zLuJF1oqxOjt+GLVTa4/xXXhkF9Y7aYxJf LDXWffzxx/CPJetX+Bg/Z8HUiaLJtVgBh6TApB/e4cBhyihLhFApOz7//HNETuJTheIopyLexxVP 874Wl8QXi5Ry3XbbbT1Nnp7POCOsbCSZHFJTFY5SE3744YeNxh966CFqETo+1YRPOEHP0tqHH364 6cNnnXlm6O2KKy4PH1aX8JgiXojPk4WpFIh0JeHDJK2NWlURcZj4tTjsTa4YDeq2226t2v073/nO yZ8EohCfPxsehyd7k8dGE7733ntTQfx87MMpDp94YsWHn0hxOKTo9eHnImKweE/EO+GEcGM6TEE1 4gk/CbfxSJtVkb8soptg9U/58B09PuwSlKIi9XpBcS+zuxZRpvZad+XwxyabbDLmmGPCRn7HpZ+b eeaZI8MU83cumh1ttNE0Ib8Do9CpS2cz/fTTzzHHHL///e9THWLcRBNNtN9++3nTO1JE00wzjfjl BbBjjz32WHTRRUUN/+RYat9zzz2R9U/uhdTll13m9z/+8Y9ll10WNmJ1/0Qfq6usskrgKk1l9NFH Z+aoFBuLLLKIRNSHH/6Xjf7AlzbvXHbppSAUAPexXv797/XWW08MrRYB+NxZYYUVFltsMaKlR+KC myLF1ltvDSz2h5PISOkwJNUmGH8C0ulf01Apms3BBx+83HLLLbHEEssss8yOO+741a9+dffdd5f/ ixhNjWONNdZ4440n7vunm6iJEeOOO+5XvvIVJmAUxaFYyE8b8w4APeecc2JedX6Dg+BpZIxEigkm mGD55ZefdNJJwUEUUNaiIkUkTgnKK6200pJLLgn70vxWW23lh7lX8HGyySZT0fjjjz/DDDNgVUHt WZGIJqKAm3A54syaBk+MSGRKRoeMiB9yyCFTTz21QKYsNzjwwAOxEeLvsssuqgicvdxXvjLLLLPg 5Mtf/vL888+/0IILTTfttFo+ggINNpSC16F5RSaccEJxJ4b1kPrcc8/Nc4hPCf4533zzRYCjed0V oTihGlGgfK7O8WhVMBWvuQcpFlxwwTCBy49ddt55iimmUBGpeS9Z/NBZCkPRdVF+MuIO22+/6iqr yLAqiCXAZe211w7xV155ZTViOzpjxrrnnrvnmnNONW6zzTY+TUjdDJpeMPwgPs2/+eab1V4Bt6In zhVUtWFGFFSKjDpsXkR1Sy211AYbbLDDDjv4EV7nr44HQQU5eZIx+mBG4eEeLbH44gZRiZnwuiOP PJLa8dP0YTZNRqz5MBVJVPNhZZMPh28bQnDvsAXr77333tQuxKvaj5oPGwd+7MOnnMKHabvqw2Qh Wviw7mfFFVdEk8433nhj5vYyQ4QUumGN5Ytf/CKMFTejE0WNt6hU7MLSdNNNJ+keL7iQJaNGN8YY Y8D6Ke1KOj4slZ7E33XXXf3ef//9I5XITIap9M8cq6++uvjJqyPNIybvusuuIb6/+++33zzzzIO9 aIyAFOa/9KUv4UQtARTQNA5MTV47UheuyBLi06qonsQ3PyDAYiAEeffXv9b7Kq5pfPvb347MCuLW abiJQ4Fi7LHHRhPlzTffPLIXxsw8jYFoRmuiJboCnuhNWZ7JcEn8PffYw6A9hr4xeicdn2FQrVjb SRCk14evCR+O95MPewTrRCCiuo022mi77bZTr3B60EEHRZPnAzRDb+ONOy5ZUiDCmBCEJutbo1Lz YXFYyyW+7qyasiKIbmuhBRdUcMMNN8RMgFfir7LyytHkSSGWiqiUkwZR6gU06U1BnWAq6H7Vh4Uj xtUPhg8DpkJW04dZhDsJsMousMAC+CQ+4pQf3HpBB8Qx3KFYkh566KH04KbGSzN0rhbNjWamnXZa qlMdPfgR6vLIC17TCgRDqi5Aqk8gxRU4vbAFLhjBSKuwnxZehQUK63sAKWG3RkhLbgIpRIQS3YxG C0Yss/TSMHhMtIFHYLuUlR8SS8YrXI2BA0jxORA+ZtB4JxNyDj/8E02BBtJSSll4edpppkn8GAHz DENAEUdvxCH6g13av2PUKwVVdZ0akCIRmLLVllsasS200ELVjBRxQkCdk6FVf5gJICXiPPLIwwK6 iAbKCD20EeNgQwqRTiPh0PBH5AKHDRsWPRyrGRcCNGuttRa8GzHIm0Y2WqZGKy5oVJg0bWrylIpE BC1Q2xaIhWxjNaNDycVI/LI4Hry//fbbB17RcYpZ0UrVLleHPW9qezoMzRVZiUzYTgcJUekMjGmw JywySmA7fJKF4RAXf9PIDHzRwtddd10YVO8Yc4XiskAMSQgZegVqwTahiGOuWUBXI8bEUG6GPuYF elko4uh6OadeU0SIqKo4cRiRKiLRLUxggNcZOZCFAoU/91WNiIisq1aXGslILvHaMJfeove6+OKL zFwbJxjDBXZBFqABJekBQAncqce9+667hEtFdH5shFUChhF5eGiJDlFjDuJHBwlUeRkiDKiEz6OO OpJWqZeYtXH5Lbd8h7PRGFUEToqOIbKSLMhe++6zD7mCVS9oUBqpcTkjYkDOQ2dGXWFir4meO+20 kxr1XqyQ8JmyLMIEGOaT9FaFbn4zJXT4iQ/38B8+bOTjfdWpgmLBXDFa5xqdd/gwfVZ9OARnPkGJ ZsL67MLfDL4VhH0pjcPLmmv+1Mis0ZGAAkhxRQARLmEUPixKhIAUhUN2p232xTO3YeKEmR5//HHO T3zRJrpDohlzeo34gpjmgyUthR4SkPKaPJNWhrjBRuRTI5cjnhhZYazqw0RDRG+tIg2QIbyAK/0x t0SNgXiUi8NEwcMOOwwc0aYCE7jg+3XXWYdvaz5hekS8RpnE19DEWK1ARCV1zP5IXmKb3kJ8DUEk 5z9J/Ecf/R7ITgpWw3wkoWGIWWaemR6uufrqJZdYAqCHztWiOhd34syoafIaRfT0oKcmI4PrTYYg YEgBxULMdOs3zMGaONeEn3nmGa5IydpLyFL14f323bfqwyK/0bXGHoFI0KYZ3v6HDz/0pmUn0eSJ QHtqoZ9QWjTh8GEgsqUPK77G6qunOByqpodIKrOXxs5toiXSG7Ai9kaT5wO8kRTVZLzfDKGgYKJx RUHRgA8balIXHOYdqUoUIg7TjzjAiFyRD/eMG5dbjg+rhWuhzyGpC4SiZNGeiWOWFn1yidgRwZDi e6AhC1KgioivL4bDaEZLYfqIA6rj0m4uusgicCcOEdcWCpDqsx/X3wNSwKxOGujRbtlSGqm5THuE gBQKWhHn0JyA68UWXYyl01xbJHgAFDcNu2EsrTFYdBP48KY7BqDbbL213j0wlitK+Svo6KVEhIRd tt12GzBfX8vp1Sg28YnM2T11xUKxuETSLbfYQi463eHKmr2QBIYaFFSBVBJnRIGU1miMKBOAuGSJ 1qWZaSGalroElJhXcvH4mF+IXoGXU7iGwYLsKBh52U1dNSvQp6hqqIFJf2MQjOw8c8998003RRHd rcSJ3ghxTzVgSoanBVN5Ag1YZGcsiu1pwDPPrC8PSBHdPD613p6UzC67BGQRVQ153REUNMgAUv4y n66OgKgJPTHY9Zp4J5MRuBBN/OtO+KewJbFBG6m6eN/Lcu+6BwNQgAllDV4kJbsuIYCUQCmyeIfI uhNc6RgiIYe+MISyjkpYEej1x1h131PxjqJinBrRnHSqSL9VpLrow8DoiM64Irsun7pW7MWdeFAL kf0QjGbuHWcnI6oLTX+jE+K9qg6VusjrivCtuI5HN08W5hDB0/KLYAkGevCBB2B6XVea2434Lv7q ErBEmdxAQUX4Lf51A0ko3kIDurqQhexAD6iqRqgFKKwmV+AVNdKJkY/xbnV1jhrhlXPOPodnsppQ ED6sq1Yk0nJxeTMmHcKH1Rs+/MM336z6sJbOxMF2XGGLyHOowoQUH55xhhkMtdVC4SG4gKCXZXQ+ bM0lIEWQs5MPzzJL1YeJoJfdeeedgxmmpC4+ph9Su1m2yETqt3iXJsCl559vPv2Nd4DUBKQUVwu1 4JC8Wi4m/daWhabkw9GEIVRmpWE6NK8XagzTqwiMppMLzj8fwapjEN/9NEUVIwG9I5TPpjGIoi4Z TSMT4ocdic9RMeaRIvyEtyAVKlW1WGFglsQnFNNIlYZR1BhASrpC1RQSLUuOTZSLjJSIISLxnF50 e6v22zsX8RzipsWNUmKEEBfx5Zi1UDhSjAKJos82j6xxUXICUjUf1n7DGbwgKiYfdicCEe0hThYK FMEgA9GMpTAQs34q8g6sozihjOcFt6oPo9+LuXvGjRxMlIjwFZH26qt7RqfYxomoFab31yAEdEaH 3cVSEZUUCUjF6BSKClRUnUyQvePDnCoGAxZs0EMY0aiPIRTp8eG999aKDb0MRANIoc+HBRY+TyLg GGN4jjjMmdkiKZz38gR+xSJSUJoM8GowQDP8MAYD3hchuXTgTlbjTlxFkqUAqeEAKakmHYm+zeiQ 1uJtWIriEsQZISDFkGuusQYPixEkw2+37bbVuT/0WZd/aIFpEXriEnzRQeqqtZAmGOJnct+8pPq5 n0wpKXgnBxJMZbmEp/zF5sESER64/35dF69KqA7gi3Enz9NgFl5oobRkPgkCio0QkBIXRG3BKIKL sBtrgFKb12HSW7Rnl4aRMgGR+BGsvaBRUUJ00rpGTFL+Yb3IgLYFPsqJlI92peMR7wRiUVVrEXlR 8FRwscpNuw0gxROoV7CjjRgJeTmisDve17D9xbZswRGHH65gACmNUziLua3oLOkNXsESMSGDmN0L IKU9pw4p9SikEMhoI/BHEl/tARaNtEQE/xR9BHrg2+gc/PJI14h/Wg0ghSuyqBerqLGOvodH8X/A Czgwto6MOsAR3UPEXO+HjGhGRw6uicIeQaI62njTC2KrxqKDAaTEO6WiFgWFvJ6p6t4UhVoSzdCb 5mCYG9GclqI6V8R9ITXUxc0kJ3beaac0oYYaFWm/ZBe1Y04kelmX13So8kOaA+n0KBFbA0hJgSSs 5uXIOkRBSlNKWV2RHkIvm3oa1Yndegt3dKg6oersHoMmH9Z1MX30bX4oEmZt6cN0KKwDXsEbO4Z9 VaF7CBiHvareKEeeFeWeTmiGGbREbmmizZteA691V3yeD+hW+TCYKA8XPjzrJz6cmEniY4D4/BYU 04exr7YfPqMKY3ca1vMBUvyWXYz6QjkKUoWcAXUxGaPABMR3kYsPB46s+bCygBSIk6BqskVIkbr5 mvj4cYkb1MWNOVig22jC3C9yyQGkiA9Pg0Rq4e2RK6qlEtM/ia9nheyVEliMBBKOhEu8RkBAiq0F E40rmr8hBDgYacJbb7kFYzKC7OgRdRE/pdBCA1jFP9/YfLPNtHFaJYgBtqHpOuusnYBUjw/LKPf6 sCCWfNj75OXDLQORZZGkZr4AUojQA0HC4VmEq4QPy4zKYyUfZsTwYZqPOAwNJyDlfdGGQ1JsfNsU k3RklCqWj6AoZCPVzVXS1B5X0a+BKaTwZqQYQwkb90ZIIQuQErr5jKARRjSA0buFDxsM/PEPf5Ap jwUGkNC6664TcVtAZhTgnpawqi62UEsznEZ6j07wzKu1OAGBD2sgEXAiQroZCTwcCqdche3K1F5r LBUZKVN7QrBmLyTRcrxKfcbWhtShO+MMSEUKoUaI3ptTe3wCJpMWijVSEowGMfwjlWVmLVy44dM1 qIQlEcfISZay+R0cnwNoAqJVOTFmNf0v4KLGv8UvoV8tfULIfj8gIAhiUCL+VvnRBrQWU3ucmK8D Ihp/zc9GFEjROS1xX9EfADJoEAqjzcfgSZyuRuEYakTMlcjVg5o7gHWs0dHS4pG/kfCIFIt2FcE3 AllAsRjRQgYBTeJRFKTDAFJ+pFxCTyfUm/thPo3fFIPIIkDjGfZ1M7BIACkKTJ1HsMSpLP3xMjEZ Opayoq//A6RSoiWxkYBUkjc9SuKrMaJwIIOaFJgJIIV4FY2F+BigOv1QAqZeg4fEMj/cBIMI6IJT TejENIdV8JaO3XD99RTLE4zzUobAD1InIBXi020AKekWv/UuupabbroRQZesmH4rASkTDarzghqF fsVJRwT9k5wosCsO6gtTjaQ29Bemwd/JJ59cn5Q0w1i6T8NrnYH+GJIQf7EkjPIo2LEKpBLKQfn1 138gnQNMqNGIGbJUJJnA2JcRcbj//vtpHdYpJ2b4MLMyLrk0/OTDAaSCSEISVR/Wg9IP7KI34sPX X3d9wHQfQOi3xHFs03OvKW7kPxyPGsPctAFIaYM1Hw5XDCAVacioMflwdYY0ie81kHSF5ZenOrbg V4YHifNeePcOJgApzlltUH7rcphJFlCvRkUsEk04gFRtMBDMvPeb35ieptIqkApmEpDyQ71UlMSn 3phvRZkr6vVhGjWKFVVX1LICSCXxPe1R14wzpkX0VXNEWNAcYDtr+BAX4U3YVZWDTytZYxapJn4A o5TEipYYX4QQP8GRWhP2moJGdFQdI7TUhN1nLI236cMahVDPh5FVthqIAl2F9XuA1DHHRFtOURED TENvGINpIH6GS3oDNfgwfEzJ4rCQFeK7uAFnEDA5Bq70YinnFFK4+LnZ/EiahqSBd0EiZLVELQsC e/PNnkiS4rAgwCjP9y4kr0aw5MOAVATw1IK8RtsCFCAVw6comIBUM5ym2M4ocBIgFdnN4CRYdWFe T6SDi3bnPq4KkGoNHOhFoASkdKIgiCRw0pSgby2hviTQgx46FpvXCDGYkY0EQ8pdeUEcNNEmbRtA SjO27pJnR1lvGrILUjGNWCUIRemeTfeAJtYY1eriE7IpML7WWyvIBXkSIKWI8YEeQsMQevqNl1q/ CK5Z7KVPxXNtuhNcg+d0IWQXaEyPGijU3hlRIGUQIAdgVdDss82moWqNVkHpOQiu7fUkb3vHminq 8WyXhq2glimGCkMKunRg0V9Gs6kCqSoc8VubSUAqBZoUNRKQipmFuB8paNCNhmUmNEW86fmseBCS IuteBVKJZ22ep1m/TDRMMpPfkTBTEcsa4dVWfcZoHp7Ql6dJqNBAiB8skSKAVCC5WlddBVI18Yks aCYgFQWJwO7GGLFaS0bdCxgG1vFMcFFbeCW1myolu5F37KkW9KtAKmhiVQ+hsUDDaOoOKQEFQw6L vfSCBpcSAPTgfaAKZX7l61dTvQT/9rdvpl7OFslj62eBzhhD41bKhMVxgiDT0FVEW4Ib/HhZEQUV t0giVo5TlyqMoKp9W/SCkVbRfjEWBf1VMFaOEwRUIjJVhBH9FigUiaE8H2bWnqcz9fgwARmdQozR cRjJg6YPY8lEf9WHic+HSWeYBEiRBZHTTzsNP8QkVPSCgTACSEWKJdEPW1SBVNyp+nAtIRfik0In inOCkyIUHunh8Dc/EpCqepTgY7gCy1aVw8FwDvmxi4JN8QEp398Qszq75DWmIZ30gKQ+7/LUTGiI zxlAZyhHMBSF+JWbLm4Z+KbahBOQiqqjycfgNnXY0Z2H+KTYfvvtegJRbzslPk9IrqJ4FUjVGpR/ JiAVKBNlUt94ww34rPXracwTTTiA1OOfpLrDSTiG+TLyVn0YBnI/FndijJa0ShjFP6ecYgq+KptO Xch6LQGppHlOyCg1H95wgw3Yve7Dn4QpPoxbgnODaFDhGJwEPIqWGKr4GEjdfXcSPxqpHF404eRR Zk7T4gHK/xhI9a5ibOnDAaSq/uM3WapAKp6S2urGat46lJlCKCarQKppxCqQ8pRaCpDqE04wmMkC nxhow5pWdS4s1qNxQXDbkF1w1F/qCYIWiCAQ9yxPfvBB7ijkxZQKU4E4PtATF6QrETGE0sfrDOLj O/DIsEkElDhBWRHek1JHhkEWuOlZ3Xf5J/vFQiUgLz6bEs3d9xTDGnzwY5qvZw31gQe6bwANRUlo ZW7IKZuKVdAtrbvXXNN2WZH60vA0IbJTDhevwTv/FFX7uf0BAaU6JAX1fOwCrAgrrCNeiwg0L5iq iPcHttCkxYLIuNKhjLHRA4+nZzdlqmOgFnGTokx7937V+GE1dEaMi6k61GoDYgXJa0YPPAIlIyZG FeirLjgJlEBXRtXRLanC+7HYnIqibUfHQBxCvfHG6yr1mtVguCKp10zXylN6Exve7F2T8TaR1fvA A/dbJgLcx6MQn1vGZgQRIFDTewF21d4oxMeMEbmkd1N8dGhPb2FdURK/p8M+/XS2czMmdPihK/zK U4sYjERpLJYSaz49OfxXX41+CCc9UwMrrWTgwT1CfCoSi43y2SWma72JbRn4gJJSrdCbl2P20EUW vZ1G5DVeAdi5SVfKSnhIsfgn9rChfUlcIahrifW2sabBCFkmSUhVu4L+ys0YT//ylz2DdSMWzola OJW/3lFpGJE5JNuioH9Kg0Fg8TJMQHx6Iz467ssmhq7cqfowl8YbuENpTCkl1pcPiwYW9nIqdSUf llwRHBSX3qOHHhjXm0vDhnynpfdhMiz1LNSdcUbNv+nDMSvdswC54cNG5CF4eBQRiO+34GZcJDcW 4vsnaGsCKGF0XMl/aPU6yJTT8jRW9RkHUgtVUBHxqSvGQk0fJhQf9lQp3SrPSbYgF1P6p1AJYgI9 MbkW4tO/WQIFLZBhR10p03skPGpfIgApwhVJzcG4FuePxuIvu4gn0i1V8UVU4dodpORawPoQ3z8x gI0Q36X7v/qqq7R3P2opPf9k61hmkOaV0MSYWQI5sGoT9s+0uUAw3LPY/OmnGTo6/sjxtPThQOTS VHw4BSLva3Rgd0Q5f0UwrmvoTvxqICI7vRE5fJjJDIypJXwY9ExxmFeY5uOEYRpzlyIbl4gGZdKQ qwTOCNN4DcBi7oQa0feUfRkCS9GEIXWdi0fBarS+GNHVfDiM2LPYvOLDoR8XbQuMAKjXIhq7VE1p QspbP/pRUrhKhYX0ARMfljS12JyZmkZ0kxpJHUO7AqT6RFG6eYY0ftWJAiiCAmWlt00tG0GamtFD G+5YhsIACZqAXPo/pVw6IeaP316De1zsZ4LWHWUBIHaK1UUcQmRRRL0eeUG+9+KLLopMmG5VNIzL I3+150gscQKZRhWlgj5A1RiCYbLwJy0KDhOSTP02l36PaHYKEe3HSFfrigusjKRXunokfest4GCO 2We39iUBKd2n96MFasN+a5zt12wJSTjXWsJltQp/77/vPi1EII5IJBBrCYKmS6ykYdkyzUY0OeTg g6O5RkHMC0le809sCFj6RYhWX66hRjyNyx05aqNbbcbvdN87ugG1CENgNArVuSThTxjFko4HSwoK E/HxjoKeuqPX5GB+RNN1X2zFVex9FXwSlhS6YR0hGQUavZckHM6R9SbkgeGYGiDmk088EeLjh7OJ YjHu9E8AxXAc0FEjsiGIR9j2VLCTNPKjtrWPl3mRRIjBfVV80UckAjtoQH+GGX2MyEtk/ySFGJSk UAtkw9ax9QBkQwRZIhTQDLCFGe9rU4yI/6CJuKGzsqIVD5fXie3+PRIcqYuSxXpRHoZL81a9HfYb orlUmW7YoEWpZH0MQDaaFQrQMysQOYb+/lKmjEX02SjrTQECRsSSMb3tfzih18A73o7zKIhzXEmo XHLxxRAbn6SuJD7RDMqpF3HFzQdFj/KxD99/v0RZ+LBSASbAqTAi62PyYx/uxZGJLJQjNRtgwvoh 8no/9OYHn4lvl8KHuYrhGaM0fdjL+kgLFcKHU2/KTJTDoNGmCAiaQIH41AP5URXfO3IJsWeYJq8W aZLZer9mAobcdPFheIsqwtYhPpHD52MUARESPzVhXMG1kcS1SI6huZmnyJqdh5ZokvimljTDqvi0 rUencGke6Rl1RXXYOOXkk7lErDBjeqXEcFO6fggFIb7X/FPjMuykUjWSSD6YwzOcZmjUASskI5pP AA5ElRDTy3TFJ3Eb4kdz84NL0xUPwTOVpi0MiH/tNddoI9wsia8TMdaKJoymZI8mTHAFU3KXe/AZ sajqwxpX+LD7lszyrghECiLI3DH+oQRiihvD9trLj/QBrIjHKHf24cOxD0jVh2mJRAKF+D/nHHOm yUcs0QZX4TDeD62STufFY0kU4rtvYAaXaK1JCq4I8loAE9jUy1qWQGSNBClqcbilD3tHpV7W8Qng AqDXknuLYFxx772HBUvR4mjSD37S68NPG/1KOsaXzlEwjOifbnJ4ykTfy+HSZWqvNYoAazixZkzp PK+2Jsk/JWOE+F+/8443q+kWv3X8WriCigcF/wQg4jV/DQXcch8mS9WzBILpfUXUm17wo2e127vv ut9LvIdgIDDM9G628nFFUbC2vlteSunf/e63mbmo4DY+YYP5AL64NA8ttqpK0umKpA1c0EaqV08W ReKRH4KOKNYGzEng6wksk9cCiRZuraVpWsKiVqcugQzq9Y5Ly9EBU8iee+6hIN6EbGoJAKSIgsJW QBAMeMelFGAX3U+0cOgKNS+7ZDLSAk/vCIXiWhS0M5ONtdJIUTgQQ4HvYMYl+gRNBcG7aaaeOgpC 2TEBIYoJf+6IaxElUTPKjyrgJ46BgqiEyaBJaRo/Jr0sEIsXLJLEN8iOUalHancfnVAXDURwVwVo RTkfiz/11PFZTbDqL1hP+NA8baf7iiMrzCVmVB0rz3Rv3gdxAlkSLWk41vaySxKfvWK1dVD2QzgW lJMU1p+lNB61wAepRoNF3ZKIJuiTy6Ai6DC6eT13wqD+psVhFKKIzrXn0ScKgbdCZH/haQX5g6iN jiArvicj6p4xGZuSeE1nGQXVCyWHekNdIrIuJMS3fJCTuxmmxFLyYRLRqptqiZwfMGE49F8f3ndf Y18R3zs0HPuNRQepiJt8OGoBm9CPgrY+gR1xFZ2Q7FRw1fRhK7SSLTDJ36o+TLfJh7HNi9jCcC6a g84vxKdVOAZ9itU30zDPDP1jxuAnwiCHDCWkvZoid+tNkEXL8hpvbOnDqtBANMawvv8JLPrdaKR0 gpn/it+7aocgvEWNQLPeDgXMm9rWNbopHAnaRsLhIS6tIBYphyt6WeMiSLKFxaxUSrEhl4gUEIc5 aNhNDsnnNXygKokPc6ccMJZAw9QSMVbdqoAU1oFhI9VoIBRN2F8YNBXUuKBY1DQW76srlkJHi04+ DJ6GD5vUSz7cu4z64+8W0U/W5/MwiuKMQreMJ0PGKNTrJpN97MO96mr6cLhEXKqIFA6WQI1QBYvE ZodJCkP9SJGCOPoRr8FboX9smzp3R0VahJs9cfgT+iJMNQ5zSA4fRhSHYwOLQDzaFNfqKddrMghS sjnwUABrukrxJMbkcR9uY50oSEV8OLULQsGRH0sx5ZSGTywepQqQGtF0THn//5NAijVJ6eJJtZMB wbsYBYpK/C9hTSAySsXTiIbNVV9VLfNjAVrojGFTNAaDZpebMdzx1zsCR1xaEfox9ypgpcyH19xR UGYIKfe9HJMI1UF5VPHi97/vZswS+hs3I9TixKMgnsZz6Sl+gmBctmyO4KKgVEcqiKzI5WbiKtUS VcQMnSKhrhhDx5W2EY+oYXiXHgU/kRVXMIaeIUWoK/EpS1QVPw3Kk4ajYPxN4kckCg2kS4DGRtUo UbtZ2JAiAJy/TfETP35UjahnCr25/JBjqIqPB1LTv0rJGI4RGk528cgLKfJ6P6yfpKbSVBD9KBhG Qb9qRE8F4mSUav7mpZd4So96Q1GuUDIiNBzih9TtfdgguqrSfvhwj1FolYDVgjE1/LEPv/hiSyPi LdKxib03K40rWuWnfLg3dadIvJ/E72kmL/aIH64VFon20uP5vepNRvFOpGCV8nLoKtQVPly1fvLh sH64cVyKJAH9YK+q+LECMnGFbKjC/bB+JJ5f703HJldJjIXhIveQyEbmktQhfrWlVH2eIYgQDS2J n9w7HDhcBfGUkWrZhDWcphFTE47YFYGr6sMp4vXlwykQRTY6iZ8iZDIKC33sw58EojY+7FEYndqT vFV1pRxYEj9GjPgMKSgntURRIvRsEYebaA7Xh8NYVR+OoJpcMQJ+CmL0EBqIy2shrL81H06MxQsR hD+W4rnnwrsKkCqoaAhoQCYjJl9Snjx8153U0XJx/0xXvBmlXLUmlAq2LFVtbIlgqiieBkCsVZcK JvbihRQQmwUTYzVxqm8mqZM4VcFT2OqLn6AcV02KjsXvS5CmFKmKUEJVhJpdIk5VpajqrVY2CTJc Dbe0fqqlWkXTW5qqS3ZvumJLJdck8k7Xfbi9N7axfgc+3Eb8KuRtqjcV7KslNq1fVVStQfWnMQ7X FWviVxmLNlVVXfhJx+IHwTbtt734LY1Ya1m1KmqBpdn8+xK/jd5ahrsqb7UIU1NXS/H7I0XHPtym YPtY1DR9iu1NKWLBSclIDQEkMYqzKIkVy0XLVTRQNFA0UDRQNDB4NCApVYDUKA5Rhob4gFRM7Zer aKBooGigaKBoYPBoQLJKKq5kpIYGmBiVuYzj+cpVNFA0UDRQNFA0MNg00JVPuLrexf8/V9eJFoJF A0UDRQNFA0UDRQNFA6OCBgqQGhWsXGQsGigaKBooGigaKBoYEA0UIDUgai1Eiwa6qwE7XKSTqrtL uVArGigaKBooGsjRQAFSOdorZT+lAZ29CWxXbGRlv3W/42idji/rCoNmXF1ZZlhjLFWRiVSS+FUl dCx4raB9IO2XnU+NaZIyMVxVb6b4odWwfvqdaf2QF2OJ59rxRx0opMpeIpspe83zcZX03DzyvP88 J8HD7asa7j+R2ptVB+iW+FXegmZ37d5F8UMb1SZPyZnWTxpOslNyjt2DYHIq3FZjS8dNoOmTNQfr 2KmSZ1ZjS8fUauInmmrpWPZMZoZbvACp4aqovNAvDXBxpyWss/bajnuzv58jAu2fayNmu9Pam6pf JFq95CQBe1I7l8P5Erb/tolwx6SioH2WHeqCsZ133jmOL3RYhO2M7aZtK+2OiQt2DpHAIfGdCGYD bjujdkwtFaTVCPS4tcF3/M6JJvbod/IG8WnVGXa247OXsVNBaMBu1x0zLNCjRnaC29LGSThRhQ3T a5vHjmgVhMWYbehdNra2R1+O+Gq3a/YWW2zBUqjZGxpZ3uVwvRFlLL3PIvbQJ7sdycke9/1wTI2b zufpuE91hAC78Hy70iNiy3IEkfUFeMfc2pvH1uEfi7/WWsRHPx1y1RlZXZ0j21jc/u9hKXvEZ9od J7b5DvEFAVXsv//+qnCci63JO+MzSvEfu0dye3w6/8eO3o4EyCEYZUU5foWmHfztIMNYHds9CApH ghLx+Xw4WASWdCbsiPJsQ057jvN5xwEFNtWyaNj16KPfG1Fq6X3HoDlhKdp7WJ9u9QWZg14bqWNV Iw2aiIsqH7z/fsd8DmjBAqQGVL2jEHHhydmujt3YfffdNXUbsjsWw2ntzu1qv5d6ex353hUFLdMZ F37YEzlTp+K7Yy4w5kSRGDc7GMGBEvPNN58DLjomTny9nYNfnJ/gbBYRqnokUcdkneoQfYkDFpzQ 4oeAZf/fjgnCjs7rcFa8IzjYywlL4rUY7eQ7vUvHZAVNx6qQ3YmWdtBwBMeEE04omDoLIqc7oVUQ x+kfjoB1Scs5+yLTB2yUTJmO9wL0nVKHJiCl4+8Ynyno9CFnWejtjB9Ch344P8dJ6rffflvHPYoe 1PkhYK69sBGhTMdoOC/IYKBjSzmUwxkvHFWv7xQzWgWq0OxYfJwwseP/JptsMtYPSzkUZZ999v7n P//RMZ8KspTTnPT99jFSBbijCsOVpOTOiNu33ejOyTP4BHOd/cJROyOVSkFRXMg5LWgKL19ZdlnH vwB/OWRZypkzgKPTJhyX7hgVp7YDlx2f36qxO1LTKTGPPfZomNuG48557D3N5r/n244oz8K7yDzJ JJMwelifeldYfvnMrKRTCx2FZNQXNE8++WTNFhYcUfY+m/cLkPps9DxK1GJobkgKT4S0AIpI3fH4 qaoyQyhnQuXE+io1WMpw5xvf+EYMmgEIXbXzzvKNBD5CJI5QyCcVFJyPIS7r7MVlcAc21QXaSSWH vl1hnG8F7kAkQr8e2gnzNJCpXnHT8YKiv07FoNw5d5mRlIxOad1pp52SPntx1XUO5AKvO9aA7tnB dgDl7bfdZsTPafWj0H+O+MpK6gDQ0l3BmB/+6STmHLLoODbx+OOPD5p6LKe/0XDHsisY51jzfAjV GXnYg/+0hUw+DRvmn39+qejgTZ8tJYPzzFkziVg+HzTxzHBgUI74ysKjRmWB70FVDVZ4yaTpoEaH 6EU+EsyFV5w9lwmkkHJ4szEJHeKQl2qzmXw6XA8SFf20ehZ36h8vzUcnEkVCikNpsYesMRV8ltn8 0dloo40Md4OmAwSNJJODZeqh68ULkOq6SkddglqOcy4BKX7vAqQcXGo4la8RB8IbjWXG+iobQpLR s/GooZhTeHV4+UyioHt2xu3TTz3VFWqJyP33369bOmD//fN7ETTFTQBXVyfe6UVYTY7KIDJTvf/4 +98NoKFSxoL2YMp8JThDuobwgAkh27n3HRN31Nfss80mqyHDsdqqq+pQpY7MTWSKz/S8PWE+P/wz 5o5zrj332AMciQZFpYBUjuw4MWCgQLhH0hSO1KFqWeBapvgaFLJwSRJWHOBdmWBC1hCQCvEBKViN +XL0qSzIC0jFghtXnF2YSTMBqaCpccEoHWcigxl05GMgCTlj6KcrI1JkRTzw9IorrnjooYe23mor h9llyq64UO9QYVOuoj3AJ4EqtmR6FO0ZOsa8wWmnnWbUZx42H0rmC9uSQgFSA6TYUZEsjzdLYjJb +HOZznfCvDFQvi66DqSwJNjBUo5zz1kbVBNtIIDUnXfeaeZR/3HvvffCfPmBD5AyjynXJQ9x1JFH XnnllfqqLgCp3nwJBxh77LFlpP7617/m211QFvSrETl606eefLJj4jok8yM6+ASkqPSRRx7pmGAU RFCHZ3zPr3SrUK9/Zg7KkWUj8kaD2nLLLc3vZGakLN277trrMJaAFGiVn45tAinLGc1LZgIpmUIj kxDfXKSp0px57bCUvJFhiQU3QdYCrEzTK87bpXnA8aBp4jgTRQWQ0ioNTSeddFIT+l1ZcxmSmtGD noW+Rx5+OF92FAT5WWedVQJJ85933nm7sqqBAs3jy2yxu3UC+QC6K5L2RaQAqQFV76hFPICUNQ26 E5ewYslU14GURPell16aM6mfrGIaXpjOWcLVHkiR3aycVE2OH1jJZIYrKFxzzdX5SSlASuoIdLCE E2Ux2vRBV4CUDMTGG28M9VoXbMFEfj5mIIBUskUCUjnWqZYFJmaZZRYI9bXXXpOO6sro2Yy2SaJo UHo+y5sygVRiOAGprog/QEDKHJnsUYjvwwUL0fL9n7xW60OoQRbof/TRR/OVIPpZxxM099l7b2uw Mqc1ASmz2BrpkUccYRGbK3OVfVVGc/qIZyaNEsEAUmKI5h/5znx9AlKoWR3rO4ZJJp44fwCZz1Ib CgVIDah6Ry3iMbVnHirEHqCpPWNcHbY8Tb5yDUaRyv+8KHFSy0iZNRBf/pixNDhfxiYFQGrBBRc0 Q2RBGzVKHHYHSP3978g++2zPCh5rmCyL9oVgJv8DMbU3cECKvEYOzlU1tcHu+eJjNab2gudYI5U5 tfeZAamY2sscpcTUXvBsZrMrU3vGYObdEoaAz6wSy4QUMlIWBaZI4hsRY5XMbFxM7SFLdvTnmGOO bmFoBAEpObn8tFkK9ab2BHzp3nPPPTdT8KCZpvbgUYvZ0+rDzJAyQMULkBogxY6KZGOxeRVIxVqc fF3oS9J6WItaIpWST9bGB1LHmbG+ygZSPZ+/fbLYXHJCorsrmYl8YRMFqw2MGi06Nta3OAyQEqzN Hmb2JbHYPAaOv//97w444ADhL3Nu6+GHHza1J3GYYivM5/OonO//kx4s44hFQt3Srd7u6KOPtkuF CwTsyuSm9EYNSHVraG7FSSw274r4tcXmUhTWXVkql5mV2WWXXXTMCUhZbJ4/tXfXXXeZIU3LIiU8 8oEUAOHrPzOGsTTwoW4AKXQsNg8gBZpwquOPPy5nK5mqocFTuu2W9Ynfu9j8113xpSCCt7TYvItk B4hUAVIDpNhRjiy/9zmMqQddshalFznh+OPHG2886wRz1h3r9U844QSLLXxqpEdx6at8B5sJpD78 8EPrGLbZeuvJJ5/cVFT+0kjiG+ZatmxBgxR3sGqhdLemeLroT1bwmCSyPuz0006zWkJHYiYuvo7p +NJfokB2i1oCOsvK+CLazGYOlgqnEvENoJHSp5qIyfxoEW+6ebs/CNO+tDIFafK0Y8FrBfkV55xu uum6sjRYBgI2leW1iBvgs7SLu9JwZq7LDJHPC0zB+xLe52D5E1vGNj5Qt6WImbjwfMOenA20QqtW blnMZ3LHt1qquOyyy2zbAZ/l7P6ArNBhrZVFQmTHqrZg9WGmA/B560EtYQyaEJVZ6UwQaRTh+3+7 n8hxYs/nESaOTfVmYikJOZjMllR0i9X8tUfCO3eaYIIJ4gtTay5zmnwyBKNI61pvjqbW2pUGlWnl NsULkBo43Y5alPV5lltaD+vS8rV2EQqoErBypsyffPJJOxDaQlCW2wA6Lgn/CC4dX74uieXwW225 lX0UDZ0zB2f6OdEEKSIjG3zqqqG0Lma8Opa3VhAWseQiAK6pIobLFF8/J96RnVYD6Ah8uny7dGaK jzHzj3qp0UYb7Ytf/KJ01IUXXpiZ5rQBhD7PCowtt9iSmfTQ3VKsPX50dXSb2dsFP0Akt3fpU/XK PRreckszMpnTHDCuBkV8y3iJn4mh8SlfAjqwPocPzwfTM+2OrEVszLTZppsJAqrw5ZoqjFIyl11D pRYwyWwJLFi1B1im82OVuaW1+DzQj6YBVc72aWH9q6+6qkf8zTazQsA/zRvSgN1AMp0fNQHKOm6U xav8NRLWMwjyTBP67IrpySv3zD95KZpYffuTrW671VS7S6cAqe7qc5SmJh7BE2muJH5nTp0kmola Ps0wUpVgfiStEawSH5w+kewSH2znM9k0d7cs5et0OTN9v+hvMk5gzdlHaoCsnxTYLakRTM4fBupK gxog8WvNM7PVB5MDJH44fI14V/y/uzZqctgV16pF1O62/a5wWLN+F2nmW7kvCgVIDZxuC+WigaKB LmhAvtA5g3E8Tv4hOV1gqJAoGigaKBqoaKAAqeIORQNFA4NaA2ZJMpebDGrxCnNFA0UDQ1wDBUgN cQN2m32dlsn4chUNFA0UDRQNFA0MNg1Y2dmV6cju9pwFSHVXn0Oemm/1HV3uy45yFQ0UDRQNFA0U DQweDfjG6Be/eLsrK/C621UXINVdfQ55aoAUZ7WYt1xFA0UDRQNFA0UDg0cDIJ095AqQGhCc4Ttb +rUfhu9CU9LPrhu+87TrYFw+/HnxxRdrWyNaeOHcJQXtrNPMFtqtBAWfCje/47VPhrQNmr53rRn1 7bffdoiBTfNUahsY9IfW8o4CpAZP1CicFA0UDRQNFA0kDRQg1Q5CwZg2BrTrmh0+oJC4Xnn5Zdu9 BEyBimz74eZrr71qh8ZXX33VP930yMaPthvZeuutbS9mO5xU5Oabb7I9oB3n4rKTm/3inKOZ+LAx ieOv7Zts72n7c8SWd+kpAGTDRrvhbbThhk4Ltz1MemTbjO9+97u2uPDUzi4wU/WDf9tp2JrMmVAq ta+3bYRydlGKSm1S0iP8J1dfW9QAfNhuonXbrthiu59sFCBVwlbRQNFA0UDRwCDUQAFSfQIpqSCn SdgEGdaxc7+N9uOCRRwsFaDBqSNwiZuTTTaZ12zv659uAg12JXa+lf3+bbHoSIodd9ghtv296aab HMpoC2NJI3/tPePwI1gt8QFb2CjWZsG24bZLje2DU75KwklZm5WBZc52tb8q5JS2coGrFHSaErI2 8F1mmWVkoYIsfr7+9a+PPvrodspWrwt8yVwZB8M5JcCGhKEWezE7Vb6JiiwSx5gDT6qYjyqITDoa S0citM8KFiA1CMNHYalooGigaKBooACpdt23cxXWXnvtMcYYwyazji+IC1KZzYGvf/yjkj4cAHfc tH+uVV3ODPFPq/dlleyeLAMUCElyCM5w4gHsokikrFwm6ZwBJ1f0+9//Pu5I3px11lmwmhk6/3S4 h99O2QzQ4/B2+S1HkfgnIo5idbBlHD2LlFyUOwHXnKA+9thjx3FIAaTsxPrlL385nQ7WHrX05+mN N97oMAe7RSfNwGrwX7UsFOU4BcdGSpJJmKVH9oCmEEwqcvnll/enugKkSrQqGigaKBooGhiEGihA ql0nDn/YtH7MMce0qAh2sWIJMoCNnLBWm8ZygJGTIpy6FeRgKScxmbMz36egkwTkq0zw1bbn/8Fr rzm0SPYoHfoGUTlIXCpLVgkdp2TAQ842iYJqkVVyjEBALkfkyoRBV/4JZzicKw64tvjJj3HGGcep UjGh1gOkejNS0I/5ynQYeH8QTF/vxDkJ1YVWcJXt89P7HlnLtcYaa5i4XHjhhasZKdxKqrlDvVdc cUV/2ChAahCGj8JS0UDRQNFA0UABUu06cVDAMT0yUmbQLO4GXOgLUpF2qq34kYsCpJxcHeQUhB5M tEkpgUSWOskGrbjiijUEc/311zs9F8BKTMgnzTbbbOYHA0hJII011lh4CCAlF6UWx3D6jQ38KB6n juNHjkrWxw/QytlSjtZKp6i66RQLpKacckoTgubggMLMTwzUhUjiXO1QUTUjRQTTizCoxe8LLrBA FUhFKQyYpixAqoShooGigaKBooGhq4ECpIYPpMzZWcozzdRTyyrRVwIBUBE0E/+sAanIGFkbZEmT Y+Gdvjn++OPLY1WBFBjhfHuUv/e977UHUlBRX0AK2QBS6QLyzOKtvvrq1VOp1XXMMcecfvrp1s5b wmWuzXyiicv+pIKG+w6hICpiop/WSMnD/ehHPzKjZ+LP54fmHKtTewVIDd2QUTgvGigaKBooGqhq oACp4QMpySTreCzuNukWS5dclpCfeOKJ1m5HXieAVDW3FFjKPJoV37JTpvlOPfXU6tQe/AHxyNkk cKaIqT0op5aR8loUPO6445wznzJSK66wgk/+fNaXZIBjvAO1VG/GU5QjJyR1NMccc1iilHlUe5A1 KYkfWbQTTzyhiszMxJncfOD+++XYHBFPdc2tHEpGqgSjooGigaKBooGhroECpIYDpGSDYo2UXt/s XlrMZP24ZFJavdQSSAVpkGK33XYDXICb6odyUjXLL7+8zJB14okJ9CGhaaaZxhIiNy1yNxlnfjAK Su3YuUBdfkNFiyyyiIxXrC53QWYwzSILL2xCsDZtB9Kl5JnVXRZmqSJN/LVTQdtnviK0bNxODRaB 2Sur+i5QpRaIDS70TZ/lWdttt13iId7sDEjRjM0U+mp4Hnmh5dM2BeNR1wt2RhPzn3HB9uJjpi+F D7dgByot4g826xcjjmg8KT7cmQ8P3ThcgFQ7pADWBJAy+xbLj9LbPkYbd9xxraSGk0CTPfbYw8Sf BFV6AchQBMo544wzgCErxBMIi3dQgDB87lddrw0wmaqbdtppLeWWOjr44IMXW2yx9E0fILLpppti SXYHqFLc4fPBlUfWJ1nT7RM/9caVEmC+j7PtAj7BL0k1i9kt2KpBnxGFU4ij6VPBlFHDQ6rRj9de fdWHilRn9wc5tuq+VlUgdeUILjbXROX5WgZ3N+X/XC0Dn/vSg30VRLMvuNCGZjDTsmB7ZtpIgflI ZPYlhUedSdGX3tpIgYfhit9XR9tZQdTaid/W+p0ZMWrsy/ptmGlv/eEWbGPEdj78i1/01a93Jv5A WH84Ruz1jO76cHsj9rT9PvT2ifitR1/DiSd9B6Ic63cQiIYrfl8e1XE47bhgG5VmStGB3tpL0f84 XIBUn/gBpjniiCNsYWCxOeRhP6fIEsUFylgSZJGTFda2JICo7IeUNnyCjaSRFAGDzABaLNXcYMmE l7K2m6pxILEEHu24446LL774QQcd5MO9KoCzkFzK6itf+YqNAy699NKUzTJPJ/1jOTlmFlhgAVNp yy+3nDXyQdzSKMmq1VZbzf155pnHd4K+p6t9QjiiQMpaq8032+zHb70Vh0fagPSQgw9JNQY1OgQf QSgIL2364H6cQKyIdfSmTYNC+8Xv8dWeGdVhw4bRTGxIUe1RaOC+++5daqkl5f8sFKt1Np5K/i27 zDL0WQupXr7uuuss5zr88MPtEVotyOJaiK8R7VIB4NYaKmbsVSEv6G+toDftzrryyisrC7nW+gwv q0uNFs/VWJUmhLAtp9t6q62aod/LpFtiiSXuvfdeEtXEp5PFF1vMYjWM1cQXvHxi+ZVll2WLGlkv X3bZZaTw1WdTfFlYO4Cstuqqtjerie/lU045RUGuVatRdb4wWGmllYB+sjfFt0ObpsHPa0Ykvt1o 7Tom1VoTkERe3mGHHZZaailtx5tVGT0y9kDTNxZNKXCurRk84KrWo+C8J4+7yCJkaRqR1JYb0oDP b2vi+5bCxx8K0l5NfBqmZ82fzpvB3ct2LWGpO++8s5UP38e+Nk9p6cM2+LUYQMq5Jr6X+VJfPqzh 2K+OD0uKN4145plnksKyhKYRvR8+jELTiD4KVqMvZpo+jENtTYur8RlG5MNLLrGEIV/NxB71+PDi i2vjNVsEoN9ss81o1fxA04iCYUsfJm/4MDu29GGfQitosNcUX5BcacUVRdqWPmwbPP72nb59WAyv 2Tf58NJtfVh8bu3DG23Ulw8bqJPC6pGmD/vMfNVVVw0fbhrR2lkFffHT9GF6pm06b4KwFIcF/KYP i062Wmzpw/xBZOMbT7Ty4WuuuYZH6XZ/8+kIhm0eyA95o7jamQ+L5E3xDz300L58WE/RE4e33roZ iDj8rrvuSsbkwwVItcMPGpLlTRCDVBOPqYIhEME/WVRMB6Ec81JLLHmkSMTKlhABMvjpT3/SXIKN IdksIUxZRJrbZorg99xzj5NeqkvXgRKYjF1vu+02/Lju+u530+QdIhqYp+4jW/3abkTxU3rfTgp2 K9XSxP24rHyvfYKH1XXXXdd0pE0cJO3IFcU1GO+LmBNOOKEtPf3W6Vqc3oaZAFJW0MOsoG2z5dOz DJmKdBjNMKTlixeSiFRXaxiYhITG+PKXZdfQr3bP9K9S6TSb0T///PO1gOJlgMCspc5beq9aUFfK eWxOoWwTSCmoLgVtUq/2Gh7ib/jUvJsN2MukkyIlaa33IuCVV15JM/RToxnjPPDaN56iQ61v4wwm iy0E3H677Zrii8JmpW1IK37VxCcym5ICKKwVVN1TTz3FPeacY45mkl9BX2uqUe9VsxQjamt27gAX mnDQy+4z8R23314L3x6hRnzQvMZMzBdwQjljXNVwpJcBAlKQpWZE8pLaRm400OyDJZvNVitIe3RY NSINy8Uag9F5sxPyMhsRX564JiObgoPs2/Th6IN5Bd/gIU0f5ktobrH55jVmohPih7yRTzZ9GCAI H24aEe5UytfHLX0YTFRQ22n6sFATPtxEEiwVPkzSlj7s0Rqrr9E0YviwIEO3TR92lgNm4O+WPhwb KTf7YBbX3yuo864VVAVv4TMWJzR92MuwaRsf5qW64ZY+bJzQ48ONoSDNwEPhw00j4sFQWZtq6cMA ASkM7GtSMLextykRPqwt1yCIl8OHocmmD5tMoG06b2ayvQyYYtU0SNOHdQ2G9C3jML+NONzOh7fY osYMtmMihTe++P3vN5vwfvvtRwoAtOnD4nbEYVinJj7rg4mM2BwJ41NPgU9YuTmk4fA6LDLy4fDw AqQ6BhKjekEuq8+Ty0kXDBe7NqQLTHRTu/KmZpkApbFRlJKr44t++FtdK9ZUbgApU1533XWXJFaz S9BIJI0ALBGq2Xu5A0SCGsJKbVzikfyBvIK23TL/f8MNN0B+cF6toJfhEkPhZpbLm95XiuzNiRgF 1aVG9dZYVVD6EJ+4bSYzvAwHE7+ZHvOITjyin6b4yEqRIiuYNsUXmklhp9mm+HR+ww3XX3fttc2u 1Mu+wLjs0kul0GoFVcHEgizA15zB8bIghdUmNu3N5L3CiNympRHdJ0WzR/QyalSKcksj4uSaq69u DsoVfOKJx4lPlqYUpOacHOAnP6kfmO3lBx98gPi01zQiPcNJdN4U38uGWMQ3+qoVDB/2iJWb4nsa PsxDRtCHf3LjDTdc24cPwyU5Pvzccy18WCtr78NM3N6Hm0YkshQmrfblw6zfzoevu441a41RLUbC xOfDTSOGDwtNffmwGlv6sGEwAQW9Pn34iitG1Iet/OTD+Gnpw1KAXLEvH5at1Ip19k3xw4cNy5vi GzxcdeWVn6UPy4H1FYcxrxkSpGUcTj7clKJ9HIb4+4rD4cN6qJZG1MtUfbgAqVEdDw0V+QNI8Vcj AHCt6dyR/PfIAKIZMjw1cvK05Tx6FDQKaVnQSNHVckmHYauC/jYLej8KtlzRoi4FW3b5OAwpWhZ0 v734zRxA0Anxm1JECAjxW9bYlxQKJvGbBUP85og8Rm9tjNhGfAVD/DZGRLkv67c0YpKivfWbAirY xojEx2d3xcdDiN+BEXHSXvzmHJzq2vhwe/HDiH2Jn2PEluJjNflwmybc0ojDbcLdNeKA+nDLQETq Nk04+XDLCJbpwyMahwfOiC3jcPLhlr3JCAWiAqSGCpAY1fksO5u3RDnlZtFA0UDRQNHAyNVAAVKj OkAZKvKb+JOklZQqV9FA0UDRQNFA0cDg0YBZY2mtzMNCBqIvtp34/xsIuoXmENWArbB892cHh3IV DRQNFA0UDRQNDCoN+Pis+WXYSO9tC5Aa6SYoDBQNFA0UDRQNFA0UDQxVDRQgNVQtV/guGigaKBoo GigaKBoY6RooQGqkm6AwUDRQNFA0UDRQNFA0MFQ1UIDUULVc4XuU0oCNyG3bOEqJXIQtGigaKBoY EhooQGpImGkIMGkBoO0N7V1r62dbwtgC/qKLLnIgxiWXXFI7/XCEhLEtni2tHRN0xumn21XZ7oIj VLz5ss1L7c2NMdsDWlnvBd+koI9t++x1TJz4ttTDIQ3Yv9jf6lk9HZNNBXfZZZeTTzopn46lmued dx7xadXGg3bEcbbSaaedRnybJXZM33kDqJ191lnnnHOOjYwvvvjiqMK+jmmf/Y6J28aQYl0nn3wy 1+qYThT0XSr28OawGse2IHv6aafZ77Fjsr4hspkki7vSwZp+xB2POv7IyMaJjhDlnHaVRMSuswhS bDoVtAOelXUCOqmdc/Kx+Kef/tJLL3VAKhVxFJU9FTHGl8JS7F49gqIz4hySWxJfEFCFXSJVwcHa byncn7rC7fHpKFWyd2WI4ghUG6ajiU9Ktqdrx3YPEWxhGuLj1hapGpfAQgOWfvdHxuY7Nnli8bPO PNN2u7Fem4bDwWi4M5pKCe+CfLT3sL6W5fiazCXh9vDELS8NmojbQbd5BFzHbHe3YAFS3dXnqEtN s9HsnUXjdBEfqWrt2267rcMNnISV4/1PPvmkkxycnuHsBQee2FI5U8XwjTM3nFfguANoDzXgzAEF TqfRGXRMXNAUPpy0FeeuOEOjKwcE2V36TGr95jcd77Pmmmv6IWDZ3K9jPoX4jTfeuOd4kDXWgEuc 4eiMM2diTDPNNPrpjsnq55yIR3YnWmDPKW+OknDopMPCA612fOnkgEjnhLh4gjM67PXfMTUFdZwO AFlrrbUWWmghJ5M4WWy22WZzcmLHcR9icH6i00hY3z6lwZvNMNdZZx2nWxx77DEdn7apw3Poyqyz ziofqZajjzrKYRoOdMtxANCB+Fh1UqgftOrwKKf3dCw+YWGIfffdl7BOsgpLORLEeQOZSAIG5ZaO jtHfq4IvqQLnAEGOA7ARewkm+HRc/QorrOBY1RyCASZ08466R9M5lQ4x1GDxnEMWGHVm1Lzzzmvr c1hH43L8JeIJrI8ocVtALbP00kL0eeedG+a2b7i4OvvsswuzI0otvW9oKsgLKU7oC+s7ncbBNZkj KONwZ8440zZoCiyTTz65QW/HfA5owQKkBlS9oxZxHYajkYxFQmzh3slrmXhCgxeOBT7H7elLcsJ9 Mobj27T8b9/87Qj0khyOsTOazCSOGmQGk+mrMruQxKqDHcERXfK0004L7uj+XZn5A5vazT333B9+ +CFE4sgLWjXyA1Yyef7nP/4hgDrIRf8BkiIIQGfSdA6uM9oM8dFxCc3gr0FqTkrGCT/ONcPbbbfe utaaa6IpOaGWHOvzfFhE6E9pSD8uvugi/XROb4qlffbZRzcfvOmtHUIsP5cTVhTnojo/Z/Ksv/56 rI9zp6fliI8fAyd9nkN1wlL2ottkk02EghwHwNLOO+9s5BC8aVwOg3fgT474yoKnTqNnF7w5XsYB eTI9mTRFuZlmnBFSQdNGRxCPK8f0+CG1o3w5lR806bQ+m4Dn6BNNqU1nfabcM4jG8/OzR3Zmn2ee eQT8sD4NO+gwE0ihY+AUcNwlaBtRGFhmWmqAihcgNUCKHRXJajnLL7+8lGwIb1BurJM/F4PUUUcd pUfJjPVVk8iWa6XS7x/+/vd6EfQzI1QQ1z8BE08/9VS3zE9knTToQ/ye09p/8xv/zNSDTg7AFZiM R52s/u9//UsuzUg3k+w//v53OR5zZLQqGYl+vhKOO/ZYx79XJ4mcIK7Ddupix8RxCJICOhIeq626 Kn1S7E477ZQpPmQmd5ImidTinx3PwiTpnI9rXiP+KbcnzwH7diy7gjpRSQ7cSngA5dxeMgk8zRTf iQi6UoffBW+oOY2Rd2WCCY5kLi9ohulzJmGDTgCpSBMSX1fNE3JUqiwgJbEH6ITs+nsYuuNMZNKh xJ6T5gxOttpqKzQzbRS88Z+vbbSR40dld7bbdtvrr7sun6xQb2wm1cevzEhi+Mgjj8yMqIqvu+66 rIM9Z/yBp9LGXelNMm3dsngBUgOh1VGUJiAlu+t8e8deus4991yHgWfm4UOVXQdSGqdsh1Q8JvUi mdNPyd5dB1IoGzXuvNNO5t3kjejWOVmZ7gVIiXoCE9l1VPp+M4ZdAFL/+IdUxzHHHCN5ZpojsxcJ GU868UQ5iWqg15tKSzyVMRMBlRqFs1QCUtdff/3555+fqVWMScI5mfWj3ssPnLuZSXa/ffeF+KNB gT5mIfVSOTS5vYknjCUgxVh66xyaytaAlDt33333sssumwmk6HDLLbcM8aU5Z5pppvyMlIQxXBKH ZLscdJi/nIv4kT0KmsBKZj4mQM8222wDSYOPUuY8NtNGURxAgXGNT9C84Pzz82VHU5A3ZhZPTB1o nkYp+c0fnxtttBE+OSeQar0gleZjvq7osEmkAKkBUuyoSJajG+Naz7Ro76X9zzjDDJlTe00gpYEJ pmamMlWsTRo8LbH44rq9TFJ9ASmURe3MmGJRPKAj3lGv+c2U8OuYZ0BK6uh73/uedQy+DxCtLL7u CpAynSHZIytpHc9dd92V35eYc+k6kGL36N0TkKLbTBuFLSxekeqzbtcMl/RMx2tZqpY95JCDzT1F g1p44YUt6uJRHZs+uucQPwEpsueLP0BAaq+99rJMKolvUVdKenWsBAFEr8xXg6ylVwYVHVOLgrRq Cbx1V0FTm4J3M3v9mNk0LJE/s/gMnshPcAa3HN73JdZx5rfQIPj+++8J+wI+OBXz5pn6VJyZJOQs 4RKsLA3sygcB+Vz1RaEAqYHT7ShHOab27rzzDuNdl6H/QEzt6QZEFuPdfP0CE4svvnh+2iBxUstI WcxkGkUfk8MqraZ4R/b8ESQgteCCC5odCyD1ta99rTtAqndqTxLeUh7TEALr73732xzBlbU8SJqn 2iHJHVJp5vRWcJWAVCaTqbiVW6SmXliK5+cs5Eo0JSSkY6NBcSTu2hXZ0U9AqiviN4GUlTddmdqz zjrEN3Zi+vypPXR8DRM0XbCa7yQylaCF+mbFKq6g2ZVpTW7vsxhrN0N2AMV8XCafqbiP9Sy6ypx9 S9RM7ZnIFvANIWTmupI8i6k96VL5LaxKzHdL9oGgU4DUQGh1FKVZW2xuylx+oisZKRNG+++/f3So YpbxmVCVr+UnHn9crM/ZnaHGg5DXs9j8k3j32muvyUxkAql8MWsUTO4YO/pOB+q1XgSQ8vWySYTM ATSQJ2USS6GZ3jeGqsiM1EbhBuXpIzUc6kdlPfPTEpi89dZbfbqYD0yTekV8OQnY1BJm83Fd2f/C upD0TRlHtUYqc7F54tYSfh1VptETtbTYPO7oSr913nn5OQ8fhVhsHjRjVjd/as8YTNIoLVsGVS3o ydSD7CMkYXVg5PZ8XGytZOa0JjqmIE0XhuzWIdx00435NEOZ9tHYaccdM5tnsr7F5rFGCsFujUtZ RGuyRirE7xarXQ+nQbAAqQFS7KhIVg9t2GQEaUoL3DEknXrqqX25nTNxYFiv57CUx1f6friMyOGA zIyUlqlLPu/cc0E9ean8r2o1e6kIO1HNNuusYl+walWHuZ7BBqRMZMAiEhLbb7c92UEo+yBIe+S4 LPF9ECQfA5MZl8f065xzzGGCIycCyj9xJxiasWK/n3CDTPSjmze4B1AWW3RRi69jjXD+RQkwH4/S p1JyZt+MH0trTRIZjn/w/vuogY8SXTSc2VeZeSG+JTKmt4BdH15kys7EjGIWhlOF51999dUAeub8 e8BxQEcQUIXPLaOKzJGPL2FtJSDTyTmxir6NtTI14NMK60Hp8/7770fTdLxpqcyJM6shV1l5Zc5v 0pD1rUNaYP75pVEzsRRqZjZJTbc0kL+GVXgHHE1BwpFkjy83M/WpuLVr9pGx3Qma3DW2qhm0VwFS g9Y0Q4wxjcdSaIthpd9lucXQVVZZRdy3/0cOkgCY0PThq0uoisvoJ3OliL7TLImOH4ezzDyzaJXZ +HXte+yxB96CYLpsU9TFNVhd8QmswiWyEbY/EOtlJkTVTCbRkTwgu6SUeRN86gYk5+xZlRkBgQbr OewoY/8bS2TMdIjUmUjCNIHcButzLZbK30Yo2YWrmzDl+V35aBFm4vaYtNer7io0LNVhDiXHE2Bc jTSJb5Ynh5qykA3YhLfk9rxLliKTrJ1jyT77bLNbbwdSb7XlVqqQk8tc0mS04yPNCCwYlvHKRGbE BPVspSHuWXWAJrfPn9g99ZRTesSfffZHHn5YFVqobVBgtcwv14ydjO4iovIBc2eZZpKMlNlN1jfU yWzywY/5VuLjkD61VqP0TD4HtHgBUgOq3lGLuBal/3DpVuESocRviCpnaC6A6u9lzl1+xIVy5mgP mMAbUvG3K6s4TeUkgolVN3PEHyAHIn4Mc9Gn4XzxkYIhwvqRgFQF06dacgTRJcsfRNz3/Y7Z0szt ZHAYHhXW78ra2BAwFh1TRSYuD2o6pOAzevqahjtWqbZTFT8TQyepQ5lxdcXuEofBJxetOlhmPlJG h8X9DVYzQXlYgbnD6EITmjlDx2RWdqHSED+UjCz6meLXImo+6MGYlp6s3xXTk5eNQvyI/znTGh23 lP4XLECq/7oqbxYNFA2MBA0Ym1rSYQ7CZbrHlQmjR4IMpcqigaKBz68GCpD6/Nq2SFY08LnQgIFp fs7sc6GJIkTRQNHAYNRAAVKD0SqFp6KBooGigaKBooGigSGhgQKkhoSZCpNFA0UDRQNFA0UDRQOD UQMFSA1GqxSeigaKBooGigaKBooGhoQGCpAaEmYqTBYNFA0UDRQNFA0UDQxGDRQgNRitUngqGiga KBooGigaKBoYEhooQGpImKkwWTRQNFA0UDRQNFA0MBg1UIDUYLRK4alooGigaKBooGigaGBIaKAA qSFhpsJk0UDRQNFA0UDRQNHAYNRAAVKD0SqFp6KBooGigaKBooGigSGhgQKkhoSZCpNFA0UDRQNF A0UDRQODUQMFSA1GqxSeigaKBooGigaKBooGhoQGCpAaEmYqTBYNFA0UDRQNFA0UDQxGDRQgNRit UngqGigaKBooGigaKBoYEhooQGpImKkwWTRQNFA0UDRQNFA0MBg1UIDUYLRK4alooGigaKBooGig aGBIaKAAqSFhpsJk0UDRQNFA0UDRQNHAYNRAAVKD0SqFp6KBooGigaKBooGigSGhgQKkhoSZCpNF A0UDRQNFA0UDRQODUQMFSA1GqxSeigaKBooGigaKBooGhoQGCpAaEmb67Jj817/+9dFHH/2lXEUD RQNFA0UDRQODTAN/+9vf/u///u+z6xH7V1MBUv3T0yjz1h/+8Icf/ehHPylX0UDRQNFA0UDRwGDS wI9//OO33377f//3fwdbh1yA1GCzyEjm549//CNn/Wm5igaKBooGigaKBgaTBoC6X/ziFwVIDQhK kOgzG/X73//+3XffranYP3/4wx8+0HtBsrWU4L///W9PH3nkEbbxu8bcb3/728cee+yll17685// XHv0j3/849VXX3300Ud//etftzTqn/70xyeeeOKhhx5i+P/85z8DIvbAEC1AajDFjcJL0UDRQNFA 0cDHGihAql23D8089dRTzz77LODyvU8uv3/wgx8ETPnd734HtXgCnXjNX/9001OABhK64/bbDz30 0N133/1//ud/Uk3Q1T333LP++uvPNddcc8455zZbb42mGdZ4wY/bb799l112WXzxxZX97ne/+89/ /jOVfeONN04++eRllllmiy22OOecc0C09EgVN95445ZbbunpUUcdpfYqVPL7mWee+da3vuXpwgsv rOxf//rXfMzzwQcfJM2AjFWCanzuuefi6SuvvNKcP/75z3/+9NNPm7PrDxuAlPcBxNr1s5/9LLXm 9MIvf/nLZhP/1a9+pew777xTLRKvVSnDtYr7mygoEpWi4E1/NRsvNJnxNEqlIukdpaosgcjpUdBM XPmRHgUnVXFCihBEQX+RrRZJZVURNaYi6VGUSldVlqr4zYJJihEVP4lQFTzxU7VIkqWNERVsY8Qk eFXGZP2mYyRZqkavWb9mvniaZEl2T6WSFC0LEi1kbxbsy4dTkaYRW7aLmixNH06sJima4pMiCvZf /FSk2jowr8lUNVaVomUTrhmxjfghSF8+XGuP/W/C0ayS3potscpStMRmE27vw1Gk2hirpqSBWiCq tf2qUZriV12rP0Zsaf0U95qtpiZ+NYLVpCBI1ZojJEX7ONz04WhTYeV42pcPtwlEfflwVQlJ/IjD anSnZKRadOU6/kMOOWSiiSYab7zxpp9+eognrhlnnBEQCWD04IMPzjvvvG5OPvnkXptyyinnnWce +R4ro0855ZTddt31rLPOmmyyybxQBRn333//VFNNte2228ot/eY3v1l99dVnm222F198EUGWePjh h6ebbrrbbrvtww8/PPfcc+eYY4545AIm1l13XRAKfnrrrbfmmWeeE088MRAY1HLDDTfgDSZTEOeL LbaY4BUFkQXy5ptvXpDOBBnskr8yDhEwiJihFpDw3HPOUXXUKJHm6QorrBBPsf3aa68lLMXdIdR9 992Xcm6++eb+ACkKf/aZZ+666y4oEwyFL/2Qz7NwKuKXvwCuF+677z5V17oo/2QXBZksFUnd4euv v36HC8Xbb3/55Zeff/55Cb+goIWwVzx68IEHaA9W9ghQRu322267++67g6t7770XAz2lfvKT78HQ d9xx5x13uOkRbum/CrOAWveRvfPOO/HDalC76uId70eNtERvSRyN1ptRUKW9zHzPX2UxGRX1cHX7 7Xj6/ve/j5rrySefDHVhBksuIDs6Npf2/9prrwZNF7kMCShBQZJiz/sK9ohz551qp2ePvHDP3Xf3 VFQRnxo9QpkPx/tJfIIEMy+88ELNiDjHfzIiImFEbDeNiDIBq3YPKYKlKAi+NwGKIpjhA7UJYm8y dxTU0GoFvayUy2Cg1pcI8YQiPv4prVqQLCTyCM3HH3+8hvlCsb1S3G9cVAORLX1Ykaefeuq/Ruw1 ClVQtUdvvP76fb1uRgqVhlFe/sSBw8Thw/7j/0IHBqJexamLt2A1jF7Fgt7EJ+I9739afm9y6RD/ Y7fvbYM09tCDD4b1wxVxxaPC+n4k6/e41if8JGZoMmyhgSRm+uPDCrb04ar4XqC0aG7MZ3TX0oeT K6qXgNEuFOGZySe1RNZPTZiivBCBxZV8ONy+qjkFjbyjIOIsyLXCJ3Xt/CEFIt7IM1/sbcURiNgu CtJ5BKLUhNkuic8cIgaFBDPeZIiWPoxyWx9+M3z4iYYPk4L1o0Zu+eMf86jvUQJ+KNaPHgft1Rvv Ekuff/7jJqmg4BMFsYQ34ieQjfNqHI6yIX7yYWVrPkwzdBU0FafDCJsh/qd8+BMnRlN4jMaSehNa ffPNNz368VtvqaKlD4fCSfH445+Kw6RQsACp1l25ubP11ltvjDHG4EzyTHGJjLPOOitMo4xcEYTk 5pFHHmlV12mnnuqfbkIMPinQ92sbUBEwVAVS8kZjjjnmgQce6DWq32STTcYff3ytAkFZon323nvW WWZR0D81+7HGGgvxsJBuAFQ688wz/TaLJ7e04IILsp9/QjCbb7bZoosuGlDmmquvVvD8889PCGyl 3otjdevLAu0B/pMzS5r52te+duWVV0aN5MWbQBBPBcfll1/+73//ezy96KKLZpppJshvs003veKK K/oDpGBTWTq4FqilLghs2mmnhVyZI4Y7mpOWOdOMM0K0m2yysUpr8Qt744833tRTTy1Gp5GiZk+B 8OgMM8wwzTTTMNaRRxyx9tprS/u99957aLLLkksuqS7X8sstJ5MHRr///vt+TDThhEpNOMEEwdWE E0542WWXQcaa7nzzzYc317jjjqsgbldeeWXwNyKC5rrtNtuoS4186cILLwDH9fQxrLn22mtnn332 YGabbbYBN2UZgxmhn0NGQTD6kksu4VpuavagvIommWQSysEM3g444AB84meNNdaYdNJJPcUMloB4 0BYPnIH4/spfTt9LE+Xjjz8esiedsrD4FFNMQWMKTjP11FNMPvlSSy2liEcA9AQTTBBSh/j+Xnfd dapDGf9qUTbEV/u666xDfAX33nvvZMTgCuccOyzir9+zzDILI5K0ZkT42yiCgDhh9+qI3KObb74J qwruvPPO1YKB/AjlEa8TrKvDXAyfd955DOTpMcccY2yT3EYpPSLrk4Izh67SUxY54ogjyIIfhvDP 9IhDQgxzzz03miuuuGL1kXfogSfT3iQTT6wTwnkqSCKhhjJ7fXiTxAwKG2ywAXVN12vEMAotkQX/ hiLsrtTEE0+MbI9PTjjhCSecQNvRLj7lw8svf/bZZwsUoXDFzzjjDAXVeNppp0kwJ2YCaiyyyCIe 8YRqyiEKHnTQQSpS47XXXOOf0YkCytGUYmzJrxBnNSIgzp/9k5t55AWvcQC6Covon3Rs8TTGmcGM smusvnrVh7mxdH7VhwVJGkDQX7KvssoqBrG4CvyB/2jCmuGpp5669NJLC1B8GP8zTD89EVITFpQi 36ngrbfeqmFGuxA9DjvsMNMImKE6jrHppptGSxQGNXxN/rFHH2V6Bas+XPWo6PK1xyioiIIasl5f QUrAmwgfNR5yyMEbbrghn4y2D8Mtu+yyIQX+xXaBCJ8K+ssWSXxEBNtLL72Up/Xg7DfeMLlBpQst tFDNh+mHD4cRmz4sTlKygpRW9eHeoddrG220UUjhnQhE3scnfi688MKZZ545pNhzzz2ZctiwYbzR U9holZVXJoKnXMubYhEAiiZWGY45oqCgFHE4jAippDhsfK4TVFypSHYKksEM3/NIzygWcSfygpgU RQpKSD7MFb/xjW+kQKT5KM7BQCtK48NB7WMf7m1ZW2+9dSjhv3G4V4qIw6TQWPrTkX3G7wyKxebg C3cBeriI3zSoO9d6tdLqVB3V6IlHG200CaSamqief9eAFCtutdVWGolBA1zM6ffff/8//elPykoU Cesi3V//+hc1gly8fMcdd4xJOuMMwCUMhvISSyyhY9BO/FNx7eeyyy7FoWwQZ+I6fDFgE4Qh8p5x +um8mdcCefnmhOQIYpryE1L/p+e7+KKLE5AitXF5/BMixG0CUvCisoSl3v4DKV3LXnvtpW0Ii3p6 jZn4KAeQik6O4DoYb6q6OhbsGdM//fRXvvIVfi9Yx6MYsnzzjDNwbmykW/LPffbZR/MA9WgYENQm tS7UYk0biCAOYl6bB0y5xGabbbbrLrvgQXTjAJq9N2eZeWY9oktYNKi64IILNOZ3e9POKtphhx2k DDGgRi+vueaa4JQRHmq33HKLGplYpBYgLjj/fHbkLWrkeOK47sF9T5FVow7efTg1sNFJJ51ERsxs t9123CaAlADEo0Jd3tSvCHMo9IDIn/2MIBtvvHEwQ/zddtvty1/+MickPmFvuukmkIUP0971118P HASQ0qkIcxhmQdjITX2z2K06dIQzOFtWNSrSVesDAkhtt+22gA4O3eGxeNYP0XD062FEE9AUAjrU EjaR0vjqSisR9jvf+U4tfUItxxx9tBqpl5KroMdv/PBA6iJ+zTG0COF+5plmOvjggxMP0YUraGA6 /3zzMYogUKUZMIv11UjA8KVUyo+rrrpKE1httdVYs1aQ7dZaay2CG3jU+FQQNeLrp1Oiji10Hjp+ dzz69re/HUZBmcIRIRc6wojUL6NQnZ6Vtt3UdVE1u4cPy6oquMACCwQMJQUTsAgpjj766Kr4IRE9 M/pyyy2nLdSk4FHghebGW+JlbkBL3EyluFLwJz/+sZDFwzHDh7GHMbXMP//8l19+uejnZZ4fQAoF RtR3Yka/xS5hqfd+8xu20+QFTO9Dn5BKuJYXlIL+NXllw4fhVF21wEI5+IH+tURiIkgP1K4dAVLh wxxPKA4fBjVwFdND8hMaDn/jhNzpmmuu0ZsKFKTwz80331yleMPDm2+8wTqwCEEC1rgvFNR82H0v ix5iCwrIAlUMJzK7ryC3pyjDsJCCN2qJaqE6itKuNSgiEAQyJn40RqwCkUKEWhVU9fbbbz/66KMT P0ZuSIl4QFsbHxavWvowI/JhPCcfVh0eRAyNNwIRo+AN4uTVlHnVlVfSBiZ7pPjpT4UXAh537LGk 4DCrrrqqdkFG4gspxKfkWCkBx/PbZETYixEvvvhizh8+nOIwawpNa66xRsyNgkQ77bSjH73i/wRq l/sAiOOpS3uZZ+659bPJhxlx1113tagGw4Y6xx13HJZEFeGX0viMCOZlzqC/oEPhep111sEJakTj xrwxxAfUOBhBoiMebNegAFLgizbGKroTKFVj1gAgld/97re1vA53AaQot6ZHLbkJpLzDFXg22MtX kGWzKBipLDjj/2fvPsB1K8rz4X/2gg0FCyKINAUElSa9S28qUqVjBxEUpSOCUgUUBAULTQGlKE3A BigYexfNP4kllhQTE1M0Jrm+3z43TBZrvXuzzzv7HPbhzLrOda53r7Vm5mnzPPc8M2sGiqJa3uGw ww5Lzskl1yVJBidBJOxYr5aTB2g88j5MA5r48fWvf23HHXc44YTjKT4FeZZHPOIRLFW35Pj02OFC 9bEtwBxfkrqcC/MtQMpkXxdIsbYCpPIOUvWc6QMpvVeoQDkAYSSnn/CqXGqAlD+pacMNNkDMMccc I8J1R1Ge6u28Ic8oimQQ7KaBi9q4howI9Sv9Qd9Qid96L1fitUzz60Wchc6jZn2PU6ApkIUXRpX6 4ZWkZERl6WWegjNVkO/gowEp3gQLhmgZS2nR0+9xRXPmhvgLAUZBj9KipvnTgw46SP3yUn5nzBdq eTe+yctmSUgbVQgA71iC0AhPBEgxMGMmVQkhAjBjS2LGI2Lk9Vh1iJkYF/7VXwkzkJ+ngTia4LUx pZUCpERHr2Gf0oVG5BnwXfihDwVIsXmuH8bl7zgmo2dOPEBKTgJq8f6mm2xyXuDa8ssLbwFSSQOs t+66LIetitMJBrlEOGMYvIhABJW4VR5pRRyiozfOuYr2E9gIQTgBp6AiKi5YKoklYRv7u+yyi46c 5EpABglTHKHJ+kCK3QE9X0wv8sreJPME4BRElQG09xUHMtDc5UL9eu4ZZ5zBkAwJCogsNsyQmJ8w n0TOBJL4zW+EAcrVKHefycQCpPQgMF2OnNmTGKVgBGGkTaokz4aL2TADKc+NN9ooovPO2494O8zt T+EBVYV9zDJI7Ossl1xyib5QpJ2CzFiLwgmYBWQnAcDmWRf6xaTVVl1VglxORSQOkAJcRH0eQzqB SNXTBVIEiJfNNtvMfTkG4r2X/V//mqDA9NiwSTSEDW24dGGCJXlW7Q4tGI4W9tWsd3sBPWyY/+Fv YVY9i02iKkllNsw/J1FaeiLb4FUMWVmX8UbqTK9hkAyMnfjzXhteb71iw0WJRh0nnnhiIUbBCXy/ 1lr8D5CEVL2s9EQ/NGdoBPPppOBXKejHpz75yQxOOHMGxsiLP8Ej10TpQYRMhcfTWbjHtddau5uO JQSO4og5NkzshN+1YbQRCEmKa8YDsWFFALW3HHpozxFphTQMNRkMCRcusOZPolCQ9g0GijtFm0fc i0Z5ZuwkNdXzwxpiw/BZaRGzUSJNiYMgTpd9trf5ZptTegySqegdPRtmihhn9lwlWQGRctgrvWAl w4YJIHXXXYAU+2GiEBJzNcZAfLKqrEXfLFzED4f9NrU3GkUESMF0yUJLAHZXHdFBQQZzBaQ4F+GE 9bMGCl5j9TUSirpESAgLhMAHI+uBNlSB2DTNVqC6HunUyU2bSelOJrIYOM+oBf1G2OIizzgsOx6W MmhAjGGH6FtyXVqfcSClA7NgAYNYRFNdTj8XseLfCYo3f8mLX8zTyUzoXd2kuj5gbCFIx3frXTqA ItyNIvF0OraqdNesrnVxprpWnEtAj9+6kO4ElXKLtEaV8mSokmOQqdYPeQ2EwUOy8WCrTi50ibXK KsgF77/ffqEtdWYpqP8zms84OyHZC2rja7wvzglCmXzpFtSiYGxg54eEnAEWCcirJZ3uJifIRWoI qiMuQGr1l7wkbgj4gCN701Ka06j3xYabb76JlSZogTteRltwJGCHfW5FzMZ+fLc61cz7AFKSH8Ie MbIQwsEjeqzSM+eIwk023tiiOuRp5bOfvTlAihAInNj1ERJGeXeySbsEC/uqE0nEW0J7QKR4A0Zg nKmUgsmUoERgwAtb7WYrCRY94KC+rLOTcGbEYg/8o5wijjIILlMDnrJwvOu5bJ6jZ5AFLSVAkjaW ASwMljoV1CJUJGPhB2BKqkkOFRsWisiH79aRYyekSvuU5YcMwc033fTd73yHkJGn0VgXeiCD2CRw j5FMQkkVFBtWVbI+5JAW1Q/XEpcxmNlPYbuQSmhMhbi8JsxDrt1l0QIPccl5aw4CQANKFOHQWJeI yEfBrF5TpwEhYtRMzlwlUsW2Kz7xCZR4mR4T3XFHjCyZa2VUXi7sv2yLLVhXsWH9lyUUG+YQQnav C2OfFiyCiYQVd6d04diwuQXkyWqwYWBCREeGLgCnGjwX2KFmEZrAM0Gpy3fdi9eINEud1E/gxMWG hXk2nDdJgM93pwvxAyaQd+UVVzCGLuBGrU4H9KuQSXBuBeVkbKBgZmaZfZcYBdGZdCbC8GLErh7z EqbhirGpgXZgNSCSwHXtzAbGMAjKQIj7codS1r1PwtgPTB96MG9qQjfJeMPVdacKAtwwWdjvulN3 dBNWFBDfUyKr47rh8phftyAawHTDp66XCPtZr+Z3MLeCnD9AGRmyFliQo6B9SsmkNgkIjrhQROei bhFWkdhwRuZe48qg4Z4fjg9vQGoqIJWMFJ9C07pKXiU4ozGINbILkOLKp5ORMjgAywy5ICSoyCCS fXMKpSzXbAaHx9STeyhKc/oPShjQcIaOLwA1PGVGXUqYrwlKYxfF4WvdY/vttut9ZDceilIqGSmj 5/e+970FWc44kBJaZIN4FtbMb4rNDFe0TjIsPZ8jEIPxrp8bBJewF79DyLrrRNp2qaXgiQApgJJP z6oIrsfYImmepIh0Jyqmax7fnYw8POWVkrjSk+NV9SvkZdGGtrLQ29CZqO/58Y+RZMzqkdcgCdNb mXbJ0DktJtft/d7KZfUgVUEZILmTuCFyKAWVTf3cEBVkUY6beIg7QxjWsCCocI5qQ54/cQ35cR/d ZTpxVUFyeS3zL4kTWkkwDuUZn5F2l/0UUQnwAb5EsGgIMREgCgGpfHZalJhhpUiW5S+ggMUZXGFE 6n/TOCIKM1ZEnJOYKXGOjgx28eJNIxBjhq72UUuwQrt5PUEl2onZ4J0/hQnwzCMLKgUuZDpYQ6xF GCO97pcNCuq5UIhKMtdcQhSawSNCwzVo201lhccN1l+fx6BEUYeBFTjokYwI6KMh8I7LTp1RIpl4 k1tQuR+cA1FHvPSSFAsg5QfVZHpIhSI6xrsYKAEm1eLC0JwSMctyTjj++PIm2ZpCIi4DdB0HVfpa dOFCGGwnvcoqBBv9MQL3J/FOIIMrrwSk1Jbpj2g/iQQ3dboksbxclv8rRYwQEr6MNwTs1OnC4IQN //SntCBRhNoYJ/uJDfvhNSLq9gt3iMtUoHqGXTg2rAsHSJFbWsE46QHQZfFWWE5PnJie3m8/eu+C Y0+7SmTDUBFidFg2TAsoYfNAFSstOb9Um6EUMwAXuiin9ERPyQRUHSpRVQwMkOqOhVJnNIXmr371 bvMeVEngWW5RlKjC2DDhsGHgvmvD5BYblqc0GAg80tOJK+sve45IzYCUjGnaZcNdXWgLneJasBon UJ4yACM9BHgn9tzzw8WGe0rUiry1bjsZ+2jWeQ0GuP30rEz6u+LksRMgRZIsKh282LAJlmCvH/5w wlTCviG6QY4W/dn1w9Q9C3cUmhVTe701UvpD2YmAYkyZQ6nZ54k6R07tEXe++Cufs3lZ8H74wx9u 2jWLzQ28YDXeIVAGFjETBBCIeT3FeJ+mKV4yNqvdu5dRhVVQzJFB9OBX4kHm3SAS9EhKsdqxwdOw IAuz2p33zKMZB1L4Zbg6BosvQCoeKm5dDoDTt1LB/4svtph15SSc3q6Izp9VuiCsVUcQku7qPlHz 6X7QFB/naRbAEpfwQ5hJ9mbVbZ6q3ySj3sVbleGphvxZwvOcibufB0jFNcfP3guk9tvPD9WK96VO JEksQR7lG6j4WQyq1vvyE8lIqZnvKAXXeelLWQUJFCDlhxYLyMgEBO8QIBXagiEkEQWhnmfPupO4 Y1cBUvmzBBW/cR0gNWQfPQFSiQelYAjTYgFSxemjyhiD775XiXMWgJvajhL9T1xPfMITkh72iFvk DNXGkk3bUa4l9rQjc6wGQ/8UxKZcSxbaZ+G8SYQIFhkQgI7smlisveiifjAJqiEEXlv80JBS+W6A ChLM1CyfYZn5xALw5zzHQkYviCJJ+Is9upinWUqvBtguvl5BE0OqytcS3tETjYAzdv/CnC92Lf3N 0ldPjzrySBpHSZToCpDycpSYoOWp+gOk/Cja906yqr0YHEP15sQ3E4suatl7PhfQKC8R9gWGrNIl 7Xw3ANnEVJCkcxX2SRsvPFhwj0Y1FyDlTlf74aILpEoXdlPqiKgJEzFRYhn6d204M25hH6mxYbyg zfCydGGClWBgJLqVR3CneFye5gOOdOECpNKFXVnnZ/BcOlHpiZnTzNgp8i9a8ANVEmxAWNeGwQ4v a07WtpuRKgUjLkCqN6RJT4y4JGK7T+MW0uUBlCExeUGvZ8N0V2wY/C2TdMTbteElnvWsYsMw5dCG Mz/L+2XsRLl6xIRIl5jwirQgc2kUpF1NwEZZ/54F8rA4HCnXQA7s2eTyRLklllDQrJmZu7XWXFMp T6V/shrd/7QgF8X3smHMZqq9tAjRkmcvI5UeEfaHNoz4X/96Asmlj+CoAKniiKJHYg+Q8qPrwFHL zLDvZtcPG4f88/S28pnBsPuAVc0KINX9ag8S6sIaEzc6vPVuBOqycs1nShxcGINj4BUpQRGONSSc +DNL1D//uc+xnnwFQEnMi8kaq3kElmVlnH6V790gkrLFFO0yXAWpPI+0kpSYlVJGZryGYXo+JERw lk+5tCtrzc8mcyBWGRBX7iOl8t50JNpM5BcgNcVi87yDcpmA8qHf1DaRDTl1D6YPSGVdc/FixHj1 1Z/CPifLb1qsYDaToDLdoMNbd6J/ghGiuz5JI/CBqowdORpdjmz5Dl96G8GoX7RT+UvXXrv4LzW7 JNL17S/P2csAMeScb1KMa8s4L1RpFCyAXYzjizvW4psPOUT/R5gWWRF6mA2HIn8Ona/0ghcgrDh0 BTkdVhT/Jd2Ia09BNIpmJOI0R5MxlsoN+MzyJN3V9fIhIFN7Jabyy2CEfHuiVEKIHwguSQJExmCM 3krkTs2awLWxhNH8kH2tZG1+6uwSE1L5HSPg7lCSxAyChROsial4lJYA1KJE1GLNWBBiznYMKjdC QJVH7GHNNdYw7KZ9YocnTG4GUCIgeSzqU7NhjEnnLO9N6NUB8yW//1GV4amnxqxs2DheKWUN/fn6 sOMFXxjstdeeLE1BUtVETAUXyEAbteabc/1OEx4piJedd9pJNjo7IHhBE/lgM1NCbBiDsWHwiw1r q2QXMMtXKNiLuBkrMw8JBj+K9r2P5vIFU1TMNJKWULMMnMAQ9rWYdX6IxD7koS3uiInqOL6n8VSF uKA1Zm9CMOx7WnIGaVoNE1N7q66KzjK6KLjB04mpvSuu6M5kJT1MjCQWXUhyW9yZoX8in/8zRVsS J2r40Ac/GBtGm76TLiz0ypZ5XyA0p5OksnwkPUIPKsmODOnCmaItNhwgRS9oUGeE5kpPZLpyeLI4 Mcvy1CMvFBum054N0wsQw/EGp96ni4kEDPKIC+8ZK/Z6IsnAKHCJ13oFaZC+JL0CWLvEZImYbosR oo4NQ13WMqa/E6ywtdeeU9kwRTBR+zWwk63m2DApvXqvvcg2fYQBqJndckSfvOoqvwH3rPTSfVgO O8c1s9Sk8Qz/GfbpiIh0Wxjdb6rndYd+mJzJBM1lZjN+OJ838tg+TZAiCtbp6eJeG15xxWLDhB8b jk3Gg0G3Um69/GJsmINlPyE41kuJfIsBbbQfPwxv4cJYrmWkRgRxYIj1GFgsssgiE0vC11qLHMt7 uh/XbLhMi1bLSsLrNgVYyCrtucceK66wglGR4gYEMhP+FN3ltEzJsSHrHPVnsY1LMojJpJhpMnH9 8Y9/vPd5MUV4HDnJZJi48oxl5Y098oJ5JfjaI8ahw2iLB/fD06yuLcAuswyM1QyR1AuDeEAwO/UL +ph+CN9AabmgIqQWICUiQod5pDdaR1Im/gjBTSgQMVYo+010U1uhhjKLp89YRfHBCy4ogCDAwroT HZJ9u6+T82vwirirq5CwOYuEsayQ4FmEzEx4ySbCKPFE/tej9Hw7WSioQh0vI+CkfAy5pI5KGOOM hDq9vZfUQSeqeHx6FLNLYIuPVoQ3D5aKi6fQifDw859zKMaXZQrJO/Cf+oOAEQb6KJKC9gpiQnxl Ygyq+Cl8ddMPBfRMfEu47LJiSTerRKRZal1CmkokfqC68Khm+ZL4LI6qi4f8xvWcjNRbuxEx72hF jwiO7KG6kIrNc84+u0hSQ2IbaaOwKFEwYGO6oe5m6TGgQIBRYmAHZomXKfoBVJWCbtLp2WefhUKO j+WjJwXpEXdmft356Ec+oudmrUnMJl+n89oayhdG7isVbEEX+E3yUiI5SU0veKoL40i/pg4/4LwQ GcnISYDmuBCBJDNoXMG8INjgGmphbAr2bBhYAfViXRGjDm7Vfw/Uxu/LEumDXV1ACiqEM8rHrQpC q3hUp0VX3hfwCvtyMLgGzUne0Cuzb+GCglAikaNf6FYIY6WF/UJ8rIuQRRegsIehJ7iYYxtAg7mq godQRXSUKDAXJYrHmssH8GE/Hy16s2fDVlnwhBPpwDldOLkfK/D0ZeYkAck/JOenKmMnDqQETneS YunKTVvgl4Jlnp0QOHyeJPPmknPBBCHM9D1xGQi5SLtnw4DX0UcdpUVaBiYQkB7Kxgjc8IC5+hOC p46iWYS99jWv0YoWiUW1TCVP8SJ+4xF4oAUjGU10uzDgQneED8H3bJg8Y8OMGVQl5KJEwJEFcncS P34ws6EN40J/EbyMgjyNIyIQesmEPqMCuTLeiDuFhn2OY3ivg0v/mMRMPlXxiSHH8ssHpPqyD2GB RCkotmb1Et+ojySbHiXq+/wwLpiEyvWp4oG9Y6zChgmqZ8MaYrrcXXE7hJYdMXojk9iwEYjBQDG2 qIyLMPYQtoofdgcX3cU5lbF1BovPiowUJZWdzTnKbgoHsvEnNcQDsubuQjO/hT33GUp6VzZA1y0D ibyQvcjcp/gyE2cBOHP0ftlLPfvlRLLeFC1QomAuNp20E4wi4JWGPPIaW+yqhB/Hjk6SrRYqL/Yt nEAAcrm5DHc0kWql1rCmN+aRLsHaiojgrdyXWJbJ88Mk2tSfjwJSEJAVgnosvGgEwMRzGM43v/kN 4waLwDjEOG56kfDP7AC4CZhKAdp8jyQDZaA606mcmk6iD3PEwCfU6xKoRO582KWrZIW1Rj3yP470 Z48Sh7ycTWgUl1qLL/NUcY5Po6hSUCyPB9SWOtkGFwYDeQTciDcyeR4hHj0XnD+xrZT7nnrHvEPW auCU+kiyFMywPn0eVFXKuBDUBs9hjpLs8ZSHUhtinrPkc7rhAVWAjuE4RrrsZ3MENRORDBxZwVKi bwnn2OfiUUKDpsOwnw14wj47J2HDj7APc5SQiSp+P0pEbTbQUpAvlkXQEB+dBBthGrB6RxOUODGe efazr52TXdCEvml2wPuyZUyIio1SEp/QJn1CLyHMhmrGFeloGaSyFgURb0xCXPBHFOd/uSJ3NIpC 71jeRFnx7Fl7O1HbiiuaQ3Qx+BT0VCDHrMwiQSnIOwdBYk3kyJQiLsyUMV1w2f0AI07Z+4RMXCoX oeO41Sxys2ENsTRxSABAgFZMbYACZf9MVRlz60TZRQxf3fkjMoGcujZsyCFYijSmI71veJ0gpB5o jyRRqCFUKUUv6QjQKlF7iouJTbCe9jShNOwjmIEhjDa5lywnXeJZS2CHGEHhEuM1JMvopke0Bk4x ae0qEk0B8ekpMTA9ixK5i6xkuteGn/Mc1vX9708Q5s3YMCTUtWGr4LO5onETSERc6VCahj+yp+4U Nkw1dGq+SbQuPVHGPdvqIpgV7fLKV5aeKA0jsnJxI22YmZHYWWe91ziZP88OzOn73tdxIkP/C/NZ dxFHJNVNnmlRBwcmiiNaf731qDV0BkwU9knSuNFNXSk2zFRiwxDe/9kw4d7fhhkYFbCu2DDQU2zY WvjYMDCNCx4JWClckBLMgf6khSR4WGO48A4gFTyKC5BI1wgXKKEXcE0/oEQBkdcqflhBHTN+WEGv dW0Y5o4fxpR3LDwt7BOgzBP2+Stc+AS4a8NYY8O6uSBoDKmV5CYM+1l43BRdTHwzsfrqTLRnw1la ymh1254fVqotNq8EFQtpcd5N95Z4yNXLcsFSvEYecZTdZVv6f+7rV8mB+7+3NVdPplkj5TV4BXow qnNlOZE+446uLl0U36o/c3nGZLq397kqP7JJrkp4BzlbVz7i04d5K+M2b+biJUtSZ86k4dXlkSYC FzQB1LpfWsmXgIEanIL6xUtUeafsXOVpIhZXXuo0NC/Tf2rQV90pT/mLEof8MCotj/BVstlY0JyC bnohi8rTnHckSCI37/i/t2pYACh1+uHPgnuM/EhGEf9nkJcrEi7se1o+cYqES1ve4QRLblxBUTxK QS0lcnNuGopEiVFKmuCwiNdVlJh14pEwgOJ9Tdt+VllxpWjfYqMoPVyrIc5UQfHVIzc9irjKonUt sudYl6cqd2UWTFkSVmEK+qFOSoyQI+GwjB4FIRt6DBeM3/uf+PjHzc6EHQOeoh0SDhexlvvZ8B13 TLx9+eW+/0wmqSgR2SVtqXViUUOo8k6+wy/Kos2eDWcEOEHVJz4huOZl/4slXfbZcFrJQLywjyQN lVa8gGwFQxUJezNKQQyRFmIi4dKFvSYKuvmjH/0wSiHGosSsj464RKnYMBFNx4Z19thwoAZ1FAtP omUyGy6Gmp6V3pSLnXR7Ysw41+WXXabCiV5/nw2X6chiwxGXGgi5FMQy1vJypsO6johL6UzE/9Io ohTMfGVU7AcbK4/UALjgOkpxFSWObcMoibXw2OEirjgXHcVIEIMdXYaOylOOouR7/IgZ59KFcR32 EQzwlUd+sOrCY8+GedRSp3dYSJd9cUG1bH5CHR0b/tYcG06XVyFelIojQnAwa2zG3mATNnzppUMb 9sKEH55jxrnih1XYgNRCioQWILYztZe8brmK3bPszJWU4KE/d9/0u7jI9ITu+1xD9+VuLtfLqi1P p2iiG7pKEyk4nGsbyUiI1427xBRMU5xmeYqL7qRhtxQ/kkA+slS5nx89WXXZn4z3LH/utjhN9rOO ZKjEoVKGhCnVbSVKLFcRsiawP5n2k+uaTMI92qaQsBq682uZGeyqpgi5Z13emUzCk9lw8qbdJrqE BRNMof2RNlyKYLmYyhRcJIXT6yalYOwkVPUk3DXgnvYLF6VIt6cUJY5kf2ob7lnjeF24x0ivF3dN pTAyhSMq1tLTY5eR8RzRsKdkPNZVSloZKnEKG+76ukJYeX8k+yNb6fmiri4KME3Bsdnv9fdov7A/ 7Imx+V6pboCYwoYn86gtI7UAwYmFl9QsNu95z/Znk0CTQJNAk0CTwIMrgQwsW0Zq4QUoCwrnJuYl qGGpdjUJNAk0CTQJNAnMHglkbUYDUgsKnFh46bQM35d99spqV5NAk0CTQJNAk8CskoCPz3rbN86G aD0rvtqbDYJoNDQJNAk0CTQJNAk0CTQJzK0EGpCaW4m195sEmgSaBJoEmgSaBJoE7pVAA1LNFJoE mgSaBJoEmgSaBJoExpRAA1JjCq4VaxJY0CVg5aaTuWbhys0FXbCN/iaBJoGFSgINSC1U6p6HzFoA eOWVV9iQ12XbEptEO57F3uX2TS6HGM5t83acsx+0bYhtLpeyWrErnSbctE/M3FbYfd/e3+qxOa8N 5erBhBrsNadCJ77Z/dmFdxupl+N6xiPVXnkkYP/o1OlCsA+Ax6utVyq7yec48MrLuUMwGY0jj2Dt Re4kCju52zTc5wtjV24DQOy7bCFoo8iI10bJDGy8Op2MaTd2pxVRVs5KImEVkrCNHMers5TCqRPZ 6MhRORqyL2g5fH2Mmm36jDDytKWn4gwsEnaK89gHTzkRQQ0ue9mHfbvdRsJEPQaR3SKYpfdYqROW mIENGCt7lo6vpzsRIdXaSbx7LP14BNu7CL9sqfQpm6COV1W3lKMvHAtT2K9kXM02FO3yzkTreQ/B vsvWN0OqnmXL0xxBO97FvTN4RmWndcey2TsK2cRr/8yxV4XbDzm823XdZ3oOm0KwJpwl0Dt5djya Z7xUA1IzLtKFtEJ9xnHOTrRw4oEd2MQq5wY4tM5xBHrXeEKxcbCDF5zpYe/g1KAVW9xqxelOHOJ4 1aaUjQ0dIKMDOEqi/hRMftNJxk6DcKiCY0xceHdOgl3pa4h0AFHOsUmdDpdwzAJIUVOnHS6ACU7K UT/OqQBN/Oa5auqExhzX5RSIHELnzLtHP/rRTiKDA8qR3mPUb0/kiaMwV1xRvId3HSnjFEtnoTCw MWpTBJJwOsojH/lIx/4E5ZCwg0dI2Fbg49WZUmqDm52fQ00odEKLY51qnL4Nx52xwz6FZ/Uz0dNO PdVRMw4kGRtHOszKsZvU9L5zzonN2xAc+84SsUd/DfsxAMduxlCdgaNzOZCqRvvoEYyZKCeQatXP dB3jU0MqGOEQGOfz6E2p1smMtmivqRObCCvs+wFK1lSorO3IHX7FUAvvelMl76qVh3aoaOp0QSq6 mAHP2NT6jM7JOc54cYAMg+eWhQAu2ulhYwMpnT2861A6O6D2ql12yflUdjocm9R5V7ABqXkn24Wu Zs4UvhGQ/DDk1bvE7LH7UsRnXH7ooYeKo/lTbcZPzs7kDirlyyVxHwKeA6HkZiprU1xCIsfWItL1 lz/9qYOueucwzm0r6gFJSQBQ85tgN9pwQx52buvpvg/bOXvVObWUxd9x+k5wkzyoqTNIQsCjKUHF 8XCwFABdqX3FZWVgcew7KwNAcTphZZ1OVgFwKd2hMcCE2hwrGwnXSMDJSw4+k99SIbj28p13dqxY DZBSDwjlJDIpKEeaoE1206FplakjCQM2j/eI0Skf+in7r5EqszS8YUg2uY7xa8Xp1+eee27lEEVV jDPHybv4E6jaGSM1mlLWeSYAZbTvgq2lOsauk+Vzd9in91QolQ6lGf7VGJV6VAKQpU4Aop53oERq B+SNP/G/s1kOOOCAypwcL8fayxQBc3LSX02qG21AnpE5HclKym5y1xC/7UDHVtM8LdiA1DwV78JV OSThoFZZBAdUCdWsv55/PYqPE/Xj6P2vizpyq75mIV/OwHDKLI8DVis9fpCEmTJAigdxRhWoBwHU hNLwKKUvzGNc8gAIcIJ15ehZnRyomESwYqrMR7xqpUj/+J//6XDcr3/ta07OkpCYqYFjUvqmt5zJ 6iSySiIVh3WktXAtX5KklPoRXCmBAKkSkCSNzB9V5mNkC2AptIl86DSHgub6KUjn7klGinYO6zDE h4EqedeJZDWcQ9fVzowYFcLkNQXU1GxuS8AG/irNwLDBabily796r72kk8euMxAnYLdcPIBjy2vm tfG+++67l8yW03/rgRRst+EGG3SpCpyqNAAAmvEXIHXjDTc4db6Gd2J0BPv73vc+lRhLGJybzuau ZRPHVtM8LdiA1DwV78JVOaOX1DXWl403yq+MIkV21gpIGmcW30SMkW5JUNXIV8xzmrpRvukDB87X jB1DhqgsI+UkeWsFnvnMZxqV1tep2ne/+2TwVCwx0eP/DE9rGFfW0NkShCOOOAImE6icp1tZoeLU vdZaa1l1YQLu/A98oGY82iUGHDGZtfbaa3OslfOkqRaQ4pplNeQhMqFpPUc9kIJyDjvsLWCuCT6X I3vroTkgJSEH6EDSFsZpQs6vHkhhGejZf//92QAAUW9OgNSqq64qeVxvRb0aJoDUK14pI5X7gSxm /CsbgvVlpEr3BKRqMlIgzqovfGFvmRHIYpa/Bkzgfd9995WQY06Qn75PZVJ9NbxDz5xJzdK9ka1b JrH88sub3IzxyxwLBDW8a0V/x/Ltt9/O4bNSK6VeuMoqDUjVaL+VXTAkoOdss802hozbz7mcjj72 6qguwxyKrIx5fY7PEhwdtd7126vXwljrJC44/3zeCkapT/NwT5tuuqmIIi9lysy5CjOiNtmIZz3r WUZ4FmCZQZiROtEGm2aPYFNmUjL1IgWkTDxJSlE9YOpA+BlB0mizSI5dbb311qeecgqXXSkBQMqy M8EPHDfil+sSAOqBFKrIU4ZP+HQxVFiqEk0CUpbvAGSmd4879ljzMiQ8I0CKunXPblamRqpdICUF a7bIQntgxQyazF+NaSkroJrhUqFL3zfjM/YKucIjwnR5i/dTrcBfM7k/74AUDGH5muGZFUg8ABRV I0zsd4GUxGTYpy9f8MgqjW0DJh+sMmScMX4hQIetB1LmCqw0NdpZd5119FZLphqQGltHreACI4FM 7emrIIU0r67113XrwQvnFkRnFYspCQsv6iWiQy72tKehdr311vM/bwVOVSaQMrV3yy23mDUzs1n5 UWHhUdrAmjCZM4Nmybl63tXAHRc3h+vKeB+STO3J8Anz5CAbt8wyy8h71VNrag+eUCcJiCVWoVbW CUhZbGEmDuO+LRWYP3DeeWBlZYgiQ3OvYARSXdIzWqmc2MW4pWZRFt71LEh9RoAUGQJS2267baXN RxfdqT1zmoKfjrDCCitY1e47hprMXLIybEmFLt+FWMtcqSkEW3tgqJM6XabhauQgT2Zmsze19+nr rrOkvQZMZGrPku3/mLOam9+rH5fi1NRe+jv8xPth3wiNr65J82dqz0xxjF8rMzK1x0QNSDi99ddb z9LABqQqXV8rvmBI4L//+88c/Wc/O/H1k9UMktJ61IwEacMmEcXyIwtlDPQrxaGrW69tiSUPKDy7 MnvoaPGamnHKdVoLrxJN1Lv7EGOtMTeqNvXXxKQa1qZT9r/+9CdTZnHHoukrXvEKM4Y18SmNisSW mmEf74cddpj9BSrRiUk92QgpSZWDJgC6ZKcJ2Up9oQqOtMo+eThwzZIOcG06opvsHfN6NtHIKhap KfkYCT+z2zV1lrKXX365xGEl16lND4JHP/ShDybHSQLpU1IUY299kprVtuuuu0rEpp+qeUYINptv vhi1qbayW7El08TyWyUFayhlktcih0rvt/fer6Z0cgChrBM1yVu5nQo4YiyatYZoC/skbERR01V/ +5vf3G+x+fXXb77ZZpW8o1NSM5ndtddaS+ZYst8i0Rkx/hmvpK2RmnGRLqQVcnBClO4k8Mt1+9PY cZnnPte3+jXDskhTnxRQH/vYx9Z/BwTiGIr5thbiKQ5U7kQOacsttxx7SwX8ip0WcJiFMVlmar8y hIRxiMRn5DIH6nRVfgM470yTF5aD8TUcoCOukIYBuj9hqZooJau3yy67WMWVpSHCiQF0zV4ylGL1 rrnCL33xi2hGm0D1qEc9St6rMkIDUvCZQfMnP/lJmhJWzUkJ1WPLHO9iiXifbcNQzj59AV6/4t74 4fOf+xxkZsWVeZPK8UMYVKdVR1IIMVQXTPna17y2su/LHNM4pKtC46hKYBpSoRyrA/FuCbNq5VHG 1lEpaPWeeVKO5c4774R0ad90YaUH+OlPfmJSz6RzMruakPUxpKzBUmz+szffrENJnEdNflh6VbOj ChV/5tOftvzAp6C8K+cvib7KyivX7E2FX3uG+dLCt5DGZj6JsE4O2fWzuvW6HllDA1LzSLALXbW6 qAk4gcSK46wG1fO33WYb7lXXqheHhYdqlpOvrEqqzPy93IlumbSEi0s11pdRsPPbePVj3wAU+yZ0 Vl5pJZntGZnak9ILYeoEUiv3OhqPtemU4kyl9LBvsiCBGfSxWsJIvSacWMuCd5cf6tSKuCLPYepw OlQN3zEHIWlK+5bdJH8ghLCrmn100gqQh1nw0cQWZRlJV85sAmThPTtTGEtIm4mslraMx3spJcKB Ecb3TAupvo2qrFBxMNRCmfCef0Jgfcc//bTTEIlUFaLZ5hf1pMptMADVShmqNimfygv7Vu9BuovM uRAM9lVu1WERJyJd1pkhj7OS42e9lcsEGZJkYUQar8LSavAudAvuEykoCaTqAlkrKZlaM4jiN2Ti OXwEc9o6lJpr0maVKp66eANS81S8C1flYgnXaWyapC6jN0zXzSrH+hGisKfy+u9NEIMkVXUJUy2y M9M3ts4K+7yJ+mekzxfC1OmqZ39s7h6wIEePa1e8J/ZJmAHUaJ/So5cyaULI/hzbQaMqRJb5wYyh a/QeyWCTBMI1TVUyHoMf8q7ysXkvGtQ9U7MLqTVIt2sV6VkxVFcZpTyg5UzxAtoKnTV67zZR2A+d 9apP5bCI7I782QRGWXllq6YA35rprcJ7UE4MbEYciwqLmuq9Ss+jRrzorF/RpYZ4PE3oUDPiUWus cYqyDUjNI8G2apsEmgSaBJoEFhYJ2OhIRsr3sKCJDIp8ZOVivoVFcA8JPhuQekiosTHRJNAk0CTQ JPDgSUC+BH6azVmTB082D/2WG5B66Ot4rjjMx/DtahJoEmgSaBJoEpiFEpiriDZ/Xm5Aav7IeYFp xdy2L9dsI9uuJoEmgSaBJoEmgdkjAZ9Y+ohnFqb9GpBaYCDO/CHUOkGHxPnwql1NAk0CTQJNAk0C s0cClqDZDaQBqXkCBnzG4msRH9t3v7+w2t9yPwsAc/nt+OjeR0/5FkDBkd+t+GpGqZGfiuTbH08V 7H2UpEINqTPt1n+8M09ENnml+GWsDtluV5NAk0CTQJNAk8DskQBI14DUpNHbV52W6fnYAQSBTnL5 XT5QB4DyqLxWUJEvOW3YZXcZG1dc/LGPuR9kY6M536A6STGXj1EdsNU9nBX8shuN/bIVtHeczTm6 kAiesPutb1ntDWMHvC4C06Jz2ezf6CBV+/dLe5aCAJbNl0u7fjgPdUY+Aw6qyzWEg0SXRyM3rLMr ILlNc6eQBqRmj9dolDQJNAk0CTQJFAk0IDUpioJCHCkF5dh6DtxZcYUV8u/5K65oy8TsRQEA2TzN Tf/DPTZ49cPO1MraXc1+ejZVcwSVHcycbpuPTu0ta1PE7DPrf3sDPu95z7P3dKHDbOv666+viE2o 7Zy72667ln0vsrek1rVrl/o111yznG+lRRWus8467jtay/kSdh8uh9Ir6GSMRz7ykfZ39hqEZ71R 5b4v1vqBR85zsGv2hGRWXPGaq68uqCgbwb1siy0itN132w0SKjyCXMraatzWJl0QOUWWqwGp5raa BJoEmgSaBGahBBqQmmqGyl69NkR2UAP88cX7LntMO0o2sECuxe6untgt16ouuMefbsITzuF60pOe 5HASr3kBzvja174GXgA35bgPOSGbWTtrwlxb6IBOQJNnPOMZ2YPbGUZLL700TJbcUk5Zl6yCgbQC t73znSfktAe4RC4KYc7u8KfjJp7ylKfYGj/V5lTdRz/60TN1sKg64TybZds2ukhGkqzs6G+Gcacd d7Tvc56ix6FXZfdC2+oj/qyzztpiiy2cLTCdWcIGpGah+2gkNQk0CTQJNAk0IDVVEA/+cJKa47q8 l5Mp7Qe/0gte0M2veOQkyIc97GFOWEx1lihJOz31qU+1Ptqf3/zmNxdbbLGPfuQjvSTQT3/6E+ku J3iUo6/MhTlf1llg2W4fRrOvP7CSgg50c6aV+b4Q41gG2aycSmHq0H61UmjWYyHyogsvlH9yclOW vxUgJVuGtspcVHiECB0MEgbnXP/rqNFyrAGct9yyy5anX/jCFxykUNaKgZLKOrrB2QINSDU31CTQ JNAk0CSw4EqgAampgBTA4SQdQOrOO+6AVA466CCfOJqhM3fW22L/5JNPBqTK4VCeOoLt6U9/unkr IAnMUonD3Xq7/js+Gthy1mlZzAR/LLvssuBRToHV7uMe9zgF09zxxx+nFeuf/DY7ZlrwCU94gnVR /pQDg05+8+tfw0yIPOCA/c0AyoGFPTflvR7+8IevsMIKEJ4jjXIc+lTMT/tZDusG7BxsJPOUcsT1 guc/vxw95oAn04499lGlSANSC677aJQ3CTQJNAk0CTQg9cBACnaxUsqCpKc97Wk+HCsF4ICCRXpA yjvm2s444wzY6/jjjnPy6BOf8ARLprqHrivraHcTcGBNqROQgnUAKdkaN83EAVIgUYCUFeLAUPJe gBRIVGYPSw3m1KS4rLJyPnl3sblVU6997WvNG1p9ZX7w2GOPnZHF5tq1+H399dYzSQcvlgNxG5Bq zqVJoEmgSaBJYGGQQANSDwykzJGZMjv77LOf/exnQycp4HOzj3/841ZtB6wMgZSbcldWdgNDzowE mN72trd1v2vze/fdd3cu/Y9+9KMukJoiI3XccZNmpFKDvJTlRz4GlOvqJZxAwIAzs4eWUrkcOD/t rNNUL37/+9+3gt7MnVRZabQBqYXBfTQemwSaBJoEmgQakHpgIJU1UnJCUkflM37LnuAVq5eSK3r3 u98tcQVsDasz5+WTPdN8QFUX3Ji8e9nLXrbrrrvKQpVSPtCzYv05z3mOdeVu2itBGkwKKgWtK1py ySUluvy21OmlL1172223zepyl4nIa6+9BqC5+OKLe6ugFC9Ng3e2P3jWs56VJmbqMo1otbsV6Kmw AanmXJoEmgSaBJoEFgYJNCA1FZAweWc1dIBUb9NSX+f5CG7rrbeGk6AWX9I95jGPMXFWqgNcFPH0 sssue86SS0pH9c7ctguU5JNpuO5GStnFYPHFF5fEUu1JJ53k67aSOgKzIKc999wTirKOG6iSCgpm 8r91SJtttpk7sJ2muzOPN9xwg+Xe3nFTXmqZZZaxWUMSVGNfXXCWSiw2z/qteQek2Ctp+MjRLlnD /ummR5Cl14ZPrd8HXu0uMXxqLzUFzUuOLEhQLkvQhnX+4he/UND/w4Le15yCI/2IthTU7vApChXE xciC7k/NPvlMzX6vWi+D1A/I/pAYBcO+4pOxT+YjC0aJU7M/rNOdsE9Ew2qjxKnZHyqxsD9SiVqJ 9kdyESVif4QS52h/avansuG5V+ID2jB6RrI/ng2TW7HhoaZiw5OxX2nDI3vidGx4CvbnkQ2PNJvZ acNzq8R6PzxZF57CD8+4DU/HEU2hxNKFG5CaFEgAClJBdiKQarIayWqnkvtRhgTd8cE/CLXrq14l twT0lBVC8MrnP/85GZo9dt/dtKANk/IVXvcClayFoZpCAAC+W0lEQVRkuuqqq3r3LXI6+aST5Lr2 2msv2akClfLaTTfddPDBB9tKwIInS6xKVgltVnEBcxaV77mHZnfXun2qUsrHepZGqdP97bbbzv9X X3112YxgPCxlWtOuEIFrubpASpoNXIP28giMM4nZXWweoOmjyMsvu2yIyYYkZfsDErY2f++998ZR L4AJJPJh++67r+yg2NCzfi8fc8wxBxxwAPzaC2BeBjRJ20eR6u8W5Hn1EGD39a9/vRnMXvz2MpQM 1/q/V9CbP/jBD5SyD6oaeh7cy9rS4vXXX98jFW0o3H///S1iG+IML+OO9s0X955ikEwY5Omnn/7L AfvoYYfY92lCj33EXHPNNbjwxeWQfXPZb37zm+0r67uBIfuMU0GbXAzZt/EHEzV+UGrIvp0vkCrh OlSiLzlsJmI54BCguOO+p2xvyL58LZGquUcMhSIAJehB1ZCLK664Ahc+euBVe9rHtT5ofeFP7rmn x4WXfVCiIOn1WiRhGesDDzzQrm9DtORlqwmxb+QzZJ9mmfd73vOeoQ1jmVWwDdnfoQ2zJexbjjmF DbPJIft2nsOFQeBQiWz+AW1Ynr5HKjqntmELIaa2YX18qMTYMK870oY5tNjwUImxYXqkzaESrYWY 2oZ9+zxEYMjjUSnxllsmteETTzxxDBtWp5mNoRLRINaw4e9+dyobHioR1zw/CfDGw54YG7722mtH 2fA3eIyRNkzjbJihcuwj/fAUNhw/PIkNf2YyG+b844d/ONqGL5nChl/3utfxw/ED3Q6OZZ/Aa5H/ H/ph2RN9zXKaoRK9zIbFmuKHG5CaCkjZh4m89GrShJPK/pbKJLVz9913i4i2jPJmF5d4ylCUBaG+ +53vjNy8W4cHdEyBDSmwJt0iJ/0wU4rdF2AOa6oYsfk767TKIyufdOxTTjmFq2X6Lq1/+9vfzgty UfbEOvPMM91XrRrqP9mzDYT4ytTKxeP84PvfT4v/+R//wR3wenmq/9sTq0w4inluiohmGK1891tX n3qqMUBKAmDzzTe34v6iiy7q5WzI07J3C9rsH9EbCus/XrbrlSTi0O/To9lScDkbenV7Gt+tUZk/ i/qHPd/LQqz9w/zPNroFxRKbrD75yU9W9ic/6cdgL0OQCgI9xli9vk046LRV6TCUIhV32MdpL2Bg GazxiHx6GRTso0dqE86WSe1ViwDoBPscypB9ZkNH5pdtbNYL3rigVly84x3v6BXUnMTqE5/4RGB6 CKQUhOa1qO/0NBVUZ+c2o4JhPsMd96n42gF28Uht6lRzjxjso8EHHD5xRVUPgXnZgAQXeOkpEb+4 tnEJCQwhiKECiSlIer0WSdjeaT4TIfMhkPKyzDFS6avHIyuF6ijRziZD9mmcVbANFjJUIltSJ7sa si+CWi3AGu1IN1SiEIsLUWqoRDavlLLDGExW+ouCvErP3tBmvBcbHuIhL+PuEY94BE6HNgzWYJ98 hlzEhs0PkG0vtnn5hBNOwD4U0lNihjQ0SI+02cORlMhH4QJE67WoCdbCZswbjLRhkwMKQq49TWEq NuyEicls2NMhdiEZcR3722+//Ugb1pv0qZE2zPciBmLoFaRujnrRRRcdacNkFRsWp4bsA0mkTeYk 34MgnEZsmFcf2rDVw/RLy0NHxB6KDfdsQ51C7UgbJv/MwLBGfrXXhXEhuYALaGlowzB9/DA329O+ gj7kGmnDaLvxhhvY8GqrrTacHEAqP9y14QakxkvHtFITEhBl2S4XnEuP7cpF/snAOo/k9rrLtnTR 3Dc6Ecb8EIynXvweIMVHmz3UqORTrzv58667vnL44YdzRsMxhKciDXejH/ZiiZdvvfVWYIhT6MWn uA/QE1bGbK8fetk4WBzyf6+gN72vFA81zEh5WVta1G6PVLShUPoEthtmpLyMO+wPUzJeNjwiSfIZ so8e4Bv7w5SMl4FLXMirDdnnv4Qo6NywvudMvSwWKmgX1iH7jEFwguaVGha0qy1Sh8PZOQm5rxp5 SyyNGs3/zH1Ph2lFL0vwEKmaR2akUGIUgaqhEtGPC7wM0wBG83gHlUaO5uVyFCS9Hqma+M53vs2w BYbhLGRsGPvDtOIcG76LfoHCkTbMKtiGdNfQhmW4ETPShlngFDZsEDieDcvhHfrmN9vhZQwb1k9H 2rB+HRsejiJI0kCRVIc27OViw0MlxoYNhoc27GVjkqltWA5YUrWX4dairV4ms2EDYFZqJDkyI/WA NmyUOOyJOhEb1qdG2vB1112HC7nhYUFcc7MkMLRhL8eGAd+hDRuH8xj8xtCGvRw/LBcw9MOSypPZ MLuNH57Mhifzw8WGZQGGXTg2DL8OHREYHT88zEh52WBGiyNt2Khjaj/cteEGpBokWjAkECCVVTJG Ejpkb1Lfn256NHKNlKdGTlleMyzILyg42fIa4w8FJ1tgoaAOOXKRkFK9hFPccVZ6KThcmeERChVE 7WSLhMZgP2t9JuMi7E+2NAELk3GhyNTsT7a6KOxzwUNdTM3+FEpU2xRKnIJ96puM/Sx0m2xlxmRK zNiXtCdjv96GRy50m9qGp1hfMntsOEqcbJljlDiM61no9oA2PLILj23DUeJkNuzRZF34wbLhydb5 Te2IZtaGiyOaQolT+OH5ZsOlC0/TDzcgtWDAiEZlOyJm6AfbnSaBJoEmgSaBB10CDUg1iLJgSMAi MDlqSal2NQk0CTQJNAk0CcweCZg2lWPrfdo/GyKrFWD/32ygo9EwSyRgAX6m2NrVJNAk0CTQJNAk MKsk4Lux+k+4ZjzaNiA14yJtFTYJNAk0CTQJNAk0CSwsEmhAamHRdOOzSaBJoEmgSaBJoElgxiXQ gNSMi7RV2CTQJNAk0CTQJNAksLBIoAGphUXTjc8mgZ4ErDawh80sXHDQNNUk0CTQJLAASaABqQVI WbOaVPHYSRc2+rOpt+MObdZsI0Q7sNk1buSO89NhxobItldWoY818r5WbJSXVsrJ1tOpavjOH/7w B5XYv9hukPVgQg02MESYA2RuveUW//DukI3ejvlzS6pNdCKB1OmfrfmcbjS39Yx83+aKDmUaWzvd On1Hg1kadxGsTSD9sA8qM+gd7D1XlNt8CPsuu+z4mJR4bQfq6p2nOf06nZ6JMDJkRfn2p0jYTkXT r2fkmyq0RSQdOYnBNrnsoZ539pljrxhYJEwIDgMdj1Sfkug5KrFPY9jP7vAu5x2NV2cphVmMx0rt dotIDqGyZ+n4jN+OsqkWnd3zr8Yj2IfJ6iHG0qeGB4uNUTP2v3znnamTeCsZR4Bv5Xq8s94xCBsW MYLSNydIvfVWnxbZF9D/Y9fMgaS/c/V/+tOfeCdkEy/tj12nbQ7COy9qRx7yRKomdAdNjF3tvCvY gNS8k+3CVTO/bDvgJz/pySuuuKJdcR0iscgiizj2Yacddxw78Os5zs1wcIrNiyNNrdg+2FkEK6yw Qk1HVZU9UdZYYw1EvvzlL6+EOyHM9tOOuFlqqaVWXmkl//C+8sorjzybaPqWYSflHLuROl1PfepT nZ03/RqGbwpF/JFYYkP8VVZZhavymzRq6uRMnc/loA+ndHOCO+ywwyKPX4SOmEGN97eFtFM4n/70 pzuly27jT3nKU5797GevtdZasO941NqEcJ111qF0R0/ksKlP3ydhm5WPV2dKBUZstdVW1LTlllva jtwxO2MDPhV+8pOfpHqkOpPKn0zUySSOLnnRi15kx8vxSLWdprM4VOLUqQQke1UvscQSDMzO4+PV WTqmsLfpppvGUPUpJ4SC6ZVhz571OXcl1RKp/fFrLAq1ttJ2CAxb0ptSrY5QgySifZGeUaVCh89o pUaeytK7zl5456wcd1PJu2qdeKZmHX+C1JVX1q1Q6/DEsak1oHWMD0N1Ei6QaogiBHDRNscfeyDx vve9j9vHO3+iQpbPmXAvLKp7gtzYNM94wQakZlykC2+FehRXIgBw+jCQ0+ggKjfHHpwJzw5UEYxl JopYhfyddtpJ+B+7l6YqLsmZM854Vn8ljEiF8KIDDTl63sRlFLXccsv5crjGIMQhJ644n477U6cU nRO4Bb+aOgkTmHjB85+/1HOe41hALnXFFVZwQkVNncoiT5AWTmjNKXW0L8cDSYytfXXCOs4AcQ6G H9DDzjvv7MxgI9SxVQ/vinCQmapyFCYJO52Gp65MdeBUmJcvIgc4D9xx2Jnk3NhSxbIzc5BKNQke QPnqq69OwjXsB+3JloUwNR9yyCHwSs3Z6qTK2sVRObMYv4zUGquvwW4r851SaDQFk6VaFiWyVo6g eCdHDW6zzTbkmWod7Sxyj60p6pCJjLtLhZKmDqOUQ60xfg5q1113ddBN6gSCX/yiF1Xyzhs7tdBh xoV3IBKcMlAZm308Gjtl/Ow38ToGygmANTMGeN9tt92cL6mzOz+M39P9n//851uKMAs3kSK6BqTG tp9WsC8BTtOIwWFkepQxirNL641enOPlxbm4JBUa7DpJuj6HJKDmuFNe9RWveMXYwalIAanrrruu qT1E5vjPrbfeujIjpXKndwl12De9pTbnvQulNcaHU7AMwnPWGHePTn5q7NmiQolILMiJ04KoKMW3 1kSRUq0057HHHINaZ29fddVVf/7zf9XwrqyQL6fFSqVPki9xQNib3vSmSmqFDQEJ77FSxxQa6FdK 1eFljq5zupmTHwP9YTXzkjUSoH0mqnsaPKBZfheOrASR4A6RykiVThQbq8GR4ZFSnNlc8iXwhDRS 77DRMaRx+eWX006h9tV77QWvjFFPihhB0YuJreLueCcZPr2gBkfifY899ii8gxSQBKc6Np0Kms3f fLPNiLFUQnc0VZk4ND/u0GXTxKnWaGeTTTap4V0le+65p6MwVeLY5i98/vMQP9WXNR41QpgXZRuQ mhdSXUjrZPSCkykSeMLJ5PVYJ3IU7w888MAMyuEeB4nrqPUitnxHzkBwkvQSV2YE86233npgGTAh ISEtwWHVV3viie/kU5wJKqI4+5PXrvR6RCdwShxy0xyrUa/Bbr08//if/2n2QfyQNbnpphvrGQ9J EnIyUvvuuy9EVYlLUiGsI+pb1SExA++646RhU12VQApoUKF8pFO0c/C2yFdZJ5bRJi/lfxmvACm5 3kpl6aeSmhKxzgOGIGsyB6FEMJbXhB0rCRsWJ0D9HZ15pEMJ2PVASpc3+9wFUpIfYxOvS2K/JPlS j0n5ygWIeN9rr70gaeZkvdQ3vv51Fd5zz5iT2qGK55QrqoQ4Q0EBUkAegB7jB4AEgspWeCfJM+CM czbFrwkDFUm+sdU0Tws2IDVPxbtwVa7nyHAsvvjiFjaZMpPunhEsJXwaNwuoYrOktCR8/UIBpMpm m3c3wpPx0u1lZSq1Bd8YPJmLec6SS5rgl5KprDDFuXiLA5773OeahrPyZkbqNEFguAw/SSMZ8h58 8MH1uEdV666zjiVNtA9JE2x9kg+zJ510kpVn6nze854HpYnZlRIApF74whdStwkI0wcWx8hI1QMp Yc/EEyxFU64ttthC8KsHUmY2xWkDCWBC5mBGgBQBQtLnn3++RGx9xjRAyphEf/dbz5Lrkjlg/6Zj KtdxE+CrXvUqNqBCl2wiHDD2CrliOTJSuqp6Uq1k54UXXji2XVHQqi98oVmnbg3WM1VmZfBubtQS secuvbRuBasZoVV6VE5vo402ykgMKg37OUGvZpSiE+me1i/G+C25g37qgZSZB7OuQL9ZYzBdwrsB qbGttBVcYCSg5/AdsiYiNJdnwVD9l1Bh3uyD6S3B3vBUAKiXCMdhMTjMZ224xba81VvfenglmOCe ZKQMdrlUk4YzBaQkJHgTBEshVC6ILnIDeozwEuY50MqVtqlWRgp65vVo3/QTCcxIkJaVecPrX8+Q RGUwXQqtUvsBUtIw4LhVtybOLMGZESAlaWoxOzpdN910k/xB5dwW3gEpajKzKTKZ0hUF6zNSEeAl F188I4nYAKmSkZJCgPaWXnrpJZdcUs8i2Bo8jXcox8JwFbpWWXkV30lURmgESxdZHK3vp1oZlBpN ST2usvLKw4wUZdWQinepaCASeuBXDaJqaovSuxkpuXMQzUVNRGFmduyelYwU1cT4odJKEIkSGSlA ynJYCy7XW3ddKWTupQGpsXXUCi4wEjBaEjxuvvkmFHP9VptafFo5KA/zJ5988lve8hbxXq5b/6+U CMCkW5rfkTXJ0Pn0008HU2q+sUISNwdIWQWPZQG13uuFzbJGCi6ppLBSblMX/9OcNVJ33fUVr5nY Mrk5I8ukgAnJSCIVj3fccUc4tVKwIL70SSTJU0v2nHLKKfVASiT2sR6UEzgOrlnSUTlrZo3U2972 Nry7RBSzsT41mCkgdemllwCmlYOHmAQgJQeZVfAlIyWasoGybmY828O4qWfdv+ROKrUfMqQ2rQ0v GanKbiUj5esNH/wXYRpTZfawhtoAqayRskMB1Gt7hRpUqh6g5GVbbJFlEslIgSaWckrK1mSkfv2r X7H27hqpTTfZpDJ5Jlt8ySWXWBEri8a6kpGqT0aOZ4cPWKpN7T2giNoL05WAnglJcFLch14ErMjD 109waB6GMLvnwxBrQsfeTCFscHYmtjbacENrpArIE/AkvQ4//PCagSkigTMpGSDSzFGlywu1pmB8 RSzY5yTpmk+rpqvFsd4jSd5ZpkfGiOoZgAUTRqWyUzVIWtLo0ENtK/HmzOjBZ2Yk7f4wto+mFPvT WGfj00WEsSXZCIlJQq6hE22CMdyQpdA05bstwbXGnPBu8GANUyKcnNxuu+4qdVq/FIl2KOsDH/gA 5OcLhhoiYyxEZw0faGJ2rxxw65NY9dcgiUgVHNHrVYvmsfXeNWokXXDBBdAD3lVbAyCKS5GEZu0G ZpyAy2hqxx12gH7G6kz3FqIXCXhjPL2ehGW8pLgqN2bDrDliH6yEd1dGpzWpbrTBN8svv3z2Zsun 1hD/P/3udzXsW8WBVDBaf99i880lzMCptti8RqSt7AIgAV3oiCOO4Oh9858st+URepfpbanvegas t5Xhv+ii8ZcyhAZuDryzzcnOO+1UQoiBWjasGnveUIQW87BvRgPXAGV3y4ax2b/mmmtspiLSq9OK rvqJrbEpmbog73nQQQdRECwFOnvZXCRRWCBfs6oJKM8+Uh+//HJ1GugDUvnQejxGKMXEEzo56KBS IYTWLOmtB1Icve8KrbejLGukKj/VtsD2mc98Jt6lzdAJQ0hKuZMPA2sueWIbVZjQsU0RUms+WCtk 6P5W8EhIqzBX2WCihlQf52c/IRXKI1Z+/B9KYBHzWRO8L7ecasfu8l2+dH/T2dADJG2Wc7ttt+UD KxNdIBTeLTzKpJvafMzBeiuXnWXwoBNFTSssv7ypbcvvxlaTUailgTwqy1cPNMlTzVks8daawaQx mFkC36tinN51KNPls3Yk2TJSY9tPK9iXgAhqTwEj5ngQwVUHEE5mZBzJfZiUqV8SjiqBRDTqbjyt WmTzsGOjnwzLsC+cWCugqhnp84aMCHOp01XP/jyyWuwDN9jHeJAT9kmYAdQ4U+PmsO+HOrViulAT Y2cRUEX16ERYJmIAa3ZlkUelZLBplgTUY/A0Vb/3h1RBeC87m+OdSGuAaXjUPVmpiySROiPfbKqW PMN7ruwqVClVSR1ESnSpEMH1yTP0QBLp7KFz7C7fYw37cifZQ/VJT3yST8ws66xxfXKQiERqditg YETKeus/2jWytVlD0VTlWkY80jvCcpBDjrXQxTKgqrnUENrIVoeq3KSjhpIHLNuA1AOKqL3QJNAk 0CTQJNAkMJUEzDyahbQ/GehjVYPTAkx31kPJJvQFQgINSC0QampENgk0CTQJNAnMXgnIl/gOoHJN 2Oxlr1E2pQQakGoG0iTQJNAk0CTQJNAk0CQwpgQakBpTcK1Yk0CTQJNAk0CTQJNAk0ADUs0GmgSa BJoEmgSaBJoEmgTGlEADUmMKrhVrEmgSaBJoEmgSaBJoEmhAqtlAk0CTQJNAk0CTQJNAk8CYEmhA akzBtWJNAk0CTQJNAk0CTQJNAg1INRtoEmgSaBJoEmgSaBJoEhhTAg1IjSm4VqxJoEmgSaBJoEmg SaBJoAGpZgNNAk0CTQJNAk0CTQJNAmNKoAGpMQXXijUJNAk0CTQJNAk0CTQJNCDVbKBJoEmgSaBJ oEmgSaBJYEwJNCA1puBasSaBJoEmgSaBJoEmgSaBBqSaDTQJNAk0CTQJNAk0CTQJjCmBBqTGFFwr 1iTQJNAk0CTQJNAk0CTQgFSzgSaBJoEmgSaBJoEmgSaBMSXQgNSYgmvFmgSaBJoEmgSaBJoEmgQa kGo20CTQJNAk0CTQJNAk0CQwpgQakBpTcK1Yk0CTQJNAk0CTQJNAk0ADUs0GmgSaBJoEmgSaBJoE mgTGlEADUmMK7qFa7H/+53/+q11NAk0CTQJNAk0Cs08Cf/7zn2dh8G1AahYq5cEk6Z//+Z//8i// 8q/a1STQJNAk0CTQJDCbJPD//t//+8Uvfm60/2DGyFFtNyA12zTyINMDSP3kJz+BpdrVJNAk0CTQ JNAkMHsk8NOf/vRnP/ubBqTmCUr43//9XwnI//zP//y3f/s3v7tt+POf/umffjHn+pd/+Zde8/Th 6d/+8pceDXXzH//xH7/61a/+/u///k9/+lOv4H//93//4z/+49/+7d8OW8ybf/zjH3/9619r9Pe/ /32PpHkigpmrFJBirIB/u5oEmgSaBJoEmgRmjwRAup/97GcNSI0O+IL3b3/727/7u78DPmCXXH7/ 7ne/CwoBkvLoN7/5jdf87083PVWQcO+8884PfehDJ598MmRT2oCufvSjH+23337PmXO97W1vk6Qs M6x+fOfb3z744INXWmmld7/73d/5znfAo1IWfvroRz+y+uqr77bbbtdee20XhMFVd9999z777POi F73o7LPOuueee7pQiY5/+ctfXnPNNWuttdbyyy9/xumn//u//3s9zgmqy4XxYYXaJYq8AB12X/jX f/1Xj2C76ZBRgNRf//Vf/819F7n5M92p3Cw/yqO80CvoNTfVMCzoZreLdivsttgrnkcp220rxScj ZrK2pslFqp2aiyEx4b1c3eLT5GLqFudWF0VuPV5yvyu6ybQ/hS5Gar9b52Ts9+xqOsQUbXbrnE7B kboYu2BXiT32h3U+iOx3jX86PXFs7ReDHIbe0m6vJ3a13+u8k1nUzGp/CiViZ5qOaD7Y8FBuRaTT kdsYfngKJRbJdKmawoEPLWo8JSrVgNToOA6FHHHEEcsuu+wKK6ywzDLLPK9zbbPNNn/4wx8Uu/XW Wz3Nk/yAUW679VZQ6aSTTgKVTjnllKWXXnrVVVeVKCrNgDsvfvGLd911129+85tf/epXt9hiiw03 3BC08oJGv/3tb7/kJS/58Ic//L3vfe8973nPBhtsAJClLKTyute9bo899vja1752xx13rLnmml77 r/+ayEsp+PnPf161n/rUpxQ87LDDtt9+e6guBT1VyWabbbbvvvt67fvf/z7MVwmfASDY8SMf/jAR RQIf//jHe6hIE4Ag2JcX3vCGNwQvwnDKHnvsscR10003TR9Isfsf//jH6Hf94Ac/YL7+1K9wR4C5 +cMf/jA/TAWWLqdgXhgWLO/nh/+7qS8Fcz+PVKjFAC2PvJlHLjQArylbiCxlPeoGSy94hKS/vH+a rRDZ5aL07bllPwU1XejPjwitxIMuF36Tm/8j28kKeqFQSNQRDgmkzl5Bj7vs46KQpGDeT1mNuopI vRapFlJHaj8FvVkKYiFXKdhVYjGbkUoM+6VguHNRTUgtj7xZWoycu1yUginiadQxUomloBe6XEQd pcWRNjxkvyhxJPs9Liaz4YTqKdjvKbGwH3omU6KnuLjX+O8zGDfnqgsr3lNiV/s99lXu/bRYzD4/ UgkePRomvNUZf9LtL0WkXfZTz0glxidMrf1CTM+Ge9qfvg0XRxR7G8OGI5zJbNijkUoMI8iOSLu9 fmobxnjXDwthPT9clDhSF92e2PXDPRsuPXGkEqfowsURTdaFMduA1KRxnGQ33njjRz3qUbJKf3Hf ddlllwn/EiSKSbHANJ7AN1Z1HX744f70CHAxfZZescQSS8BYXSB16aWXPuIRj5CI8hqoAVE97nGP g29UKMFz5JFHPuuZz6Q5f958882LLLLIWWedFdDzla98+bnPfe4JJ5ygoDfllpD3t3/7S49M1R1w wAHPf/7zISR/XnTRRU960pM+8YlPhDf5MBks+Oyuu+7q5remg2Ame+dLX/ziC17wApmzIhkID4wr 7yNSZwATsZZ3CCRJsgsvvJAMzz33XJD0Ix/5yHTIyGJzs5bYhE1dK6+88g033LDpppt+4xvfgE1X W201N8kHYvNjmec+95hjjiGNuBJWvuOOO6YguUFvm26yiQrVQGj3FlxmGT8Uf9/73geDKmgoo+8R cgriRRZw6623ToZJjg3SzSNQ++KLL37Vq15FAh7BrLkPZaby3XffXUYwHVjlR7ztbRpaccUVr7rq SvWEyG9961trr712ryAJFy4Y1atf/eq8gN/rr78eF5zO7bff/sIXvvB+7C+zzLve9S4FVb733nsj oBDjx0YbbTQHDk5cXjjvvPNSp+v8888nYQaPyO2227ZLjN9kiHePPvCBD9wr52VIeqJyRi7fqTY1 Q//342Lp5xpU0F28sx+vf93r8gLhf+bTn37Zy14md0tHRHTjjTeyqzx961vfakDy1sMPx0iUSMJ5 9JIXv9ib5Ix9j9R56SWXRNqu00477c1vfvMZZ5yB1OBdussjvH/mM5/ZaqutQgyCzzzzzDyiRNa4 55576qEq1JxRzUtf+tI8xfvll1++yy67IFLBCSUecUQeLb/ccvS+7bbbfvazn/35z39OTcY50Yjr wAMPfP/73/+a17wmxCi+//7759ELV1klXOgdBOvRpz/9aV0jT4868sjjjjvOeCMFvbDTTjvlETuZ sOFNNyXtmKIuH0W4eIzXv/71+hculOLlN9lkkzwi6quvvlq/w10KSnvnUWyYO/rkJz+JBS/wZmus sUaeMmDC4UYUiRIPPfTQPIrq9YsvfvGLSin7udtuk1DPUwZMEcWMFWQMjGeVVVb5whe+4GWKIDS/ J7Ph9A69lYRT53rrrUdQdOpmuMBsYf+CCy4gYTasrUAcXXi55Zbzf94vcIpdnXjiiRjXEw1K0+tz kdvXv/51g0DKpfrQWQKwmvn8EMOGb7jh+i233PLLX/7ySBvWE5nKCBt+yUsocfPNNxMmYsOXdGz4 1FNPPeSQQ4gOd4iZsOHNN0+LGME+Gw5Q8ILXwr7/qYkrFqeYE3oMZXm8FHz5y1/u/ite8YrYsILF hsmHDTOMW265JTY84VVWWSUFWS+vGBsmBAX9pkROmM13hZMu/PwVV2TGb3zjG+O7itw0WmxYz4oH w4IuGT/Mm1CHHyrXa9KcUtjXTXRwviU2nzrDhTmf0Kk4GU5hw7RMOIpEbiScgmyYb8f+l770pdiw LAnu8tRrXEpsWEFP99prrzyKH0YbJU4nkM3nd2bFYnPwhd987GMfK05DAPIo7nDcOjzg0pWIzNPD HvYw0aUnJnJfaqml9NIukNKZ+TUR0RShqbrNN99ceKDUpGrgpMMPP8ycnRZpCMbiwpLIgUh4efYd 5LTOOusstthi3/3ud/2pKlmod77znXJCCnIi8J9OEgTGTQeBqd+E2ox8qAlEfuUrX2FzhWXu5oMf /GD+RIMexWvrZkPoxmVwOv/wD//A4j/60Y9Ox7YAKaVe+9rXQqvw5XXXXceV8KdPf/rTASmSWfLZ z/70ddeBp6z/tttuI1KySjdW8JWvfKWAoYcrdeWVV9LgUs95jk4oZPIgfAe0IS/Im3NS8XpxUliA LSjCxUNJvq2xxuocjR7+3ve+V7XK6oFI8vuJT3ziFVdcoSBpEwWHDhNzTyAdjxzAVDATG4CS1Zn7 fCUzW3LJJcFffkENnKwYrG+bAPWCFkWgd7zjHe5jX+gSTcF0HRhf3kehDm9i93Of+9wOO+ygrIJK cVhvf/vbFXnWs57FRKFYNmnIWALwdtttFy4m5PDqV4PgwhIJTEwBn3EGx0TIMATPDuKgU7VHH300 j0bsYjn7JHCPxHLNoQcXHNY555yjRQKnsvXXXz9s/va3v+GPXAwDSWiGbBZffHFWTU0iMS24jxgv HH3UUU996lNFrEyva4gNY1+dpCr/in39Uc3+3HyzzTwKF2DE4x//eAEMqbyekCMMAM38NXZoXJjH vjqBSJ5dW2lRE/o7pWDfYAYxH/vYx5RSlug0547mPAVxqCMFtQtGaJEiPIU/1lt3XSRhxKP3vOfd uGCQUQcbBhBjwy42/NRFF9VDFUQ5QWkrxDBmFvWWt7xFwdE2vNRSiFSn6CiQFy4OPOAAfoPuYsZb vmzLrg0LVLw/sXgKRO5yfxtWUGoZMfS40YYbqpm08XX22Wc/85nP5KyUcmEBI2kRwe4jlT0oqGuz Dfdxh00qW3TRRbm7mDGx8xt095SnPIVwEoP9T8j32vDBB79otdVUJad+0EEHpRRnwqTPOOP0KJE1 sjdXgjqTZsMhpmvDJQzTBVOkd6mLLpBizPynmvVE3bkLpJJ74EgRv+Yaa+jyuTPHhn/7pje9SV8r NswqsAM9I0Ykxj6hYX/Cho8+SodikGzY0913u58N663pwrFh8Tg2rGBs2EBCc9zs1ltt3bVhfbPY sN56Pxve7f9sGOZAG5snNEpk7fqmPhsbhtGLDXuqm+CCyshhwobXWy827A6PpJPusfvuRYksFsjG GkdUhojRL9Bz/PHHEymX2BVpz4a5Sn7Y4hbc6WWiJN2xEw6BH/Y/X1dwGOET6bOf/WxQKbgzulA/ O9e54sHIDViMDccXYf//bPiss57xjGdw6SNtmPCxExtmohM2fM01xYZJRozAvrLWzxx11FHpwhOr ZdZck4dsQGrSOA4B0ArHyr8Tn6iv48Ei+l4PHLAzQIqh9+qiyyGQCkLiSjgCMBweorakauCeLLfK 0iJzYWxRGilPYSAmKxeldeFWf9CF3PQINqJ+cM2bjIzKzeKJMaGH14OrvMzmTAiyyOFC9emgmZHv mMf8tz/8QdKLrITSvAPnwVXXXH21OdCJp3/4w3AFFR533nnnaQIpABG+MQwyLUCq+iRRECPHil+j B57FffFbB9CoIBQgRSzcMSQBv3rBnwryvEY87gBSIA7YqufrjWQrlGoozovwoYfkYFzeN5oHU/zm Yflf3kQTiHFHDxT/JeHENiMnk7aeokqQ4PelA381JyUT168JJClikK3/eydASkGtUBAPC6rKeG2z 9dYJwBIA3HcCpxoUuf76CeeITl4SfGQ2VCyk0QXL6QIpQlYEMYLcN7/5Da3o9sjmyyAA2aBw4X9h gGswihU5jNK4J5CLrLTLxcsiFCBlXEtcRmYSJwTOjEk1zktElMvRazhHdZJVgJSnfLdsgXfSogsL 9IhrvhuK5Zu8GWLMfXPlxEIC4gpAJhCGfS9wvjABgSNSXyDMGIaC6OdA6fR3//iPuq3uGdg0Ibef //z000/HSBIAcKr6C/t+c+4YYSQeAU/kEMrVwKgwYtACf7AWrRTtf+5zt5ESRqR/eGR+XP0pKK7w vMSlU1A6/OGdkOoFFmVci3eqga3Zc+GC5JkH0GkUQZviSteGSZUemROJiQ0UV7gwtICema5xmnYN pmlNWy7siM2AFJGqQSfVdOGCJXBKAo/3hVVyYGbhQiQDHVCICzUIeNxgCnqBbdCFrkEmm226qZxW dKQgy9GnpAEKJMIL2uidrSYTqRU2z4YRLA9BgEyLxmPDqmJmtJnA6U+6CGaiJuMipJLe0Ia9hmwW oqtymJzDtttsQ4YFEqlNRoqESQ8WSRYnnZQE9F/y17moWyqO6EJAbJh2CvuIxz5ehjZM17wcF0Ru euX9bfiXOiaz8Q4EMLRhrgzXvHrPhlHChokrNozIng0z74vm6M4jNlyUCFfpUDomPKAG1eqnhQs0 YJa+aNawhMSKDbujICEHwSQhp1sBE2wP7qHEyG2OX7p+px130h8xy2sFS1GbVPeR97dhQ03sq1Nf ljbjh41Pdp3jhwlcZwmQoi9UsVUKkjTlsjJVigyjVYorftj74CyIGRs2uhCSujZM16yOLoyyRMmu DTNIxCCbDbNz/MZBqVNz6GHDoq1e4CLJ4oi4d/AuGY3Zds2KjFSAFIQkAjHNpz3taXxiybjALmWZ 0VwBKVGHicD7LFVHmlgbfvbZPZxBYUyKvxNyeouZQKX4O1Gzu4Y9hOl1b3j968F51lkWm/PjuDD4 gNj0HxhOB5ipOT5YBEoQR7kbNhcyZJsEUUiOC/PUBQT0lrfPFZAC18AakUzN6VpJ6gYYcamBLPoV wQo8xvGAVAYQYirvHD+eMVOSyd7XLQGpf/rd7yQ/hBxiFyADpHgrHRKq0JfSYoKxPz2V/NNLxdTi l5HhKYeijxn70hG/I9QpRctGb0gNARAPp0C/mtO6p+osQIpX1YeFc0GFl09GShFjboN7N4fs8+NI Vb85HS6AP4I4C5Bad911pcewgyoBI3BNGECtEaqn6ixckEm4QA+UzydyK4KE9wXsAqQMyIQHlsy/ UArHJHKLu6TNYr0vokhTUQqxnPv+9yeRgwsBmBtipYWLOOtMJRh1RLMRVDJ//icB7o/pqiGPvINC SkQqOCiolMFrpoBxagSiuBWKYm0RfkbMwSvGFXpKiMnltVtvuQWA8xsXKinTFhoiBB2HuIQHjNN+ KRhEKGYra5BNCGVFvxogGyCD6ca6YsPhIskYv9VML/4s7BOdDiswaFFM7dmw1xT0jnWKrKhIRlWI EdtEFz+6NuwRqkQF7MeGxaTYcOjxvmhK496Bhgkw6CG6ECo8JS6wwOVHKYgMdbJ8RcwwKV5yBjhi DOJTBELsTAWmoS/8lokk1kWJnsoMsWGmlVbShTGYNGGElmRqgNp555677jrrFLfghWLDfnuTLkBV iIEk6bQLpAhWNI1rYgm6T6K+i7oZpPcxzsC44viBng3nZS2a3WNXMIq2AuDyiGT0OIakLQCRyQ1t eKKJT3yCpoqPii7UVmwYDcWG58z0/UTfRK1OYfjRs2FStU4Ap5CBpqPEdBlFkIQG3RDA7fXEdDf6 wkWS1kUaHpW+gE4G+YHzzsMUP8//lEeI5FQFNV4I4pRWDL+KGISIWV0//H82/JGPGOEzRY7llXP8 sLkgUbIkwJgW58CkCZNlZmUCewA0gcUu+10bxsVkNsw9cpKlJ0ZTbJjpakJbXRv2iEy+8IXPa0iX AcLihyNVzpIE/KhcdjwvQNgsAlJyOUZgvBX9ZemSixz5AjYasDJXQIqrFWCMt8gdGmNqwDijL3IE Ggzp9IGrrrqqB3cyZSaoSDgx0J7opW2ERpYthnU/2UPeox/9aHNbakY58+I+ssyr/uI+UKuTaLpQ K5siDKMTzAILXMagIm53VnFugZTQZYiTrqW3k4NLt/G/Pm9krw9fcP75gJR3qIYQeEOdzVCv6yJj /RnX0oU+QJI6MCClX4mjHC6Pownekwom1hPM8ZWlRa8RKSDFx8fndolxBzFyJ3fcfrtQ8ZN77uHU tFK8kt7ITUzkS373O+4jMylK8Q5XX/0ptZEnIKVOXkB8dQeFBl4cU2JJj/3vfe+7stAlCHlZHNXt g4eEW4FcKUBKPJuTV/sUrU2I64ILAKlEiKzRKZc/gUiCJSLhRHAVkKQB4o6//OU7b/nsZ8khQIpR YVArWcxB3SoMusW1tSY3XH99UlnQvLg1VCLiQU8N/fhHP0qk7BKjftI2gV7iXFGi14gLwish3yM8 0lf0AsR3Mw2eqjwxmFUIn906E8AUVMPEhyO33datNiJCvBSv0Xw37KWglyMu/3enkJJ08b5BrbLD gp7CKFKA3TAfRQdNwhaGWyWUhv2MmC/+2MfgjJJKKfFbo8rCkeTTfVrYZ8NyOUNiymAg60VSYbGQ ZAdlF0ayH5iehWsphaOsufHDxTjF4OQJ8Asr+OFlKI294dR4DLNMa44NT6Q6fAsNe2XNkwq7PZFh mLVkw5FMz4YDaDKwYYTa0qJ3CsoJKEzOT6OqKnBcu3ofG1CtEa+BUB71bLgIJ9onMX47Yb48ihIV Z8PcYM+G48H4GTiywJGULTZMv1PYMCBVyO5qX09MLMBLIHvpUxi3FETnHfZEktSRccFrRYDdnsih UCLtcKocvpd7y6Tcgfl0Ou8YK3KqQTkaQufQhuOHtVj8MCBFrbwHhxDw7QWNsivjCqPT0k1wDdMY avbYTxemBUUms2EZNVhqWJCm2LAu3LXh9EQCZL3itQFtt2B6ohcakBoNJ8rUnmkavw1Q8rGei+LB EZ0wyABGkfJhJb2K9Jnh1J5M4CMf+UirTGAdl6y1OV0uI2U1ZKJK0sj4Hu7pVcjCJFp0ABbWe+Rl HV5BUbynUX3JEgF9VRFgf+WVVmIoukc9iio1+LRJuhvluQMi6MPidJlDNOKUluhyNDaQYrLa0lf5 lw032MCIJPkVfZIrBKRi1vFKI4FUNzYkeRsg5QexJHYWIKVanWqrLbfUItwjDEhIGFkGSGmXv0jW DZrMyiFqUvz2L31JT4YM9OrEAJfaLB6yuI1GhAeqx0UmOALv4lUBqZ/PCYQJgQVI8UfeZDNhX3M6 tuFp2M9oPgme4pQjDV41QCqJbnW6X4CUOziaw8SLCdBlvMsVKsjUWYsBvd8lkIcwxARIZXag5GBC AGSQOFTYL0EIO14wIixcZKV2xKUqMZWoESPT6TJogSN7QKrEjCGQ6oa3IZDK08mAlEcUMRJIpeBk QMojEhgJpErBkUAqxjYSSKUg8Q6BVB5NBqTydCSQKnWOBFJhP+CjF4RSkO5GAqmwPwRSRRd+MAzr Ba1EMSgFTYzuJGmYVpLEnhYgheViwwVIeWp8wuDpVHHGD8/BZAFSHRt+CQPOajOVyLtoSIeSxX/M Yx7zmoMOCjr0vrKWKFn9w8as6ZET4sEC7LgUKNMoevWXvASq8NTUKmlPBqRUqNqRQKoIfAik8mgy IFWeDoFUHsWGh0AqSixACtlCmNfIzaCdZLgsHi9Aihw4tHgwIjX6jSkCUgoCNITjEWdFzmyGbwdf nvzkJwttOinZcuzMPoNPQIdqrIfxPhfH0QU8jQRSxTaULX4YkOr64QyrTKpoyHgJbqNEfyoyGZAq NjwEUsWGRwKpYsNDIFUKDoGUR9wF7TcgNSmQkopnE/nYrZvjAarc33qrrczmAgcmkiwMNINQKvK+ i/XAWzowVO7PCBr0fuITniCKABmKCyGWqnFAHnkB6GbxAIHJvlRS2pXmkY9l/Wwrj0oGCJ4zs6Ab oAE9vYLiOuNm/R4xSusNLdTorZefW1CVTw67pUxXCcy5g1/rv7ppNskMTnNsIIXBTO2pGQvm1K38 SH/Wt/O5fgFS3YH7cGqP3cdrl25cgFR3kM0pQJwZJYsrJlaMlV//+tdR1jXXXJ0gxKfoP9459ZRT PLUW8qADD/z+97+nk2dqYAIZdIanBEKJUCBRWLtgCZRcN3cjaVSQ1v8BqftmVRK9MrUH3CAesMD+ 8ccdh325/TiOkpHqpViKVw2QKikWEtA656hO1LIfXNiBDPp51S67CG+4cBUgVXBSkVsBUr3khBeC DAKkyui8TIuQm9os7zBAJ0nreU0zGUuIr15WVi/AIMTJR1tTL69O2t2pvVQb3Gn8wL32aAgg9n+m 9royKSmZ4bSIajOcZVGcKQ12kwQlIyXwCM/dqb0E5uDOrOXviiuwHoW9qb1IMrjTMiMK6k7teeTP ZKTIwQxpl8cyvcUYBNoy11CibzJSvam9GH+CFnMymmeQRaGFfUbbm9rzKBk+SixTe72CUVwy992E XMlISfxYUiOZpzdRPewOxJivKTZZgFSXU6SuMWcG3E160XEUpAJrLZhQMlL3s+GzzyZJrUijEiAP bNSqiGGGUrxxjIH6/AklqEFP5LvMyapQczg1dtLTEXnaqadZ/GpKmnflfNDQnZ4uEoj22XCm9obs q7Y3tVdsmDpiw935WU+LDUuNS/OMtuHTTgOye6YYGwY6QcB8xoEdkIsEjMHYp3SyjBRYHw+m8glO TzsN7uFjgaGsPiQ9mTyiA4aYCjAKV5mzs2DDzD7vYWyj2qcv/nRFsK8hAzAfJUhWeURTvqw0+6EV cutN7U3mhwOkimCTEqNQc+J87HvPPFNO158BtcOpvWLD1kjQhcBarKtrw5na684JpqCXhXsi6n2X UDJSvam9KLFlpCbFD4ACs2NYtiqA4vlNVlXe5t6AJ/MU1g+yMEMNTp/68wKEZH5X5NNz4GhZB/bk T1oHCLg8dkYfLm6FRZpUDqzxvyLyVRKnjFURc0CWbAdLSW4v8vjHM3FFPAKNjSp4EI8o0rQ0qK5O 9z3VSUqWC+IR7C24wYUxnK9S+aMuLpxbFOV981+8T9Bhri6QQhUMwZ+Wp4BUyUgFhCmLO3N/eWdq GuQCjS8tWRMUuX6Ccodx6yrf/MY3+AKey30LKbTih76XBRyZKSMRGEK3oSPy5yMk9u6ZA3EEPK5B UOF5/VBnCqqQ7yZMgy3seGQhBT/CEfN3Ohs8JBMpNmhOns/FTvK1iOJa+YuvfhWSyLoEdzKvgUJx SPCIU/YaLwYcm9pIUorTgato0yNqLVy4Se/E6IWw79HS98Vs1KKEXbE0PzKT0vXyBGKUyd+pNsgG YbwkA2ZFWFAtFvAIsvCbSFUDCmGCwMFubMt8jfcFFVGKcLq4Qf0kZnQuK5lUQSjBIAECxJdeeokW 0akGT5O0V6cOYs7aHcU9MpbgNPUy/DJgPQLaQCclIo91aR1hRCcq2O8g+nX9/p//mUKtDPPbnIju YESuTn/6/y/+4qvqRL8fdAHDoSQFUaWefIgkvjJppkJiHqncNKu+Q5tY07/EiRQkGfSwB5NHJkPE JLakfvdTJyMnZO+gnw3LOLoZLrwmtoGt/L5sje6puRRUORckePhzwoa3375rw/TChglNWeMrgkqd aVFzvApJsjdyiw2HC+lPpGbi2A+9mLhS0FMTrzoaqjg0pHIUiPSI2CWVNeRP670wKGVe2NfQ/vvt p0L0WAiBo8S5cCHxA/RTqFANuwjqGkq1KpFdYI9JPHg5H0ywqGLDzAbOwD6fo6BH1oaa5Ek0hVxl yBhhsWGjU70A/Wpj3hpVA6kGazKMrOqjBcZGGumJ5INBHlLoJRwWwgDoGp0eMQPrCtLf2bDsNbsq 7HtfVeC+eXz1+61gYR9qJGT1xIZZUdeGySrru4c2rDvw+aQE3rFhTqPYMHvWCr7cnNyGf8FE2bA+ UjyY+RAjE7Jiq2yYxyg9kRysxzD+US0YRMVgfHoikWJBVX5ATowESI0SsclPxhRxoU4OLTbsBZsD IY8RYpnAsd+1YZagYIbBHAilkB5n2PXD6tElDbe8ECWyE3+mv/Mb2a9R2dgwgqewYf6TBRYbNgi5 nw3vv/+9Nvyud9FLku6xYYrIElV5ENlxplK6MMa9rP9WhtQxovADFnnw10gRCq+nV3PHfJlBCbUV ugX+f/yHf+DCLr54IjWib3RzLdBSPhc35DXQ0SH98CdvGMTgBdNtCrqv3xYYwUz1GUW06H2XkKZ/ RkM6j46BkjxSHKrIV3vMiEvSkNFDnuq9On8hWA0gtm7Dyn/5i1/Uq1znBCWNHsrFl2kiLQqBvOee e+xRnnLZoEDaZYXuc9PGowZbfjNEfWkKs4jV6opelsODXF06tqQUSpJShjOMmSRpQFvdPvE78IVw WH8gL6CQgh7pKjIxurdYbgC63bbbUndJDmmRIrwMnirof63rUXoyR2mot9eee4JoIYajJxBuHTE6 lRhvBAba8unCT4Zr4oF0IPCXL2KCZoy08ppFSNLpwKUEg6kEzVkUldfCBaMitLAfLnh2MhdyvviF L2BQ+kF2xwsCcOFC0wgD2bVi7E7U2ctUnd7hiHkixIcL/hpWyMYW2uUE5UcNBox6DeAS8DJ0+/BF F2nI6BOyV7wsOCUcjPCPcvuytuoUgTIoDBfCCSylobRI+DwUkrzDpXJzXWIMZxPXuTD+mooL+ymI fUrkwZHX1QX5m6ZRUIvnnH120T6p+q3fJaHFb2qiEKNpQ1XsK+gpIyFkokYn49G6vjmxauc3vzGm F2m6BWmZ+hSkU+Mo5KUggvFLdwoiRp8tNuwFr5kz0lVxwZLFgC77u++2m14TLro2jItiw3QBJ0Fg 3YLQyb0LjO5vw7jAvlgYfM+GaaoU9EOump9J8kkg73Ix8VnuhRcGIKJKdq2rRDZGC1E0VLdDx6KY tC6v48ghmZ3hLZN4Yw/INn2mKmYjtBcb1hOLDcdsslFFuvDWW2+FGJ4wpsiGoYou+8ToZr5WRmTS q4EdLNnIlvTYrWSwUJqegiSQWr+zOgKSM5plGPk6zKNsd+wbeFQJ85ZP9GwYOGP2AX9iPLmVDsVO 2HyU2LPhHe9vw7rb/+liu+2KDRM4XNh1RD6LczpF8tDM1ZtdJaqna8NFiaQ3MXa95BLSUCdFdG14 hx22t4thlDi0YXsfcJXo5ycNkHwyzELiDQBZcrbccKLLP+axHFq8hxdYuwylVD2PJ0ixgW5PjA3n TaksdEqhPYMf3m471p58M8FyI9xXlmAmR+5PNzUkKBvVTNhwxw+btmPDuBjasK4nMCEvNkwa3S5c bBhfvFZXiUwUL1GicVHXD3tN7MNFfVR9QGA0ty88+EBqbileCN/P6FOiy6U/FBRV0nJgX566skIr l+iVm2CKwYQfkJ/gNIUMc2ixaPqRj3xYrM2l26MhvUtyRZdzsWmPdPgyKeMdBUHSUlAA1sf47oll DV/8orGgPqk2L1go3Z3N4aeAlVIQeE1iRp0IBrXLI5XkOymdkP8VhNyRY9A5oVsUqtbmk6Kmhjji tIIGT70GMwEThmieCgDhAjIueelwAeeVFpVSPBECHFcK+1IRXjBcLlx4KnAiw/tIsjwCzosHVCcG BbBSp9c4pjKJYOSXgv4nh5LiUrnl7VEB0OBpmTRUs/qxwxNNFDz0UJKPY02LuDBaKC0SCHF5IVku 0YguylO4P7mxFBRNyyOMJBMZRMh14q48FSQoKGk5P0479dTyCMjGYAK5R/BWl30RiAf3KBGUqZSn BieZfEloNy4qjwif7hJHw0vMKRdrRHzhQvAuj7wWPO2p4sJYPhrPxU7CvncmEOE555RHon4imacI NpCghTz1I5t0hIueDQORxYb9EB1LnYffZ8MKxrQIuTw9//wPFC4QIzSWR28/4ghYMNlc/0OErKI8 vezSSw2ELrvsUjtlULezH7yTRTz8BiPhAfzZs2HQs9sTkcpdlDpZZvpabBhq7LIPIGYUpHKX9EnY MSjVQXQuWCddXgo5rfz85z8jXo/IPzZPwgFSFKp+lCtrUUFgvYRfIWZqGxaA72fD555bCvISXRsm ga4NSw51bZiT7NlwcUQ9G+Zgk8zGdcBEKQh9dpXYtWHeo2vDtIOvrg1zwpROaO7ffPNNUaJW3v3u k+Mi0uUZWPLTBAtBetmV8cAEIuz4YXqPDRMCL9T1w/GQivAex9DK0Ud/a84HHAFSc24cTV+BRF0b VgktZ0ZilA2f32Wf9v/Pht/+9q4Nc2JdG7788su6Xbjrh/m6zD8+4LzK/AcJDUjNf5nP6hZz1l5C Jq+USxfKWoT0mXLfjzK1V+J3svSlYLmvZ3YL9ibFEobLC34XMJHI1y2bCJoXMt2TKyEtMSZ3uq2E MO/rja5uwUT0bovudLkoeKjHRZf9RJoh70UChaq8k3CYp13eu0s0puZ9JPtdLrpK1GJ3QckUegxi GLIfA0i+p1w9PXYlMH0lTsGIFrNgqFwBQ2ETF109linakNqz4Sgxj8bT45D9rhLH1uMU1jhkfwol 4lfnLeLqdpMYWDQyBe+RzxRK7Nlwmig9q9DWsy5Nl57Ss650yaKXYl15v6fErg1P7YuGNtztF1Pb 8HiOaAZtuKvEybxE3F2RW/GQeX8yXzRZ/+2+P1Ri3OPUvmhqG56+I+p14Z4jwi/dNSA1qzFEI44E yqHFxe+0H00CTQJNAk0CTQIPugQCBBuQalhltkvA1ID5AkOidjUJNAk0CTQJNAnMHglYduL81Qak ZjuMaPRZhm+K2tLCdjUJNAk0CTQJNAnMKgkY6rfF5g2oNAk0CTQJNAk0CTQJNAk8dCTQFps/dHTZ OGkSaBJoEmgSaBJoEpjPEmhAaj4LvDXXJNAk0CTQJNAk0CTw0JFAA1IPHV02TpoEmgSaBJoEmgSa BOazBBqQms8Cf+g3Z8dCm4LecP311q3bdPGPf/xjPc8+eVWny752jiawgbIV8eNVix7779lZDp05 CduOLHaVtGO4XfLGq1Mp6x/tzjfB+A032OPOtniO1xi7tlLQlj8Ic4V9Vw5vqa/ZTv2OcUidOe3L 15o11fqUxl5/2LfVaqq1d2j99zW2asS+DbtTJ9na8LqGTmXt8UFBSC1S7W1yO0b9bMlmkl32bbha vyrW5rFILZryoxzoPgaRyqqNCdlWN7TZdojxE68v28eoMEUcQtXjnZrsmlupfVsTRe8247bhpB/2 w6xhP9RyHapVZ9E+IYzNu4IO27Ava1f1ztipVz131FU916cVR0vVkIp3qmFFak7Hr6mtlI1TJQFE Rqq0X1+zDT+L6uNaZySa1BM2rKEBqXkh1YW0Tr7DZriOdHDIg3MMHBGw/HLL2TWuUhy25rNjrzpd DnWx7bUz0nWw8aqFQpwp4RQXZ2j8679OhGQ+2jEIT33qU23gO16dSokZNix2cK9jMZxN5mgFO8uN XVspyN85XsOJH2HfyYBO5oECK2sG8j70wQ86CyzV2ijZUSeOXqnx/sKJ80Ow79zDVOvMFjtflwO/ x6PZxtbYd0JO6nTMoj2vK7EUyEj7TilxblKqpTuYdTwKU8qwwQEaDMkxaqnTiRYGEpVgwp77LJMN pE5ng9hMf2wwATGsueaaTiIq55qzeX2BeAWqsdkX3hzihHenTIZOJ0E5Jaky6ttT2zEpbP6JT3yi c451LqIwiBqbzhTkoxyQ8qQnPSmkumytXtNb9SYHmxBjUb0zjmyeXtOb0Ek1zqFaYoklQqRTuUjD PuA17DvjyOnRTpLhRtTpJJma2krZOFUG4EDoUOuALNvc11Su49jun+odbJw6xRRjqtmJpRqQqtF1 K3s/CQilDowz2uNApXl0LV5g6hNpHlCCdj12MoDzQ9Tp4rOcnLDeeus5be0By458gXezda9j+JxF 5bSTnEslADj6zRnY49WZUnq4T3NBPeNRYbXSjaZOeQ7exKl8GMe+COqsaCmfGjrR5sQGeJf7i1QN UtdYYw3At6ZaZbHP3ZNqqpXz4/5ySOXYFwk40stBJalTMklkdQLu2BUqyEcbQIv0tJ9qQUnHklSq jK0Kpc7eSZ3yB6RK2jWk6lOOaHTwXOqUUYAnhMPx6sSgXNQznvEMx9uhU23OYoJRHCCT7OzYlzyx IIqw0CkZCaRWJmUdKsL4VQKRO8eGuYK/9akO2ncKniPz9KZQSxokPDbvpGq46Fw8AD0VyvmBvJX+ hOqdTOwU2tTJkXJT9eiEQTp3xVl4BNs9uHZs9hUkAZljx8xLbIdaox1aqxxEOUnW0aiyXKlT0lQT lenDGjanKNuA1DwS7MJYrW4J4kjApmuZj9Ndx56DiwT1eQdedqOR32JzTRc1ZSDAC8YbbLCByQJE 6vbOQq9MHqCWbwKkzPHNoPqBSAeWkWeOv4UqzKDV1M/lCUjyfKUSipPjqfT7aqMXQMqIPzVDVPVA Sj1Ydmxf6qR9SAJEq5GAsvQOSJXR7YwAKdvtAFJlhtTUntRpJZBCKiDlDMfwS02rvvCFY48i1CBT wux1UmbvKEanDjuIzWFnlSASwAWkTESyIhANXHO+byXvBx98MHSrpzsD2NlzcA+wwqgqVa84WOYM 3eJDXr3XXkXC41Vu3Ii2ktS87bbb+IHKDkUjgBQHiCRGJWfm5GNbe49HYbeUg4odBlyp8R4ZQTll 2Oy8YVqr8dLqVxyQMmOQtqA0/cv/9RKY8RoakJpxkS68FRrUmiHS840aXc6FFVkru+sFF1zA49dD nK5W9HkB3rSLuS0uj0s1XcJJ1bdyL5D6yldm0AjEOVBS/DDC4wE1UZk8AKQ4fSmEGSQyVQVIlTDP BoCeyoyUal/72tc6RzZNGKRCgXfecUcl8YAU0F9CHSBl+rjSVgOkynIr05qSZ5VgApsmTMukM2Gu svLKBaqOIQRASlLT7LCZR0CKbB2SPVNA6hMf/7j8ARswfGKolfJ0zrp5fL1SSJZDlZOQRa5ZyFjE pb9jvwuknLs8hjBLEfxKFwn5lvWYfPzIRz7Cn1Tme0jPBBnVGDZIbX7+c58DJet9FJrl4GccSEF4 gBRAGZkAUltttVUlkOLoNt98c1McqdPYz7KBlpGqMdRWdsGQgLkSI9Fl5lxWY9x9112VUT9Z6LgP B1jKbLuskTT25VjHEwog9aLVVuPyQChJfrHEQpx5AaQkPEwjVvo+Lt5Cgec+97kWYXz0ox8dj+Vu KUBKvA+QkuGAd4lUFuEHc+Z6auoX5uVLrrjiiqjJFCQJV87voOcNb3iDnFzqpLUtNt+8BkmEQfNu wLTESap9y1veUjO5kzrNPRGsZRypU9pjxx13hPxqRKrsAQcccMQRR6ROMEhoYfxj16mG9ddf39pw 2Q74TL5zRjJSDAl+spbLZQWSSd6xKSwFYVDSK0AKsNBKZWxO5WDZxhttBPFHqvvvv39lz4KhASlr jyxmsPxIetudSgngl2uyTMo6BEsP4fLKCkvxHpDiVyUUKyvnVEmAXUWk7zvnnIMOOqhSWWKH9SE6 Zuo0X7zpppvWL7qt5HRk8ZaRmhdSXUjr1PPln0VoCV6XkZkReaXdW2xbgNRJJ50ET7gWW2wxC7p1 rfEErc+vtNJKSNUzLQtF8Ac+8IF5AaRgFEs7gcvx6Ewpoc76Lc7ODJfYXFNVypom4PLi6M0SGuQR qXUzlrJ++MMfrqnfiBk6EUqjpq233togsjItgR4rwQWn1AmpWIJWOdZXp4ldi82FqFQr4zU2Li8S gx7YlVCaOqEovaCefTNcT3nKU1KnbBwkVDM4UdysE1KBCQAC9oXSZiojZTYT0rWSXa+fEdWTbQFS NZbZK+uzNdqPSF0SvZWJw4mpvRVWwLvskZnT73zn2/XUshyfL5x++ukkueMOOzB7s1qV04Whqguk tLLvPvtIoVUSbCEHHGm9XUTKZdWDaThs55124u1TpwkEQ+jKcWklm5MVb0BqHgl2YayWf4dLJHXT 2+Vg5aVqPodRidkHw7tkjPVMdVrhJNdVWhlD0LJEAp6lwehMzeDa7rvvXt9FBWNJeLEqVIF6Gqoc 7fmkKGuksjJ6DH57RSThwTspKHWKH0Tq0oSwWvk1HCBlLs867tQ5IzAC8dba+4ArdYol9ShKnTJS /DJInWrr5x9jn2Y3BLzUycDqlaWGAw84wGLw1Cmm1qAotZkjZqLShFQfMG1O88jqaU3GCeRJlQl+ +pQuYHXLjJirXrndtttKc86IMFOJFVdSHZY0Rar1SVOpXBCfY8G+4ZlZ+PoZqACprJGiKVIF0WZk wwKflbzyFa8IxPe/lQNWUFSKF+8kYPAckdYn5NBDmNRkdJc6hZJ6F13JZgNS80iArdr/k4AIZ17c uMTCI3ZvfMZlV361x8eZ27IkNn3JpcdqhbcaT/Q6p7U7ElqcfrqliGItszUTlUMomS3HpJvgMLkT Um+55ZZKIIV9y3eskjHgyxcx43HdLUVNMvDinDm+IlVI5ZhjjqlJn2Q5vNVX9iVSrZzEjHi9f/3X fzFZbNGxOkmgfqaMKABogZlxBkhV6j2yxb7VUT77D5Bi9jPCPoAiVwpMh/3Kb7+BMMvMmajaomvY 18wpqFoDJVUFnUtzWnkWi7JaSDa6HqAYhLB8Ka7zzjsPiJyRfAwZWnrF/gOkKgcPZEjRP/7Rj0xo AqncS6zLDGzlQALvxqVWsEWk/JXksSR3jQfAOyvyqaZsMcGmZh8wBq6NfRWnauioQrCyxpMUMv7h H/4edgT71AlFzcgIamwepy7YMlLzSLALY7XcNDhy5ZVXWslo8w8zCD6HrpwmJ0eeTs9XYS4OSxNj p+INlawyXuxpT7PVU4IH77/kkksuvvji5dOwMZSHTVNvMtsS0ea2QqpZHo6gJkRZuqs2k25qMw9l W6kxaBsW4ZJ8oW0EWaQqLVG5z6f4YUuFwr5NX2YEoBgrY9/MI1LBXzClXgKJSUilL9WCKfV1wrjm 8tRJ6eo0kq6P0KgyimCZYR/NlR//gw6QPSKtYg4okfG1iRQJ+zG2EKDbLu9IZbRC9didtFBiNj99 CpEw+oysNAd3ULj4fdoHqsZmPAWBUcvhEfnStddOhltCjhlY4VSTPuSOiuoRzEexf0O1GmrxDu8y JzWXvk/7NbuIoccY0sI7Eljy2c9WLeuqRPyBp8aQUb067aYxI18s1khvirINSM0jwS6M1RqFZNDM Xxs5WYtTj6IiRyFZhbmyT8/Y8uXaZA7QxiUlZyDgSZjb6a4yeWaEx9GrGYWFVDdrMhMYR5srFf7+ 9/88NuO9gtQETxSpls9txq6f9s26Fvalu2ZE+0a3RQIEO/ZelF2+BHh1IjXsW382NtelIC3Lb6mT DaiTdc0I++YHu+xX5ngonZ0jUlo3OQPjitRfMxejqvDetXyuoD4tIa9JmGhmqyqvR2ZYJsP092i/ 3vKpXozHPpsPckKn3/p+jV3hPYyHTnallcqsDN4nPiv5wQ8K+xFvzWAPj8WpxviLddWwr6wcZJEA ldWDs0p6GpCadwJsNTcJNAk0CTQJNAk0CSy8EmgZqYVX943zJoEmgSaBJoEmgSaBSgk0IFUpwIdg cQn5djUJNAk0CTQJNAnMQgnMwqDbgNQsVMqDSZI1KGamfSLRriaBJoEmgSaBJoFZJQGrBmtWnc6j 4NqA1DwS7IJardXNlklaKtuuJoEmgSaBJoEmgdkjAd8J+ZKpAal5Ai/kHn0g48OBrnzddMc3Drn8 dg2/IhkWLCSqTREvjPz2ZLKCuV/anZEvd+aJ1Cap1OYluo1vcNrVJNAk0CTQJNAkMHsk4LvFyu+g 51EwnRUZKZAF4BheBRgFKvWusjEr4dpuxA5G9por38faMMMJl3Zyy2XPMZsbdU8OV9yHr7Zp2WH7 7e3W0/uu2CYrNi181ate9Y63v713XFo+8j/++OMdXWLfue5mOR45GMh9u8ho1L6R73vf+yq/WI7i uxKY7KPiIp8eYI94p/kpcgNSs8drNEqaBJoEmgSaBIoEGpCaFAgK8GeffbZjQOxfbCNXiCcXGGS3 5WxkbH8zG765aTP7vffe275/nkJFykqf+NOWeiCL08LtgpoijhOy85hTOd1Xv+MLbDt2R+fcx9/+ 9jfZMdnT17/+9Q5J+NMf/1hQi8PXPIWKQDTAyN4bhQEbWthr2G5pzhVxsIaTqsomHCALFh7+8Ifb m1G75517nsOnKnfjxaNqnWgB8OVynNMQFZk5RnBeQFsyYSnrHKU9dt99mue8NiDV3FaTQJNAk0CT wCyUQANSUwEpmSSbLD/iEY9wXrTTQ3M5FcR5CzmnDFpydqObDn+WQ7Nnrj/J1CTae88880lPepLT SLx244032k3bbmMAhMlUICat2sgLvnEQ/a9+9be5A17Y2dnurnfddZc/gR77ZZdNY+1Nt8kmm9iX 1gyddXYOjAPIgoeklyAnp6BIU/kTCIPPoJxSrSTWox/9aEeizlQK8Zvf+Ab4+MY3vKFIxpEOX/nK V7r121jWQWkwX9657rrrkpS67rprocBjjz3WcQ3TPN68AalZ6D4aSU0CTQJNAk0CDUhNhSvgHhmp xz72sTkAIekWe6RCML0DX+Gnhz3sYeWERcknRxo99alPDQZy0A9sZLf73tyWWdW11loLMivbItvM GrRy5kaO1HVwGzR23HHHpaADcRdddFEgyW9N2PwePrNrsz9Bln322cfZZ9lc27kK8N+RRx6Zgv4v QGqaU2kPiLcycVmwmvcl57pnTMqHSYDJQg1TX2DiiSeeaMtdh19O83zvBqSat2oSaBJoEmgSmIUS aEBqKsBgHsoCpsc97nGAFOBiQs25EBYwif09cHDyyScDUhJIqc5T039PfvKTIQbZKScvPv7xj4dy envJQyHO6wFHCsBSvxSUKye033nHHVoHULLB/3HHHasVM3dpQnbqCU94gmPjgqvMM+a8W5jj0EMP felLX/rp664rGSnZI2Wd4wa3zchJcz3BwWfoDG0ueE7CCQSc4vCETDi2jNQs9AuNpCaBJoEmgSaB aUqgAakHBlJSO+ahDjjgAFklX+CPLNADUt5xPpoVTm9729usjrJGCpBaY/XVu2exQR7vOvHERRZZ 5JNXXVXqlFiyggqQyvFqTkIFpKy1CpCy4so6J8ukAqQ23nhj+Srpri5JENVZZ5217rrr3n777eXT PJDlwAMPtMz8kEMO2fvVr4Z4Pvaxj83I+VCatvhdtbJfrm9/+9shBiJ0kqVsGZjoqevCCy/sJcMa kJpmL22vNQk0CTQJNAnMWgk0IDUtIGWh9F577unA5wKkTMZZD2TmLuBgCKSCpeAVGZdbbrnlKU95 Si8jBRs5jHqlF7zAYYqFiKkzUnI8k2WkUgNirMd6/oornnPO2b09F+Aqq9EDcUxNWuTu7MmpmJ/2 s1tvvdUaMmeAg0ql0O9+97sXvOAF8NMb3/jG18y5rKC67LLLulQ1IDVr/UIjrEmgSaBJoElgmhJo QOqBgZQ1Uj7Ek7857bTTyoncPpeT9fFtXbI+VgKBOFm91L2yO8D73/9+66WsIu/CCFBj2223lRxK 8imXNVKyX2WNlLk/OacTTjghBS+//HL1WGDut8zTeuutt+aaa2Z1eVCU2T1pJ7OKU5xHbenSyiuv bEqx8gzwHptWgL31rW/94Q9/kPu4W3HFFQEsHGUvfyvNN9hgg+4h4Q1ITbOXtteaBJoEmgSaBGat BBqQmgpIZbF51kgFqZS3b//Sl3wEt8022wQZwC5mAIfrprNBgPSPjQmkgrqNmZJbaaWVJGyyLUKu 3ld7MJMvBEd+tee8lO5Xe2iD7bRifm04Z/f1r3/d8qkCcdQJ5fzqV7+aivm5fIYAWz+UNVI+MJSR Yl6lmmuvvRbIqwRSKrQM3wIy28j63e1X/nTTI3z1HuU1GThP4c5eb0wfAJGJdGRBSFdB05TDgjbu UtD/w4LeV9A17Pxe1paC2h0WRGG4GFnQ/ZHseznsk8/csv/zn/98avYn4yLsKz6SfcSQ+UguEPmA 7A/rdCfsT6HEqdkfqcSwP7USRxaMEkeyHyVOzf7QhqdW4nTYn8KGKXH+2/AUSsT+sEO5SaTzyIan YH8e2fAUXZiFDD1YHNE8suHxHNHc2vA89cNT2/AUSpzXfrgBqanwgik5WAdCskDb/k/dLS5Nk9ny wFL0iy++2CJ0c3977LFHASvwEFhjquuMM86Qp4FvfvSjH/VWCKkcwLIOvUdBNl6S6zon+0gdeWRZ 2K6GyfaRsrgKjrG8/d0nnywBZtn7hR/60D0//nEqv+KKT6BEW+7DfBtttJHNCCo35ATvbvnsZ7vE d7/aQ4+VXvZ6KC8MM1LY8S2h+b7pYLZ8tcfRXHnllXYrlSPsOWJ/wot08fGPf9xrPa/hqWlWKUP4 tReGvWxXCPIB9YYF1UP15557rm8Me47Yy5Tog03/9wp60/tKKTuMJV4mDS1qt1cQbShEJ7saRhov 4w77Nt8ask8mHpHPkAv0mGKGy5nlkH37ceDi+s98ZsgFmfsSk9VR5ZB988i4MFQYFtRB2KEFgsPo 5eVPfepTSPUpRo8LtH3rW9+0yM8HqkP23XHf029961s9Ljwy1a5ONfOnPe2jASXoQdWQC/RjX8K4 V9CbP7nnHrzrOOTQK+jlz3zmM9gnvaESyZm0yfyv/7qPv4sNG54NlUizuPjEJz4xkn1WwTYsBhgq 0XpKxLCrofZZ4APa8K23TmXDwxisFf1Fi1/+8p1DJU5hw17GnX46hg0bqfJgI234i1/8ImKuv/76 oRKnsGEvs2Ha//xoG/4Bm/nwhz880obtljyZDfuah5XybOPZ8NVXj2HDt+Hi5ptvHvZEPfe8884b acNensKGfZ9+nw33B59T23D8MC0PTZHdxg/PlQ2TPxvGAkam8MMWmQzZF3njh6ewYX54aMPW+07t h7s23IDUpEFcmNczfVYGBsk8WfGt15W3gRsa4rVhHduFv/vd7wazClQynad/KqL4rbfcYjZtuOkA g9DTunWmcm/KXVEhYHT11Vd316d7KqPDce++++6QFqMp1ULctj/waZ5dy32a59rlla8sexOY6VPK C+6DO5xO5W6cKFEh7CjKsu+J64ILLIRSc7jAskVRHM29Tz/4QROUtjzITCg/6770lUnGPffYw28u UhJrCkQVIGW4hoVHPvKRvFsvZ2MYd8UVV0gTgom9UZR+6OXVVlvNLC29yD10OxXR2fQLXKZo9Xcf 6fYaXWqppSxxsyVYr7N5+S1veYvl/4cddhiVdQtSjThhrwplf/KTe3qOWEGZTgUZWG+oJKPw2c9+ VhLUDls9OtXvZdxhH6f47baIQWHbI/Lp1al19Kyy8sqqpbVetYA7vWDfjrJD9iEPm5P5zILj67GP ZcaPi6OOPLJXUHN2ZwXrl1t2WTLssa+g7f61yC32NIV94fkxj3nM2muvPczJedl9KvaON7vse6Q2 daq5R4zW0eDTB7PkqOq5Wi8bq2Sv2l5B/OLafmwkYIzUwy6GCr7bUJD0yLBLDAnrCL4jYd7DUOrl l22xBVLpa2jDcDAl+o5kmAmgcVbBhlnI0IbZ0kgbxj4btlqANYpwQxv2hS8uDj/8sKES2bxSyg5h tJf1FwWFk569oU1ERydqe2pKYpgNP+pRj8Lp0Ib5AexvscUWQyVSHHmSKtn20FKxYS5uMhumx2Hw Zoq25Zuw4aOO6hXUBGjOZpZffvmRNmzwnE9/eprClIMlWKnvpufWhoV87HPRk9mwPjXSht/xjncg Rn8c2jA8ZHUvG9aXezaMfb1eQZ8E9WwY+74i8o0UmZN8rwt7mY7YG1TU49GfIBT9Dm1YJeyh2HDP NtQZG+Ybe8QgmwXypayRXx12YRtQz7HhwyezYWX/31/+5ZB9I/mRNow2kYINv/jFL+5ZafHDXRtu QGqqbIioXw6n86MHhrI9dw6wGx5d51HKTnaQYYpPtqtTmh5ZNo32TuhTT/covWHThdQpSJpOZqi8 o0JR2WydXRhy6XhdgkEfqbXyVFcv6E1Py30IVeD3w3KxMoM5kowAKTbN5UGu8ge9WKLnA472RPWl 5NB9exmws/cp59jrh142uOQXoOGeU8hICBcWrvFHvX6IGBDQhmH+7xX0pveV4qfU0HNDXtaWFrXb IxVt8jToNOc7zKx4GXewMk57TzFIJiRz9NFHDdkXPgUMrl8o7bGPi8svuwwXvNiQfUlNe33t+qpX GTb02Pey9ICCgl/P12jOoNwownaswyCk4AnHH0/vn/70p4dKZFSsQnQfqUQe01NfTgyVKBkDoMDr Qy7If//99kPPMJWFcvTjAi9DJea0AB+a+MpkqEQ5AAWtXByyD4KAdMDZEEh5GXTb8mUvgzZG2vBW W25pc90h+zTOKtgGCxllw1exKIs1J7Nh47qhDXvZWCg23OOC4iCPB7Rh6ZOhDetlevQUNqyf2iRv MhvWx4cQBD1seMcddhjCQZRfduml2B9pw9mvbrc50wJDJUq6YB+oHSqRtbAZ32sPp5KR5zCuqW3Y KGsyG952Ehs2QlCnr7NH2vB+++338kls2MASF/JnQxv+0Q9/CC6QwGQ2vMXmm8tz99hnYDKmPAaZ D20YX/HDQ0xPp7fddhsfNdKGVRs/PNKGLbSdzIY5f36YDQ/zkVg2Jse+tNMUNgwADbUPQWpRQmRo wwArOk1GDQe0XjbR1LXhBqTmCjy0l+8nAbAJNirXEPYBbeVpdnDIBSZ2C+b31DuF3rch51/qqHrL 0LXpJ256NHKm3FP9wdNhlj4LUzzSyUeuLtJtXCMLKvKABYcpZXdScOih0ts9Gvbe1BMupmZ/ZIuT sZ81DeFiZMGwP3KBRWF/+DSjz5FcaHEKJU7BvoJTsP83D6T9kUqc4wEfWPsj2f/5z6dS4njsx4Z/ 8Yv+7GRX+yPX+oynxGKKI7UfJY7U/tg2PLUSK7vwZH1/bC4mUyL2K214pD8p7E/WhSd1RGN14Tlc jOOIpu7C99nwiJWj0/TDc+WIHtAUp9B+lDi3fnjIfgNSDRstGBLo7mw+0gel70396CFQEAsPAS7G 1tRCwv7IQBKhLQzab+yPlMCCpf2FSokNSC0YMKJRaQma1LQEb7uaBJoEmgSaBJoEZo8ELOGS1pps Gc+DGL4dAfz/PYjNt6ZnmwSsXpeGTZK2XU0CTQJNAk0CTQKzRAKWHPjmoAGp2QYbGj19CWRtfrua BJoEmgSaBJoEZqEEZmHYbhmpWaiURlKTQJNAk0CTQJNAk8CCIYEGpBYMPTUqmwSaBJoEmgSaBJoE ZqEEGpCahUppJDUJNAk0CTQJNAk0CSwYEmhAasHQ0wJEpW18LVe3e5tdrGxLPdxDdQxeHLOjTpfF hraP92nhFMdFT10/eixXRB46s6WWQxjdsc2JrR/GoK0UwSzy1GxfJ7V1N/Qau1qMqyq7duVSf/12 +eix95gFpKnTidd29vf/2HQqSJj2O0YeIaRa+yZPvWnZdJr713/9l64E0Nw9R3I6NQzfIUB1dkn1 jcV4VZVSOM3RjYX9cvJ6Tc2///3vkVo05UeNXSkbxh12HtXQO+NX7R/+8Iex6RzyrkInKFRqH0mx /EiAYO3tXsN+GOQ6en2qd6zF3MrBKqKe6nvnvc5thXmfO+qqfkbYx7t6CDOCZV3j0dYrVZxqMf6p z8+YZqOstCsBdjsLl5mHlwakpqnT9tq0JKD/2N7XQQGrr766TXWdk8jFTKvk5C9xc7YSVqfruc99 rn26HW5gv+bxqkXhBhtsoCpb9CZ82vnaeYVLLrmk7arHq1MprsT+2s+Zc6lqjTXW4FPGrq0UtCe7 k0NUGPZV7ghtm5JX1iwaOQ7ccdep1ubR9qr2f0210IkNkcN+qrV5NCFURlMbgquw1OkgEexXYikH 0Tz/+c+PskKqHfArz8RkpQ6b6rJvv2YYpZJ9pz9NCPQ+kVKZ3czHBhM+HX/hC1+IX4dfBY7bbl6f Uv8ll1wytvYNRXq8q9ABqcNj3eeqCbyrJyLND+zbNn2uKhm+7KzM9PeifTZWQyrAZ3/5rup33mkn mK+STu6oW6ffdGfXqJpq8b7CCisU3p0zW1NbKWsMueGGG3Y7lN3hwaCaymEmZ9F0JcCp2m99dmKp BqRqdN3K3k8C/LsTEpyi4Iw/7h5eWWKJJSodyh//+J8XnH++4wXV6XLC5UEHHfSMZzyjnDY4tzpA pLJOBFtzzTUNd4RkB+k88YlP5Pf9Obe1dd8Xpfip56+4opjkzJMZyRtxRq9/3escnxL2HQgDoTpi rIZOmA+dzp3wf6p1bMszn/lMp77UVAsxOOpk2WWXdQ5GqnUiBDBRCVDkdeCzgw8+OHU6twQCdhBY DamipmMuhKWvf+1rqdYxIw6zq6mTf0cVjOIIndTpTBunuQEZNdXqPs7AcVBG6vzq3Xdjv5zaPrc1 S0g4V5S1O3aDafkT1w56c0BHTQqB6h3zAuI7eyR0wmfOeqtUvfOLdPxvf+tb66+/PlTBXFmXQ4Hm luve+3AP3Mw7oTnUOtfI2TVjV0v1aBPyb7jhhlTo0Gtn/lTCfQkYanLMUep04i/85/ShselUEO86 6XHHHWeIy5fWj3JDDKfqJGNDPuPbUPu+c87hqCunI3hUh36eecYZqVPlyCaWGgnMo7INSM0jwS6M 1XIc6623Hm+CeV3IQXWrrLKKQXmNLBy56sxmB2uUSnI2WU02Xm2CqIgiswXw7bvvvqeeeqoTpurH OiK0YROvWsNyr6zDep18J1apHNeOwBOqa+onQEc33n333SVZIqYKKvVTUdy0I6tVFfIcIrbqqqvW z5o5NYyCUidcwqjuvOOOGgkoyziF5wJ2jX0dUlmZPTLjLGViz8DQ5qRCYKIm1ZF6HELnoLr8Jkyn YtfgSEh0rbXWco478CS56yDwNx9yyDHHHFPJu3lheoHwdCJE6lZcQT2QkiVVITjODzB+J/syqkrV K27sBJ6WMP/qvfaS/aqpVkpGjlPPSiVOweMH6odSe+21l8MZVahnQboGUVIyNXSmrLGuwUmlxntk 4H2llVYqPuTSSy91DmAlkFLceK+4OzOSEtJmJOslMOM1NCA14yJdeCsEpERo+RJe1cWfOse0cljm 1Hdju3qI09WK9LjDxnlkSSmngToxVBJF1qe+FZFjYk7zK1+ZQSOQKHLavNUMTic14ndIQuXKBkrh jyoT7yMZpHEItYR5gJKc64GU81zLrCtcApw56LRSwgbQ6667bllpB0g5HbYytAh1oinxhjZTkC95 yUvqgRSgf9ZZZ6VO3WrVF76wQNUxhABAb7TRRsweOpGGYVpky7QqebegJyjH1JtpPsldByRUdihK kTtRicGDHgpMAKb1GSlCgyOx3wVSRcJjiFQRAGLFFVeEcuL3DCbhyEogRSPGkLLFuipEBZsyrcoE Z7iTjpWAr9R4T1D8klFEmX8ApGitEkhJdMm/lgS8dQL614wsmRhPy1OUakBqxkW68FaoZ3Ilxjpc qguo4k8ru6sBWQFSHNO//eEPE//mXGO76Qkg9aIXcUxyEiIKv6/bzwsghcJ6x2es/JSnPMVozxSM GZN68xLh+CNjaFXxdBOivE+klag3QEqojppMRoCVMwKkTj755NQpqABnMwKkhDo5pFQrZh999NGV thogJV2aOqUl5H5mBEixgdQpYL9otdXM8I5tBrRjVuvGG2/ceeedAak3vvGNZPv2t7+9kncAgurN PZngcxHs2BSWgjlioQApP0xsVWa5Ujkgtf1227HMSHXvvfeuBFJUb+3RcsstJy0nF8WlALuVIlXc zKZlDADKIossYlFjvUhHAinDibFX3RWSAqQk+yNSpmWAWg+ktthiC6PH1KkJbrABqZkyg1bP7JUA rMPL33D99f5ZIwIDJWCPfVkHWoCU9RwCs0skMKoee6UIIAXnmYCX4o7LA9fmBZDS8/fbd9+a76HI 7aSTTrKU9frrr7ec01BybEmWgl0gBZFYhUCk66yzzrrrrGPcX1M/TqEcQ/OoyaDf9FalM0WPFUKW cKVO1FqAUvmBoTrvuOOOJz/5yahNtVIy7KGGd2WhB47elTqZFrA+NtwvxJiDs9Ywdcqi6VY1FgVI ZXXg6aefLs/hGDWrcOqB1O9/P5GROvfcc88//3yQQq+vzMcU9guQqtROt7gkh8GJfGGk+q53vaty faTP9HB90YUXnn3WWUsvtZQhRD21gBSEJ2V47TXXMCqT0RBPJTgbAikVmj/9zGc+U0mw7mMNOzAd kVopYVVTZZ1ch07kY4jUucnGG6Nz7O+1K4mZunjLSM1T8S5clbP7t73tbWZ20tsNHfSBSg/1gfM+ IMWVTImxvvXLV1xxhZkpqzrGHvUCUslCm48QUFF73nnnzQsgBVNyr5W7KpjayxopC9gN0OtNygQB rJMvtAnBWjFS5bC22nJLYbWmfkN8826nnXaaCl1f+MIX6mEEeiAJcxyp89prr61PcanTwlU2wJZS bSXjEZps2Que/3xzMakTiJyRsGfRrtm91GlVUw2KQiQgBUCoxOLFTJMBkfVAKlN7xjZSsNC5hcy0 Vp+ORd68AFL0Lm8k1RGp1ic5MrUHTEhAXnTRRT7grVnEGXOamNrbfXdjJz+sbJPsec1BB9XDfTV3 p/ZULjfJAdZ0fGX/6q/+yqcAhqYR6YzMwAooltsbR6XOm266aabQeSWzw+INSM24SBfeCsEdmVjJ besk/Lb8UKq/EkhJ7/PyRs8qzMU7b7zxxqbkxhY0wjj98sUKVyLvJVRX5rd1e/HJcF+sCqnGZKRR A6REEYvNDznkEB5EhTOCSxDJk+6zzz5+FKmCa75cqwz8EkUWm+NatZXCLMrFsuknc1shtZLCEqLM u8nwCXvqrM+ZpVrzOzIH0pAzy77F5uLcjLBPehauMdGCxohXRsr6sEohMHLZCEOd0Gl8AlLXT8P9 z//8N8s3SXTlFVfMoPZlXi0SmsE+ZVgClwMTzMASxlNPOUVvqoz6NCKvwzVFpJk9rEzzMABVgTu7 7LJL2HfZCyNL2muupPkByhnsUKqy2FwyPh1qRvp+DY9TlG1Aah4JdmGslrlvsskmBhAG0BCV72Ks PaoflcoW8EoqzKVryXmMvasCjy/F9ZjHPAaRcfT2u+IEF1tssZqJMwHpne98J/atZDLiD6kilsha szb8lltuseLEzE4qrN9BKnYJ8ZChz2qKVCW9Kn007QN8j3vc44z1VUu89RNwSL3qqiuf9axnEYI6 LV+tWR5U+iSsYyrzCU94gq+pVeuDhvruys7NwrCrl770peq0QL4ydRSSPvaxj1klY0CiTjO8lV+/ G9XERGWO6Uv95kqyP1nN5I6QjPfHPvax1oTFosyZ+l0PpAR4y40XXXRRPdRM8U/v+yKyRl/QHsyn TjUjtXI6GyWSTwceeCDVS+3kGw791B4TBic18PTCCy9cfPHFrbuKSC1m8Ke0dCXvxAiQPe1pT0u1 hMD1VS6+5FQhMxKw6EKdPoCtBJF4BJt8q2v+HT5TpwUes/N7vaijAakas2xl7ycBYELg50o4ZRMc 1hvO1Hy22SgV5jI6r9lSQRICvOM4rvjEJ9LbjSNBKAl5K1rG1qhubwEv8tSMwntJPfdc3+/U5Gbk 9tDmSoUzMgMVHk2M2qCrSLU+FS9mmCUs7NtMqx5DoxNyuvBDHxJQo/r6WRh1yh+IUsblYV/6ZGy9 l4Jwid1TsW+dkDqF5xkxfgkkpEpLhP3KTXQEPFwj0hRhspuQWQysBqKx8C7vIZUrqIEREazFRmrT Ny29gnf//u/+rl5T0CR7Ume0b9assk5uxO4M3B2bz4weA7vk4otNRdUkUbijiy66V/XotCmxGcnK eW28Uw1zKuyrmUn8/Of/t7/MGNLgVC+7bMKpIlKFNiyoVz3RSRujjeLVyUTHXssxBkdzW6QBqbmV WHu/SaBJoEmgSaBJoEmgSeBeCTQg1UyhSaBJoEmgSaBJoEmgSWBMCTQgNabgWrEmgSaBJoEmgSaB JoEmgQakmg00CTQJNAk0CTQJNAk0CYwpgQakxhRcK9Yk0CTQJNAk0CTQJNAk0IBUs4EmgSaBJoEm gSaBJoEmgTEl0IDUmIJrxZoEmgSaBJoEmgSaBJoEGpBqNtAk0CTQJNAk0CTQJNAkMKYEGpAaU3Ct WJNAk0CTQJNAk0CTQJNAA1LNBpoEmgSaBJoEmgSaBJoExpRAA1JjCq4VaxJoEmgSaBJoEmgSaBJo QKrZQJNAk0CTQJNAk0CTQJPAmBJoQGpMwbViTQJNAk0CTQJNAk0CTQINSDUbaBJoEmgSaBJoEmgS aBIYUwINSI0puFasSaBJoEmgSaBJoEmgSaABqWYDTQJNAk0CTQJNAk0CTQJjSqABqTEF14o1CTQJ NAk0CTQJNAk0CTQg1WygSaBJoEmgSaBJoEmgSWBMCTQgNabgWrEmgSaBJoEmgSaBJoEmgQakmg00 CTQJNAk0CTQJNAk0CYwpgQakxhRcK9Yk0CTQJNAk0CTQJNAk0IBUs4H7SeB///d//6ddTQJNAk0C TQIPngT44RaZFiAJNCC1AClrfpD6r//6rz/72c9+0a4mgSaBJoEmgQdDAjzwv/zLv8wPd9/amCEJ NCA1Q4J8qFTzT//0Tz/5yT1/2a4mgSaBJoEmgQdDAjzw7373u4dKSFko+HiIACkp2P/+7//+85// PFTan/70p/+Yc/3Xf/1X76n0aZ4qOEylqvA///M///jHP6p8ioIjzUQRZUc2OsvN6p//+Z9/+tOf /r92NQk0CTQJNAk8GBLggRuQmuWBskferABScAxAM7z+/Od7oQ9cMnwafAOsSKL88Ac/uPnmmy+9 9FLwpXAIG/3DP/zDCSecsPbaa7/0pS99//vf//vf/74AJj9+9atfnXTSSZtuuulFF130t3/7t10s pR4VbrPNNgcffPBf/MVfaL1Uq92//uu/PuKII7bccstPfOITmujKVCX//u///pWvfGWnnXbaYIMN LrjgAhTOoE2Adz1gByAW4QzBoqYV8cIQDo6kqguk/uq+a+hMJntU7udHt2DvUe9p3hyWKjVMQUwK TubxHrDgZGVHEjM2F1MXnEJuXckMSZ2+wHvyGbtgUdNcyW1qLqbQ/tgCn6ZFTWE2U1vUvCg4f0Q6 tkXNayXOoMCnb95Tu6npe7AZbLEBqRmMmPOnqgcfSEEeJ598MlCy7bbbbrzxxhusv37+bbTRRm96 05uAEoK4/fbb82izzTbbbrvtNtt004032uiOO+6AG85673sPftObTjvttBe96EXQUhfI//CHP3z5 y1++ww47fOxjH7vwQx/afPPN99lnH9PPkSwwBOuceuqpwNCxxx67xx57/OY3v8kjyANJ++677yWX XAKcoe2GG25wM0+/853voOGcc8654oor3vzmN7/hDW8APoq24KoDJ64DPvCB89Ts5ZF5svG0Cwy9 733v+8xnPlOK/+EPf9h3n32K0Eisi9u8T0TnnnvuVlttddddd02n0QKkrA349ZwL3CQrQLN4HH+6 mac/v++SAi9F8ihllfJIEX+U+/lBF10/pYnc9yMtlqfeLGX/5m/+5pe//KUXilsPMd33S0HU9bgo BbtcoDwrw0rBkezjZciFJh6Qiwn2BxdGSEbZwnh5pcdL4cILXfaLFkrBsKDabpGeLnAxouAcLiZT YpdBBJTmIjT/h5EuL1jw5tRK9EJRYhEC5YZHdXb13tVjoWcMJaZsMciu0ku1Wi/W2+UdSYV9Ei5c l3fCRcy+BwsKLz2z91pXI132U0NRZRHXNNkPF6Gn14W7SlQ/IYSdUqSo+FedbqjdrkZ+9rMJNY1U YrQ/mRIRVLphl/1hF/4/g7x/kV7f11BX2iMdUcx7Tk8c4YiiyiH7Iamr924/nqILh6SRNowAZKTF kV34Jz/5SctITSdazZ53HnwgRRZf/OIXV1111Uc84hFvfetbL7zvOuaYY5Zddlk5JC/ovZJGnkAw KN7lla/0p5vAjXTRbbfdBmk94xnPWH755bv5IRhInYcddli+RNtll10e+9jHfv7zn1ehCTsQ6qmL Lgro+PPaa6990pOeBDYlKeXmCiusoKD6IRUQbeedd/67v/s7j/zp/lJLLRVAJsu12GKLyV1Fo6rF grJXXXVVN4k1I/pG2+WXX6658847LxVCmRJmZ5xxRhHau9/97re//e2l6SuvvHKLLbZ417vetdZa a330ox+dDhmAlG5MjEcdddS666673nrrqQEIgw2/9a1v6f8cxJ133imN55EX3nvmmR/84AfPOuss RY477jjw101FZOO8AJ7++Mc/VuRzn/vc1ltv7RFADA374f9LL7kkfkog8Y6X3Xftvffemnjta18b H03yH/7wh0PM+uuvD9Qe8ba33XjjjVw/er73ve/tuOOOwO7rX/96f3YD2N///d+fcsopKbjJJpt8 6Utf8g5eVMvVfvOb30RnuHjnO9/58Y9//MQTT+TXtKggPaYgshU54IAD4PK7774bLncfm3D5Ouus o9rzzz8/pVyc7EEHHpiCr3zlKyUmyY2pfPazn4Vl3fc+0fmhOCCeePP6170u4go9fgPE4Z23RQyN p06PbrnlFhbI5j199atfTSBuKhiqjj76aJJULfSsrTQUpZDSV7/6VYx/+9vfNsBQ24YbbuhplHL6 6afjQkFCKEr0gtd2222373//+3H9GLzpppsA98iNXphfErqJCsYqE6Suu+6uu+6KfUqMRn7729/q X+5PKHG99a677joGpt+hJ1qbIGmO9hXB3aGHHkrvhkAT1rLOOv5HpKeSxF/64hcDXv1P+1QfYlT4 yU9+khGGGAZ55JFHRm4ve9nLujasoCbUSSky1kPYetBBBxEpDX7jG9/owheyvfLKKwhWQUOaovfY sETC7rvvri16+fGPftQ1RW9SooLM6bLLLuu2qH49jl2FC2Mztk3FRaQ0glTjTPd7WB95xYZ1c/7B /9qK2RQbRi3TZZnEFdCmP0a5WvzABz7Aj33gvPMU4T3cdxMXTMtlPIm8DIcokdEqNXGtuy4vR3ru RIkYedWrXhUlHnjAATwtM1ZEz4qZsfwoET233nprlKiUnsix06P3e8MSpFIr9rfffvvbbru3SMGX X/jCF7CvNmZfRNqz4fQsNvyDH/wAnbff/iWSjM3HEaHqIx/5iFKaJvaIRbVhX8cPwPr0pz9NJuny m87pWd5hxgFMDCbvRx0qYcCaUy3Hmy5fbBgBQp6nSOL00q9LFz7++OM9akBqOtFq9rwzK4AUiMDt QjlQEdFkEkqfB6S6yR43ufuHPexh5st6EtRdl1566RVXXPEf//Efy6Ovf/3rK6+8Mr8sKwPiMF8m y9l54d/+7d94GY3GXnlVrbPpZI+EPb3l+uuvD1hRCnxBjz/Vr2upM6kyjh5W431CM9AARelCZgbd mcFPWFXFbal5ow03FLnDoznN5z73ufBNYVn/fMlLXlLmN3ko7l4/33PPPTmL6ZidOgUwM5777bef tJyw5Dcv9tSnPpUvFkdJ1Z9uegS3Scg95znPged8ZsJfiAceeRmAeNvb3vb0pz/9u9/9rlSfILrE EksArwRLKaLvKqusQm4UF/xBqjQC0LhgaLOxL3jBC0AQxHDEr3j5y9/znvekxb322gvqvfjiizPu p1CR5jGPecxKK61UAlsCyfvOOYdOFVEQL694xSsUpGuvQQbAsbbyiGCXWWYZUBs9ArAMJfrD/rtO PFHwwxFGRDJ4HYM77LA9ybNGCJUPRWQA3xvf+EaiQI8AwyFy1qrlFj/0oQ+Rkrwpj7naaqudeeaZ bNU7msOjAYBKiOuJT3yi2L///vvjvYBIikNYYV9IeMpTnvKpT31KeHvWs551+OGHv+51r3NHozhS P2GihPo4fRSiU+ZVfF188cXR7ymQ+rSnPQ1rqlLDaaeeik6gATEuYQm/7z75ZO8Loujx42tf+1rS SwyMiiMZJCH7mc94RhjR6Gte85q3vOUtKIlgdZznP//5dMQAEIy86EJBUGPRRRc1APCIfOAPDakH ne94xzsMXZTV95nEC1/4wohLMD7lPe8hf4neJEJ0N3VG1JSiab2PltVJiaoa2jAoSeDK6s777buv zosdNt/NLXlqDPbMZz6TOgI9S7ZDWaJQ5OEPfzhQznt0C+IUfn3SE59Iqsyyi8AUlEGnHQVJjxtJ nfCHiyLYfNi3ZgDLNJKuoaBxmjtIZfO5mftY6NowBPa85z0PlKEI9aswNkw4NEKtlM4hxAC6SmQ/ CIYhfLGr3zE2lDz5yU9mzPrFkksuKd5P5GJ//Wtggi0VJTIPdeplBK5P7b33qxFP9ZqjzTXmXESE En1Tl8cFjK4XaI5Vp7eq+Z577oGEHv3oRxtOpyuVC7jhh3WHRz3qUVAyGsojctOLuWKSgUIoMY+I CCYDuNHJb9MyKBYbRicvyoSMr6Ai1oIqxvaWOaideb/4xS/mKnV/7JMnYKfbUqU6jRV1Je/r8muu ueYZp5/+vGWWMYxUpxdInidkgQoec/TRfBRmVahagsXXhA2vsIJGGT/TYsN4gYP9ZvC6PElSliDF i3rUgNR0otXseWdWACmJH+NRUIbbAlDil1kS59vL6zA1QAo46EmQ5ckS9YCUasVvroG74TjEFS4p iAdg4oZ+9KMfJefEuXvKuAN99I1vfP3r/Lg/pTEMJkTHZKQAMgN63lM9vJVZRZOMgFfo4c0f97jH wXkcsbQKzDFTWArlopQKue+zzz47zRHO1Vdf3cWOPSCV15DK/U0zI2Vm0Kwl/MHbUgE4gnGdXz// i69+FWgT8/iU3Oe8hAeeiBMBpIAkvKMHSDLkJV6u57vf+Q7tiAG8D1FzssIGMXJY3C5RizfiJZ/F H4l/Lo6VDchAypBcc801PDsfGoSHJC5YvElo50x5eWV5Z+5SPZk34cIkSzRk4JuCqjXshodCGO2w Ja1jRJ133HE776ktb3J5wjzUGPa5e3Dkve99L4/Pp/OPqoJl+W6AlWEIV8xVuFUDHbErEvCOGOAp CXgkaWeQCr4jUs4G+2xShFMQF+z2c7fdBhYYOTAtOScCzMyI4T72P33ddf/H/oc/DJ6KB4AUlKY5 KoBXkIplY2IEq1aQ48Fpc4vNNwfj0CMaSeZ56n0NzUmuXKl3UApKACnScAlCDIzxCyqAF661YoTj fQURgxcMRvvMUjQSKd0RDxgn2YZ9aAXM8hT75KZ+vBQu/AasVYUeARuIxK9SytI+b2CaHg1gopjE zt0RF9mYcYJ+qpQEIR6FbdYVJUIJ8IfEm4JcBAP78pe/HCUSSGyYWlmISw5bDPYa4znzzDN6U5Ac Am3C/SIcCZd5qPACebAl3BF4KZicDQvkBBi5HsGeS1KK9CSitKUgeKfbqirDAGSAHf5EJ/aBAwMV kCuYSUGpLBFar2Q50jyIRw9Yv/erX00mXgv7t3/pS8WGxXtPuzasg+i2KnTTABLgI+0oEUf4vfXW W9xhD3wXM2CTd991F1+33HLLIQkZvBwleqqtFMQFr6taNDB1RKo/XTjJOcryMpAE3rF5qkQhD6+V JIECJc0AsAE0MyGi6CaltHv2WWeRKptMorpMjPpBv3ThEdADG6VCxMMrxGU2g2uKDeuGbJipsHmw hiERCFNBlSHcoW9+Mxa0heCoht1COeKRnqKjqZMHAOV1+UMOPhi1ehZsiuYAKe/Lv2LEoIglS7Ua L6lQtcSCcjasy7MoTa+++uqxYf5c/Yrr8qutuipZMUhe1KMGpGYPSJoOJbMISBmrCU48pmEE2x1J /VwBKbarO7FabvqQQw7Rqbjv3oolHcmw2CPxdbiYiU/n0XgZrqpHD3eAGHls/bOs4xaA4TzdDATk LvU0XWWaq7yn1hbXbGilKk1gavgyxKb/a5S/Lsu5CpDSh6cJpAiBCkCcMtrOvBs/cs89P9bhhVX4 JhEi2X5eA9ARA0RxmINnScyGugw9ORd3+E0QhPM9+qij5AwEbySJ9Irzm96XJC/5JL7VfV5PQYhK aBcaM/T3f8Z5WZ3gf87u2c9+tkfXXXstPJH8wUR25KCDuMhuskH9RCcCiSUZaCZAZkWRItj0v0Gh 8IydkmwIwlAzIsUV9Qge/B2fKNAK50qhlqURcjdnwH68mYk2ODLIAEjFPqYEmAApIjXWJyg/4EJ4 jl9231OKoI7CBZJQYi4G15AELJKpbe57IuScfTb8gTz0CFpQ3QS63Xjj98+ZhFK51XXohCEiMeh2 jdVXVzmqQO1kpAyIQQE1iDeCSmlFQd5fakFfyNAfMckX3nD99QoCf8kZRG7inLIE/ptf/1rQkoro cqEgeIcSKpBLFiDLmhI/MAWqUoEAiX0AFLaA9txBgAmsZEYlS+C2MgeaGStJYg0J+fKdQxuGCZgu jXhNqCMfBiZ7UbQW7AJG0LXf7CRzwWGZ8IF4cXoiAO+/PyxVCqoWFCZYEJ92IAy0FSCFX4BJ91SQ 6hmYqlLEm94Peoh5C8kGJLmjYHhnM8J88Ad6vKNgFv0MbXjrrbbiMQCang1jjXXpJlovSmTYWsm6 Ik2QvKbZuVEZ3gmZ0DwCAY02i0ijffQwPyRBKgYtBVZOTJ1/4xsgIBoowswd+gE49gzfkDyvm/7O TjTEBjTKP/MS3QVPmmCQ8Ie+w0uAQeWpHwxSetsjBua16KLYMENVG34pgiMiZFwz14y3yWfbbbaR hDPc4rGTkfK+TqES7JMwwhiAYKROTciSep8e6Z3lMGnoTZ1ewD45sNsAL04YtfEnIGY8HiFoNDbs BSJlKks++9k8ko65ysorawUyTlK5AanpwJfZ884sAlIytGKMQZsBtwgUGbFXzlF0SWpnroAUJ2VU Lc4BB0YS3B+gpocX6auTK2fxRqvD7910eKhF/8xsYPcCaMQYHZI76OIkoREc5Dg0pxeJcyKBvlep b4EfFtSxEQwciKO9CjVhMKd7n/Xes3ooKhmp6QMpcuBZRNZuaEkIITq+Uszm70uEyAJVF4fIb3rB byI1zOVQ+AVa4CLJGRTjVQOkklji47JUnWOVYskYXbu8Ty4qyIcIv/3Nb9JQeeSHEKJRXl5ePeki 6k6Y91RKAPQccqE58uTv+C+lxKRunZyycapxcyJNpslyqZmjhBTd9IkDIIUdfvnjH788QUiY+dCc FEtClAuF6kGkRIKxJh8aIIV9MIL3RAwaxAnDX7gT1kEV92qkm7KSPXRXwl6q1ZY69RHi9T90m3Gw nnLuue/P2mGZA1EHhYCUphXRyte//jUFNcHgvQZMAFJYowjqUMpNIdwqKFg5QAp5WtEBhRk4CVrq JgwoBb8KZjQvPHSjIJJQPiGus84SdbrzMllupSqdC/GCUKm2rM91BwGwKWAUMEEF8oXyEFniRlz+ L+kiBd1Hj0YJWRpjqP3kjTStZhNPOg7UKM1WkDrxEpqRFXPyMtqIK1mQzBdDq4CXDi6gSjYUdOjl 4A+qpEHOQaky3qBxqgfus8ZAX1BVgJQi0t4l0VLY98OFsN123RV6E4klcgJVCTY2nDVPQxsmLsO/ oQ0jg9UBHxFaxg/lUjPuEKNOVH3h858HhU2n6sikyjDk5rvmHe2rJFlVEivToIULfBkkfPiiiwgq QIp42UNhWXGY2LSXssafJs4K/lMJDwB/UDo58BITlnlf//IDgmd1HpEnlqOLCRs+/3y5Ui8ARl0b 9ogXNStH+AFSBGLWglTDhXpYF36xD9wTr56SOvUy/s37AVL6Mj8sS+eRF3QuA6EoBW7TCprxHqYC 7gOkig1npJH6iQiQmpP2u1m1HjUgVRk053PxWQSkskaKo8lgNILgxZJSCj5gdlI+ZW6rCGvk1J7u YekMcAN/uIzRTWDrHinlDtMHrTg4Q96e3N1RULDMsq3ulfk+4wYBpge/jGJNHwhg3uejjTz4FxGo UqmG9To2qCSvJldhkkjKvdQpN+bRnBmKM0d+ITgjQCpudwikCmgooZGPBqQ+8+lPJ7Od0JWY6jK3 lVUsCcBxUgFSBCVgG8DBr8bu5ok4XAPBACm1cTGS5J56xJ0ZLqtcWst06l577kmVZu6AhoSHkUAK tSUIMS0EWK8qq6ROzlGdvJ5pCEAquSI4RoumVNSmoYx3GRuHmww8mhEW3odAqgz6ecYk2AKk/C7s F5AqnEAGNIv+hMDJgFSqDejEAm8u3gdGJCHkCmFaCZAKvEgaLwm/ZGUAKa8Ff6Rg8I03ASnSKEr0 zhBIFe2rbQikCuwbAqnCghZ7QKprURpVM2oDpGJCmdIdAqlS0PsjgVReUBxmZYQWltE48C34Mb9A QLxnCti4y+Qg04KWMknnkShrZCW9wR50SWUF7KAHJIE7iyyyiBQa7OuHqBm84gVhmHwUUVBxSuGI 3B8CqcKFH0hC2PLLLQfYIdWqMosFEa9gAVKxYf2l2DDoICEXINWzYY5C/hgazlcj/FU6lOSlyyPx G5tBEnC5ygNGaWEIpIoSmXcPSPWUmOnmAKkoURGqzwIpMnn84x+PErK1mCkpsbBvmCLZA/Lqnpas UatuiymXH4Z8XLpH0r1yWl6OSwm80wQg1bXh4ogYeYAUSkoX9tSfCsI32Df2K+zHTaULB0hlhBAU la4alBZ0my6cDoWL2PAEkJqTiSw9MV3YCxNKmYNu04XbV3uVEXP+F58VQAo00SXKYvOuFEAWixAN AQNZzKA/8pGPFAB6kjKI0d8Al+7idIBGWYFZ/XCYyQtdUfcIimKsuiWINkRR5r+5fgNHI8teQ0CJ EedOO+4IRQ2/y9MN9AdRVv16i9y7SrofEo6nYC5jYjg759JRjQtFkVSFBktts9Z7ssrnCkhNTO3t vHN3ai8+MR1e2JiY2ut83V1idhxKAtUEkJqTbulGhbibAKluqsBr5hr4dE8BKX5KAANTnvCEJ0jM JCNlYKp1Ec7o3FMhkM+lHXWaCKZHCzLAHTfB7izE4exk77qZhnARfydjHx/3+c99ToViCeNxk0fL Al5QHiOSi7vvtps7ELkKE1ALkOqmWPwuU3tFFIEs3QAfIBWc1L20xa4CpMpEUpna63FRHHECf4CU 3yVNWGpGVQFSvRYLkOouDyrvCEIBUiXHkJkUUmLP3TBZMlLyHKJ+mdqLJSTeZGqvy0VBbESqmwRV pFqPgjuLGMv0VpGbmjO1B4gUcQVKJmb3pvaKDRORF5ixzw70JqDZEjfAQhQPeYzHWmLmx5wYFcMy NMosMDJkoNnb6177WgUVF7xBbeAjti0zai0mczJm84M2Q7AXQHNssm3ZL/8vvthi1odJTshesDqj tW5CLjEbMcxeQp1gERlSkX3TjTdiEKTL1B6WJ2x4jz1iw27qSlrPLBKyY8O8HwcLsoBZmdpTUCaS 41UQI8rqs25m5VaAVMmTEVqm9rpz5VGiIl7rTe1FiQETET7pBUh1e0SyMgAiGlCCWR+EGihqBQ18 GnG9+EUv0pGVxT6fADUmBS40kEYe+d9gzI+ujRFjgFQxrWK3CCtAqtcvsE8p2L/j9tsL+90uXIDU sAsHSOUT195T7Bcg1XuEPCoTOFhyunDbR2q8QPkglnrwgRTMoW8zXFN7upNZ5y7yMF4xGNWdjKql iOASdlxWUEFX1nsef9xxPrswBDQ6kc/3p3kNyIk1y9MAYYJ39s/0QzdOuoi/Ex3NjouaivhMKXNn nup73KVEurS/cfAJx58AumUjBv1BPQAZBDbxudBxxyWpGxVCIaZ+oD21qZY7M3CckTVSSaq5LK7k zdOc7J1hotgc2ly4Ax97s3tK8cKXX3bZdOwMiJT4EUKsDwgi4e7FWuxAOUbD++y9t7xgFpu7eC7x lcAzFuRYPRKZTNaIH90ZQG6iLDb3I+8n3NKssETXisC1+FKcu2cJnDv/aFkMYrAp/eYFoe7jl3/c U9YiUcTfZb2t4KqeSy652Jsy9lCXpaYoDBe8J4XCoHw3p5whu1LqhEcpmpkhLOuUs9benwSCC9EO +xkK8+9ZbO5H0lG4wI7KJbcYQ1bjCmM8sixF/CYiy2Jz1ZaxbJ4mpmaBhbK5qU5dY9dXvUoqKFy4 cA2X3HnHHXG7WjE2SGjsxq3ARHaOTtOISNUdugiPiK684gpGrmb6LY8yoFdtFpsTe5SYtb1QIPmE wWhfB0QkvRMgqZJSlqJPrJv+3vfgYFzcfNNNlGj1SSzKpQZ55czo0aBUK/Ky/NmjzL9ERIqTWxab k1uSakiixCzTjskpqHJTP6zXb/2CDdsoYWjDivMGlBU6scDGoGRJo5gNE4LRkTGxZP5nP0Meg/em 8Qw64YnoIi8nM+ply+A4E8BOtVG9P91EwF13fUW39bIiodN9gx+pC/X7oQnMltXfIILsskpAZIQh Ly16gTwRTx/qJ+1k6WLDnKE/9fQ5NnxOWWsfG8Y1tERopnfhPPWrDSUpKKHFjWT9U5I0Mkz4QkO0 jzzK0qFsdVGUGEbI3Pv8IX4VL0qEDvnGZJ6ixCw27ypRwXyoyFYpUYVUT/5cCou1zhKPhFC6MAZp fE5G8q/94JSKHQLHXmaxfGCx4Sw2LzYcmM6E9Au0mcRHTOnC6XTJLUn8cya9MYP7uGADwsrILmwU ZEiTPFNBS2GfnLPYvLCfF7yMvCw2J4EA6AakphOqZtU7swJInXfuucZ/uoFBiS7NsouMdHLWpkfp qOKcSa7ukiPxT8+0rRT3YVAijPnhz5NPOilggtWKeQq6byVj2RdAJSpURIve9w+GMxsVICUtkVS5 gqn8nSeckNlG/Za/0JDAkIL777dfslwlRSTecH/6vH41XLE0tvo5d7jBGAs0zBoy/mXZ5z2PG4Le PHIZWBvAFTb5MjeFAX5BN/Y7n9hMQUO8pA6vKrJVuRHtke94B0mACBwfIKIqA3GPXKAkUYheHnGa fng/Q0xa4LhLGCYlMjElKurn86IyUuS8RBoe6qgjj1QnvGttGUzM5aFWnkMS6/jjj0uLygoScJ58 FUTr5SSKtE7gUhGWplm3RDhBhABTuADXUJ4P0BCGI2XdT52sB0TwiPfMl/Ph8R1vf7t/2UeKJ7Vk FYD2GYGhvxd4/MIFP2gayLSjhhTk6H09rp7EIcuk8nGooafmmHR3oHzGGafzzgbchHDmGWcUL0wX AjBSyTnsZ9WUcbnioil4YRxvCOGRNRxlDO2pFUteXuo5z2EwaM53jmoWhABiI3LoxKfgqLUOqWRE /JAsMQckE0N6RFE2kaJiH+7JbcQwXDh65SteAUYnEOoauMi4Bft4ERSphn6NuTUXXaSgegS5ZBd0 f4Fcox4FVdM+FgIlvSw++SJP8rV8t4UXoFPf1FBRYj7GjBJZO9BfbFjlXqZ9WRnigrQiDfyyJXND gCN0ZbU4OsknOJVpkaFBmiaIPR+uR1b+p0SESV8xbDYPVDGSiSD/138dnCd1imaUe83LKUhHfJEJ Pmr93vcm5pd1Fu6ImUW/jA3ZODUbiDC6TkEkUY06dRbhlvZ7NswvwXnYz2JqtnfsfTaMfg4WVZQI IeHl2GPv7cLEi4AoEW1qIPwke7IIL11YjKcvBbtKJCsdWUHg2/vsnzqiRETqxVEi7Ssl6WW9NllB iuEIkSb12FjAsdblZY2c5bfo0XhM9p3J5WVSRVvm8lw6iz/LYi/i8rI0KkSFVIJCSc+GI3xYDQ20 ZvROzkYppSeqDb6Ha5OwZELl00s0gDu4oBSXH9YzhbDYyamnnIJlHkmv52ZLUuo+Gz5WczGVYsPe 0bmwz6GZTWaiyFZnA1JjR8kHq+CDD6RwDr5I25RrKIskY0buzNQrm0qCh3KVF7o3h412Sw3r7Jbt kjpsrtTca65ewRyW5PAEUtxlF75AhQATR2Bc5X6u7NVeVkoJQrkP63B5c4rvoudPQQz8IT5xxDyF AJCLa3MITwaXnCZHLC2XR6Zs8il1Bl48qZsTu89vthmfaxBflolYi+qmpSe2KVIq2KsMyzhi0bS0 yClnWkS1wIRkhiJ5qpLsBeUdDUFOifRav+WWz6rc0ofssogqYKsU9MgoM07T/3AhhFG4EDPKl3oK 8sKlIKkKJ8JY8NDLtpj4akFZL2Qfy4J7wD5AqnBhCJ65EkKT5uRGyS3sl8+/E6UmFohssgl2vAMY uZn7GeJzr4UY32CDpJldxTj2s92/RgGXEhK8gCOl0IlaYi/Rix4lSt1XlRSvdzj3ootkF6JEL1A9 6Fymz4Qo4SQ7K+aC8ygoCS0qo5TyCCNWaqEzSrSEpTzCpkxGVEx36mei5akAnI8GEGOUFS6wgJ7u ppTUIQGGwqLEDHhCzBwbPrbIDTuQB4NMR7DuO1FQEzJ2PnNzpSGXLAhJJs6RcMQbcRFOZOV/Q5QQ FnFNZKDvuot4XfoIwlLQCxPbGp18ckyFMYAaqnJBCcmIGCoU9jUhHyPVF6qySURAAHCWbm7M4Kb/ uzaMnrAfs2HDpU6dMTacbA3smP0h04UluZN9IRNoOOzQMt5JOF1YQeYdMy7VQkjJvqQDMvjySD1l fRUW3Gf57F+11laHa2ZPRlSfLxzVIP3mtXSuOdxvdfHFHyNqT+WhQMMQ5vIDcJyzmeu9n2ESl38g Ml6KDWOTXoKMwyADjiNKKwbnpQt7B37CYFoxzC44MlPbuAhV3ikbqyLAa0YdocojOK87K8pDFhvW NMtPP9UcDXLgpQuDsJhtQKo+XM7nGmYFkJrPPC+gzWWl15zTmf+7oDRIbuLvztWdSUyRUiq/p0Z4 gJRuHHef2aIsc+lN0pVHWWwRJMEz8gLTLNWb21I8C6JzddFJ3F+3xfjEvN+ljTfPa90Zt27B7tqF 8nIpUvBQwuSQEQz2SuE9YbtcI7nwTpaMlKvH/hS8B6EO2dcipWQBbK7uaqdhqd7UXrfC7uzGFEoM j1n51GVkMva7a8iGSuwuQJmMEcQMVd8VOKa6EsBIl5ihDZeGsrg+RttrAmsBHEMJR8ilYE8vnhYD Sx6uexVTyWgkj6KUIftdqrqm0rP5oQ13hTNZZxypxMJUr1RXngFzXaZ6SpzM+CdTYmGnOJCedWkr 47e80K3fo+Iluv0r4pq+I+p14cl64rALdwmbwn1NbcMjVd+A1AIXoxuQWuBUNm8JLkCq50Dbn00C TQJNAk0C80ECDUjN2yA3D2pvQGoeCHVBrtIaKWlqPbldTQJNAk0CTQLzXwI8cNkAaEEOJgsR7Q1I LUTKng6r+YxFfrtdTQJNAk0CTQLzXwI8cP02ztPx9u2dmZJAA1IzJcmHSD1ln4X2o0mgSaBJoEng wZLAQySiLBxsNCC1cOi5cdkk0CTQJNAk0CTQJDAPJNCA1DwQaquySaBJoEmgSaBJoElg4ZBAA1IL h54bl00CTQJNAk0CTQJNAvNAAg1IzQOhLqxV2rvF1sk+crG9ng9PhmcRji0YmzKoOZfDFmwh4/+x a7Ndfr7EKXXai2js2noFHZYaIdgW1RY1M7K1vU8pC+82ORyeDjlXxNOLPVe77M/IV0KWktgEKNoP tXY5qtyWNowjz+XHDK7AdQxRodPmn3MlwOHL2LSrUIyKeG0dFPESSKUEtIW8yBPB5dCCSoIdGlPY J+RcNXXavi4bfJdq7edUU2EYj+p9AZNtKusdC8ZVyP5L3/dnOWJrPILxztS7HQqdlqiPV1srtSBK oAGpBVFrs5Fm3sQpH0svtZRTR5yz4RQFzmVGCBU+HQ3mpDCXg2Ad6WAvYJubj105H7fWWmuh0/Ep qdbZDjMSTSGnnXfaSYXOsHPmq+NX64+s5uXtWK3O5y69NN5tNm1n5LF5V9A3QU54nWB/qaXCvuNK nOlRGfIBCHvuR/up1o7q9rusqdbm0U4LcTALCh0JbMPxGsZLWaTaIX2F5ZcPnbaTdsxcTc0qtLE1 3h3uBk/Q+9Of/nTnM9oaG2KrqRlhNukOnQi2J3j9+ARJzjxYfrnlUq2jG0nAGQA1dMI69vsmASdJ p1o7yOsONXU6sonqmZPjBA57y1smTGuJJRwNDp6OXa3zDBzVoqoQ6dKEzdDHrlBBAxub1Hd5R7Ot 5A3YaqptZRcgCTQgtQApa7aT6hgQwzKnAToMxAB9RvyIzJPTr5yPVk5NcYaD0/ScrTG2OOSKPve5 2/hTXjXViiIO36g8XlqEc0CEk4BV6EiKNdZYwyHE9UDKKTQOsAudDjZ57GMfWwmksA9GvOAFL3Bo bqp1EJvjXGoQD10oLhPjVEenfKRap8s5NEOIHVtTTkpRj5PInKkCl1em4kIGs4TCgbyc/uHKubk1 6S6826eRSG+84Qb1O+6N9p3+IdNZI1UkIczRvKETwY5PQXxNz1KWXhiqrEyqdagUEOBM0rHVpKC+ w5wYvJOIUq2Dxh2SUwP75KFBcxCfEyBe51Q6JqvSsQCRTmcyjirsO6bGEUmVvDtKCOIvvDvSigHU 8F5DTys7/yXQgNT8l/lDuUVumpNyktdMMeksVcN6c3mlQr951co5Do7Pkaglpe/gP4edVQIpPhrv TvJKXAH15KXqgZTjFB1blngsl+a0MjCoUryOz5MyBHH4euHK4a8Hv+lNNSE/9KjQqbEqz59OCJb6 qgEoqcfxhY6PrWS5FHfcnoyRmZ1yx6yW0/0kZmqawPtLXvxiANq0DrgDo9fLE9dOwO1Ouv34xz9G POsdm1SnAkO3YESXfeMfmHXsOlNQTtexxCBU/gT3QZ9KMOHoRmfhMVGn+H3yqqsqa7uXsBtvdGQe T2Waj3EaRYCSlbzr5s5ih/VN5UsiOmfayYwzQm0lYa34/JFAA1LzR84LSyt8h/PqpeJniuEZgThD YoyeOX2AjPfnBCW9HJlcCaTw7vDRa6+9VmbOpVpzEPVrpE4++WQZqdTpMl1Sk+OJKERTiIffv/LK K538SghdqDq27oQl+UiVpwZA6sUvfnE9kJIsdADz2FT1Cjq4euWVV+5RZW7rHe94Rw30USFsKoKC KWZ1K20pNIvxCOtSpRUDgAJVx5CJ884pZUZye73Wrd6Tk9OnCpBab731KsGEU4rPOedsAwmT+3DP GPwOi0jIrb/++sYkIJp0F7LrtxHXMeViWf5Xv/pV2T6ZSJmzGnOaEU5bJfNNAg1IzTdRLxQN9YCU cCLq1zgU58aXXBFPmlWxMkmuGoxiZG8VixVXyy+/PO/vtPb6tbHYlI2wfmu5ZZf1T0AFemp4j8Xw 0SeccELqXHHFFW+99VZzc5XGBEc+7WlPe94yyyz2tKftsMMONZLsUhIgJRUXNZnpkJObWSBFniyq hmDRDpG9BIzlfZWrxFBlCGERzxOe8IQtNt/c4uh61R955JE9IIXs1VZdVd5rbAO4++67LTMKFtdb S4eS9akEPQFSEn6p0zTcJptsUlnnIYccsthiiz3lKU9h/CBgjd6LxAzzFllkEbOQT37ykw8++OB6 NakZFAOkrLm06sAIrXL1+tjKbQUfLAk0IPVgSf6h2W4PSBmW7bTTTjUrea0DLUDKTAdv5RIIjf6h gbGFaHIEhLJ42Tpu8W+m1sWDeiDal+dcUlOWoNbwHu6I1AA3dd55550Wm0t7jM14CkppmImAyd51 4okG0DMSn1QrPMt2WGQdNb1siy2kf+pzM92MlCndV73qVSbOxpbAZEDqqKOOqomp8CLerb9R/9Wf +pTlQfXRdCSQkkqcKSBlNdvzV1yRpqToJLqsZB9bqgpKwarKUqFoX8fXy2pEqs4DDzwQ1vna174G netNJdlZQ+dNN93Ie0D5El1mjSspDCVyuli+6qqrrI7ywQFUWkNhK7vASaABqQVOZbOa4B6QsjzW yM9QdWyiASkLTrMiykoOkyafvflmYz6gqmZVh3Fz1kip5KyzzvJhVOWiK+RZdWEhvBF/oIOV17Ca fNLYvKfghRdeaF4j64shHss7PvWpT1XWKSBZ0AP38PiyaJW1leLAhDBPZdTkmhEUpXLfVJapPVCV 9ms+NcC7lVvdtWtkK/FTmZGaAFIvelEgDpEisn62FLZDWDepg2zE10zt3XXXXUYOWXeFwmgKRjG1 XbkJCFOHzi+79NLUOSOrxOZM7Z2DVN0T2TMyZ2pqT6qM0vmlsqKrsgvgXbbYVD46+ZaZGplUUtWK zzcJNCA130T90G+IxxdO+DsfFgl42auGf6kBE5z7Mccc47uqVOgS/vnBrOke7zIG9UWVUXi2POBP NXHiiSfWfAylHuxvsMEGq6y8Mq7RaTmzmY4a3sOdnJmpjUsuuSS8W4Z1zdVXj8d4SmHfEF/6RFRW Z+XkS5cS4XnVF74QflKtiFI/1jeJqSppA0Aq2of8IAnJubElwEQ//OEP+xLQD0S6PvrRj/ostDIr iTAitSwM11Yg+UjC52A1WB+DwjzeL7roosgTwfvusw/iaxbJIcm6Qwvj1Fb6lBm0ylVouLbqCHw0 2lFt5aYPUa7+iM4zzzgDLjE4oXR7CvzgBz+osSv1yMNttNFGYb+yy5cOxU1xdMaN0dTYxtkKLqAS aEBqAVXcrCObh7KUB4p63OMeJxOz9lpr+Sfr43flFk3mB30Engr98ymQDWZq1odCTqDYYx7zGKEu Xs+MDLDi47UasUIkVteedNJJUmjo9Hkdl10PU0hV/JAvUedLX/pS6+Ir5SngrbvuurZRWP0lL1En EFk/+5awZyJGteCjak1B1s9tWWdjlZXlXJaeRPtrrL66pS3wSo2mgAl5DqjXJgiuww47DGSpySLg 3fwj3hmn1VFok5ZAp7V3lQYAjqtZ4EenjZqkJyGAGiSBNnjXfh9ILX3KHGIljoQdTbk++tGPNu2u Wrtp1K9nBxmp3kzxbbfeimwYReXrvPSlNdtTwWGckjVSPBU6zz333BpDSlm7M9hFjD8J7/vsvXc9 7/VUtRrmpwQakJqf0n4ot8W5mzWweYy1QVdcccXll13mnw2lbIVQP+zj5VOhf5/4xCcq9xTg+CwH QadFQgmfsIWYLU1VoyFwxHpYQdoEBDqvv/76esbR40t1s4Q/ueeeyLM+xcXL491FWeqsye50xYV9 mUjVUpBqZwRESm+g0VSmT9/vNYDLLzc1U5npQbakDgT5qEc+8hGPeITdPn2s7gPGsbWPd0uYI9UE UXDHLhUzMhXFAGA+dLokvXwcULMjZXg0Doma8o+Bjc17Cmb3LOwzURX6XW/8lljZONQmtPkQRFc1 pauJms8XMM6cdPYYf2WXL7xbbXndddfNIO+V6mjF57MEGpCazwJvzTUJNAk8+BKQMbJHETABP5mG k+mp2ZxpnvIja2LHSHS6pE4vveSStpZ5ngq8Vd4kMLcSaEBqbiXW3m8SaBJY4CVgekgKoXKObP5I QVqru33o/Gm0tdIk0CQwfQk0IDV9WbU3mwSaBJoEmgSaBJoEmgTuJ4EGpJpB3E8CVnRms+92NQk0 CTQJNAnMfwnwwNZxtsi0AEmgAakFSFnzg1Rf9Nxzz48t8m1Xk0CTQJNAk8D8lwAPXPNV8vyIE62N +0ugAalmEfeTgHWsHIcDs9rVJNAk0CTQJDD/JcAD15+I0ALb/JTAQwFI/cM//L2vb4499lg7AZbN YNiiLRbtWJ3LZjw2+LFhWle4PlT2HayCvlrvnV9mFaodRxTxmczQpm2Q40ufd77znY6o7G49p5QV rE6ZtS+LRh2D6mPdBWt/tgak5r/fbC02CTQJNAkUCTQgNT8x0Iy09eADKeAD2jj11FPf+973gj7H H3dc/p34zndedtll2YzEVtGQkJu23/UapPLOE04IKnLKgVMUnMdkD1x7QNvPI0VsB+xU2r1f/Wqb Lvr/2c9+tsNE7RtUpAYxaO5Nb3qTUwgUv+jCC7tYyl41HvlA2s7CIJE9IUtBG+45uuHNb36zkyuc dXr++ecXLGU7GXsnPuxhD3NgrWaRlA2pZ0RVqcQ5a929T9CMgCK0j33sY8PNFe3uc9ppp5VT2acm pgGp5tCbBJoEmgQeRAk0IDWDEXP+VDUrgJQdpYGehz/84euvv/4ur3xl/sEiyy23XDZHtpHxrrvu 6qaDIcEUh3v4M/knxzvYk9pGbX7bZ8WO1dmiV5IJloLSXKCVzaadrVHwkJvOf1188cWzJSNk5pSo bEnsslmfw6ccIgED2Q1vySWXtMducl0w0+mnn/7MZz5TvgpkUdAhnQ7cSEF3sr2vytP0zH5fTQ42 z83hUy6bJl/8sY+9+tWvLkKzobCDM0tazvvOpIP2sOA0zemYVANSD6IDbU03CTQJNAk0IDWdUDWr 3nnwgVTwB2DkgAUzZX7nsmPe8573vGw9B47kJhADSDkV1W83zZo5Y/ypT30qy/OaVM0znvEMO0rn aQEx9q1eb931nLRQNkQ2qed0LYcP/GLOnrnyWCqx8V2K3HTTTZCHUxT8hqWcy7HNNtsEZvmCY7fd dvNndte1O+6jHvUoM4Ap2AVSM65m56FKg8FtNg9M5RaG+9MJpkVo8lWrr756mUy0L/B2220H1UmP maOcDkkNSDU/3iTQJNAk8CBKoAGp6YSqWfXOrABSMigvf/nLA6TMVYE1YIrskVRK79AiGSBAylFr EaL8kIm5Jz3pSUAGMOEwgSc+8Ym989K9Jju19NJLH3fccWXyDh5adtllATXHrnnhzjvucEIcTJYX vKkVU2bJ+shyqTbnuqPHCQOOg0AzjOVNUCZvBkhJfUmtvfmQQ6TKas6E6lnJj3/8Y/OPjl4x4ei0 tTz1iWxv2tF5LC95yUsKkELPf//5z0g14Yie6VheA1IPogNtTTcJNAk0CTQgNZ1QNavemUVA6pGP fKTTr6SFJIqsf5Lj6S0AJ7gekPKON+WHrAGy/6+DFKCxtdZaq7cJB+ThlErrh4roASmzhICUJVZu mhkEpByzmhatIgeGnJEeILXxxhvDat/5zncKWgJQvAm3bbLxxs5XKqug3DfR5hhwRZwJKun1pS/N wElz2pX02n+//TQqt1Sm9tx3pyTeTIOayHMCa++c1KzcakCqOegmgSaBJoHZL4EGpGYVSJoOMbMI SEkCOTfeqZxO/M5UXXJO1jyV4+57QCpJIOcngFBWo5vUc+L6jjvu2P1QTj5G1gpmsqaqC6SGGamd 78tIHX98PyNloXoyUuWyLmqNNdYw19b7ag+uAukQIKMmWbXuuusm6VVzyWxh8EMf+pBKLGA/77zz erVBTqYjJerAuOHB4w1IzX7X2ShsEmgSaBKIBBqQqgmXD0rZWQSkJJOs5rERmRXTOe7bxaRMlvlS Lx+j+WoP3ipzW3kny8mBCV/5LbroorZCKKutPbUuypzdVltt1Z1os7poww03BHR+/etfe8eMmJTV G9/4xhSUFXv84x9vCXyQnDehLpNrRUNsfffdd7eua3h6qBpCqtlJi+IdLF94GVvB73//+zbaaCMf 30GKm26yyWte85qQnQvvFph7YY899iiLwLptNSDVHHSTQJNAk8CCIoEGpMaOlQ9WwVkBpLJGO2uk CMJMWZmuuvPOiUk3SaZMukk7ldVLXZFl2yeLmTbYYIMecDH3Z9kQ8NFN1ahN6sjK9EzYmfayiErK Ku2qwQJzK7SgIpOAPugz2VemC606P+Tgg8G7YapJwQJxYCyzh8s897m//OUvK7V78803o2e11VZb ddVVTTIuscQSQFXqRCF0tfXWW//N3/zNZPssjAek4E6L9KUDh97HTULwwkjH5L6nIwsiUp2k9Jd/ +ZfDsgSl4F/91V8NH0nvKej/YUHvK6XsSGK0paB2h09TcAwusKbOyQpOwUVhfySpKTh8hOXC/mRc jGRfwSnYH1uJYX9mlYivyZQ4NRdTa39qG55CibHhkaY4nhIxOIUSp2Dfo3mnRGzObU+cThcead7j 2bCqosSRXXhsG56OEqd2RCN5rHFE3S7cgFRlxJz/xWcFkJLsAYB8/iYJdNddd3VXOPkkzZKj7bff /u677/ZJ2u6777b22mtbPB5JwT2AiyK33HKL3S/XXHNNuaVuOso7MId8ks/9ejsR6IQafe+ZZ37x C1+wgluGqSAtyOPoo4+2ZEq1NoLSokVUaVHK59BDD7UrlSSQ/Jn7CPu7v/u7PLXhgvk192+//XaJ MbjHMqlh1mpu1Qz2yW9p2ioo6ToJueyVhVO8b7/ddvZoCHdYIMwep/7EC0am024WmxMOLm688cbv fe97PUjEv8CsZhLxPkRL7lAB5Gfrr54n8ghsVSeaR8IsmiJwrQ8Lwrh29vL/kBi8K2U6dSTg05YW tTssiEJ0onboMb2MOzzidEgMmaiTfIZceJmVqhZ8HxY0O6yg0cKwoHiGfZtxjGTfNhYK6gtDLjTk 4wxfP4zkQk9R0Aeww4ImxDH4pS99aaQS3ceFd4ZcqE2dX/7yl0cq8fOf+xx1UMqw4De/+Q1KxMuw IK7xTgLDuO7lr959txZJb8gFa0cnmY9kPzb8/e9/f65sWFVj2zA7HMOGsV9pwyOVWGy499Sf89qG e51Ri/RO+2PYMEub2oY52/FsWO8YacOUqE/95CcjuvA3vvENxAxtmM1EiZPa8FcnbPjb07PhBqSm E6pm1TsPPpAS5t/+9rdDSybCbBy1xuqr64RFRpABL3nWWWf5jH+5ZZc96MADPS2L0CEJeGXNNdaQ rbn0kksMeobr0y1msvEmZ9qTu7KCkE/8lAXgrDrv4g+QRc3yQHvttZf4HeDiMjxad511rOVafvnl 0eOflVI2FM1TM4Z2HLDS3H3smGp0Z6a2kkIhXmxwJVWmWs0hEvFSa7q3Ry4L5KHDskQsRXR7E3/H HXus3xzZ1MdhBkhJtpkPlf0CvwwHu27RyMl3i/bukgbrPcrA2rIwe0nwRL2cDchrztT3j7Cg+rt1 ckMiKKlCqKTdG3162U7x5l6POvJImLVb0Js4sleFssPgraDlcda3QbdE0S2INpHbarz11l13mFtC Ku6wj9NelgjLNrX3SJbUaz0uWKBvHRZbbDExTCKh+xQBdp3FhW04euzz5iCL/KW5ZhGuxz6WYXcF 3/nOE3oFNQcpylCC7CrpgQkFzT4TuNV1QyV+5jOfMQ8uiTtUojtmkKlYsnOoRLWpU81DJaKBQZrO RhXauux7WToZF2859NChEnG9zDLLkAA59GKb9ZHSyQr6oKTXIgkLoragI/NhxsLLdIRU3bDHI53q p5ToO5Uh+yx8vfXWY8MspMc+JbIlFjXShnUcdsga9cehEo30Jmz4qKN6XHjT+0qttNJKQxsmK20p qO/07A1tIjc69bhhSjI2bM3o1DY8VCLFGZHaY49sh0o89ZRTEPO6175uMhumx+HoCxeHHHKIglzx SBtmMy960YtG2rDJCgK358tkNrzZppuNtGG2zcJH2vAHP/hB2reRzUgb1psms2FrVSds+C1vGdrw 97/3PdMaI23Yy7Fh4/mhDRu0kPZaa65F2unCDUjNKpA0HWIefCCFSukWM2hWR3GafvRSStloAHTw 1Js9XOJRTue2mGkkZAGtQIdenRGN9//wh4mmR06KWXSFJGClW9ZvJ8aE1FyKd9e2I8MLud/7em46 +pjiHekuqTVYE4YzCvemjUOFCnfcz2VNvfXmpV0xLzfLO3yELMsUrQRICRhWtSsl8dbz0dw33wT4 2rB0OBXl5R122EFIkCPpIQnOzl5WiAELerAmQAraMwkr8dALQl62Zz0H7f9eQW/KNtk6S9lhEPKy trT4kQ9/uOdq0SbrgE4C7NHJkXkZgCZnnPbYD470iHx6deICPdtusw0MPUQSApuvBHBh2NDjQvyQ HrMbLUBAOz0k4WW7bODCSsFeKNUclOz7DJvNar0HpBS0+T4DgCR6mqJESFfUl6ocxmAvm7k2o+2d nnA8UhvDsOP/UIko33zzzUVEVA2VeOaZZ2JfKBrGYOOcl669NgmQQ499L9vjA/uk12Nf4JFUsEWt 0cXfDOagvQxGI9XXtUMl0iwl0vLQhgmHVRAOCxnasL15EQMODtnXcWLDNrQbsm9952Q2zOZjwz8d ZPK04osWLVp+MJkN63HDwQC+cCeuD5EEaZAJ9slnOBhAOXy5yiqrkG0PSGUshBg2PFRibFj+fpgC 9LKTuLA/tGFNsBY2s8UWWwyB1HRsGNKawoZvGWXDxkJj2DD2bS6IfUOCYRfWcwFQEHxow14+Yo4N 2yhnlA1/mbTJnOQbkKqMkg9W8VkBpB4s5hesdsEmnlSfdAW6AYJA26/dve/SSyGhAihTJKU88sP/ Jbs2kv0AKf2ZO+AQf/rTnwynzLzgkRdGLhSQVPB05NoLWMcj0zEjC/JEno5cBiR36JH/Jyuo7MiC 2lJQu5NxgdqRdd7H/ojzm0W7sD9yFcVk7Hu5sD+yIBZGcoG8cDGcLvSInD2amosx2A8XI4+vDheT aT9KHLmULUqcQvsPqMSh3Ar7w5V1HRsepcRqG55MiVOzP1KJ9Ij3kUrUyhQ2PB3tj1TiNLtwj8eu Dc9tT4z2h/NlU9twUeIUNjy1I5rChn/849FdOD1xChueQok1NlxE2jJSC1ZoRm0DUgucyuYtwWVD TqPDkmruOU3ezaORywu8aVxVhlZjFBzpoEPM1C1OUXBkzEsCaeQiVlVVsj+SmOnIbT6zP5lI3Z9x JVayP/+VOFmLNaa4ANnwvGB/ZJ3FaYzRhafQxbyw4fnjiBqQmrdBbh7U3oDUPBDqglwlIGXwZzTW riaBJoEmgSaB+S8BHthUw4IcRhY62huQWuhUPjXD1oQlH9OuJoEmgSaBJoH5LwEeOJ8TtWtBkUAD UguKpuYTnbZ+sIiqXU0CTQJNAk0CD5YEsqtzuxYUCTQgtaBoqtHZJNAk0CTQJNAk0CQw6yTQgNSs U0kjqEmgSaBJoEmgSaBJYEGRQANSC4qmGp1NAk0CTQJNAk0CTQKzTgINSM06lSy4BNkI1Nam5Zqp Ld0JxK6qpdqs4qpZQ4AwG3F1SZ3BrVPtyKpm9Wtlsk1i51bFhf3wPnJ32enXOWQfwcMjAaZfYXkz vJfLn2NU0i3S1btqKxnv1kyShc6pd1abJgtdvRfrqpeA1pHXNf5p0jP1a132CTlXTc1Do6rnvTBO 713fUuNYuowXqVbaVXp61/L9nkGXUqOXVnb+SKABqfkj54d+KzyUDX/ta7zppps6s2KrLbfsnR49 tgjUbDPxtdday7911lnH4YZ2SXbczdgV5gAcdKI21b7rXe+qDCQhhgN94xvfoEJbY/v0xsbi9Sct 8vI2Yp6gc+21bZhOyOWsyfEkYF9W2yh32XeskEMzxqutlBL28KtaOopU99lnb0cR1FR7zTXX4NqW 3yhUra3Ga2orZUU+m0NuuMEGodOpL5WhFO/O68S7k6zsbGS/+IjX/u+VARVhDrAKnYRgH/8aGBEJ qMFBTBO7kM+p9vLLL3fkgP9rZOssr7333hvXjtVKtQQy2THq02zIJvJUv+GGGzpuz+b+9zqWrbay jfs0axi+ZsPMzTfbzOkxpe9r4Lrrrhu7QgWdnGGP+C7vHKDN32fEpdQQ1srONwk0IDXfRP0Qb4h3 FuYvvvjipZZaihO5+lOfqgyikRcUJZryU5dfdpl/LmfVOUEsh+SMd3F8Tm90RtsFF1yQao855hgH 4VWGKNH08MMOcyScCsWAl73sZQ6FcFjQeESWUs5SPPjgg0Mn3nN8WE2dYt4pp5yyxLOedeGHPpRq HQjjxJtK9mnq05/+tEPK3vnOd6bas886y6HdNdHUzoQCvFD6ile8ghycBFLDeIER9hDfeeednSMZ Op3B4vyZmhynspTy7CWWOO3UUx0n4DSnZzzjGc4DcfxtZbUIK9rXuV7+8peDAjWaUtYJNuRZ2D/6 qKNQ6wSbGtkyfgrSpxyiEqmyMSeZ1mT7gF0nrjgRz3E3jvp2EqXzCh2SWONYnO6FKufDXHLxxaET qGKxlbxfccUVTtgsvDvUyHExlRi6hqRWdj5LoAGp+Szwh3hzBmGGpI47nSk+hSIoCkQrFaqcy3aU YU0TjpVwRtu//Mu/pBKHPQtRNTFPJdL7TrB20q3ffCisBkg5r7SGTmWPPvroN73xjYmdUjKOSCuH ZI9dcw4ohKhUi2tnqUon1ITnUKJCh6apPH/KGjp2sCbspR65DRSOzWyvoG2BMHvllVcWfkETuTSx sKYJ6JxIYRSWedBBB115xRWVWS7EODddTstpuCEMwc6+dJgmFsYmFTZVAxPqsg+iSaCOXWcKwijO jLMhfv401JH1qQQTzvo955xzSFIi1lCnPr+LMCdIAk88VYwfTpXhrjR++2c6nFEyUj2ove222xhD Je+V6mjF56cEGpCan9J+6LfFdxiKObF4plg1r2H0XOnmhsR897vf5fT5ZZ7UZdw/U0DqlltuSZ0y MbIU3QOtx5NJgBTvnGrhyJqpjdBgZsfZuiDON77xDRgFkuhC1fHoVEqF4KnKU4MsQloZu8IUlIer zJd0CXBErpgnb9S9KUshi1BjZtjELLuS35KPrMnEFMKGVIGqiC8SHkOwd95552qrrVaTJpysUTPm aLMPeF648cYbzR5Wgol99933wgsv/OAFFzjruj65G8L0StNwCNNVzWmC+9+7D6qOIc8UMV5yjjsQ KXkmve0kHDiycmA2NjGt4PyXQANS81/mD+UWh0CqJjiRlLU7gFRckqq6V40cZaSWWGKJ7bfffrdd d91nn30kJOrBX9Zycf0Idh1yyCHCXg2RKfutb33rsMMOS50Oukd5fZ3i/TOf+cwddtjhxS9+8dZb b12fOwlJAVJZx+OaqYxUD0hVWhTs2E1GhvLDDz8cYK2pGTKTj9x4o40e/ehHH/ymN0lQ1avpyCOP hKW6VMmhrrbqqkxi7MotMZQsKThypjoUegCplVZaCZhInTfddJOMVOWS8ze+8Y3g6eKLL24lU00e risu6SJTkOZ2V1hhBR2/RumlWmlItW35spdZ1AVRzUjmbGwVt4LzXwINSM1/mT+UW+wBKQO1k08+ uTf6nyv+u0DKcpk999xzrz335P4EV8O+uaqq+7JVMtZyCVT86XOe85x6FJXKzRWYIbLkwmVgetSR R9bwXggWOFOny0xE/QDaDNTSSy991FFHWRS/5ZZbzhSQwqypva222oqaXNZdGfHX52a6QEptpnj+ pmJua94BKSHfVNR73/teU0W0X4+l5jWQ8tWC3uQyF3nggQdWfsQgYwRMQOfRvjpNTVZmZfT0LbbY QtKUGzHDW9PlS2+SiFpmmWWOP+44oAeRMwKkwrtk5GsOOsiPBqTG9swLaMEGpBZQxc1SsntASvpE wDZUHZvc7tSenPwRb3ub9IwBpdxMzQyXlEzSEpY1GPRffvllY1NYCoIjVq+XBdEWnSz7/7d3xjpx XUEYFrQGCcELOHJDxTPwDE6BhJDjCMlpocCNXdEgOY6EIypeIYVTUCNET03vSKz8Fv6SkVcrk+rO 3eUHfVcuAOnOzvnm7rn/mZlz/OJFZ+xlmS4x1tD1Mx+xvb1No0zT2yrtkTDDydluoaZZhBRlI1pw CBP/iN0oG5dmhRTqhBV/pwnvf0t71PX6pb1pfxgy/afnz/v/Xdr90h6ERyztIdDfch0d0crGpsib m5vOA4CYIDQIsoo+9c2misIZ8rvsqeQHSuTU4q+urjoe1r1V2uPJZLykzfoGsVClPSYTgs7Am3m4 UVzSyCIJKKQWSfvpf1Y1m19fX9dQycZvbm52Gq6Z7Oi3pWQ2q1dYStIx2qF5e3u7tbVVzeYkeFiY NrdAY4fZk7cRvVYlntAoNJv3hRRZKOboQoqQYux/tYUUOrKazTsM79+LykFMICPGNUuRlP1QZRPI lCPZDz/4I+7u7tBMpLWmr3lez2SSLi8vB9vkRsZOaa8a7ZEUFAqrS7pjk0Tpb2/eTA99wNrvHz7g /GQyGWwWoc9S5PT0dDYTQyqFE0AG26wbaTZncUKTUNPO7O1oaOQ4fyETeXZ2xq69fqcUGakSUiP6 SbM5ZU2E1Ig2NfWICCikHlGwol1lXqaqxRy9vr7+88uXtcRnQcmm5Y6QYsy8NVnmlsG6Dg8P2Xw0 GAeJdwpkq6urHFVQhScySfh5cXEx2CY3ko1DSFErZLrHSdpujo+P+2IFIyQMymaNvdkmxaSPblhb WwMCBimYjlLd4M3ERkXM7u7ullLpdzTT0IMpXlGo8xr+wcHBxsZGswj1z5cvEKBwRsGIC7ak/Tqh Z+zIJk6m4EFFT2CKZA+/oleaL+y/P3/GVVqtp65+beR3a4wUyLB59F9/fV0IqeYZXWSMeFBXVlao 52Lwz0+f+lkZgsISgo71kqc8TlTN9vf3Ozt2SWNzyhfHPTBT4Scd8Z24172MlOisPHtWY+dJ6I+9 75UWFklAIbVI2k/5s3gZn5+f//LqFUcHMaGww5zr19evT05O+s0i5AzKIBfGySd1UKIkUDn0sbIK LyHFa4+8F0Wujtl6mzJTs8UMP6mZ9FUU/rD9hzU0Gbji2c/38B4ix8Pw6bLHJkc/jCWkGDhmOa5i rOGTJcIUaQlaTyr6+EzsOFO0EynuJXHC4ZlLS0vMgCTnOPSos2+R0GOBsQO2UiaTyb95Lx7+ppAi NLzs6enBz+XlZYQaybmOkihurEP2v39JoTqtHQ+misqhMwwCrJ0wiPLr71flWLLqhqQaWwuVPz5+ REl3sryISL7pzFH1ODW/8oWLkXI6Ay1cNXbODu2PfXAgvPFBCCikHgT70/zQH3bVTX/tj3bE/Xrl zH3f6i9NV8vCiAOftTaKhz8Mf0Sb83B1fk8UQgrZhy4hw7G3t8eOyOYxp3N6oqDKKoL0CX5y7ezs 8LYe62DSEbfszTX602/lKI/r6JPJPMbenIi8fcEEFFILBu7HSUACD0+AatH7d+9IF9XpXFx9GT2n UZHmrEOJptecPkizEpDAMAIKqWHcvEsCEnjEBJBNzU7whQ0+WeQtDIIfJIFkAgqp5OjomwQkIAEJ SEAC0QQUUtHh0TkJSEACEpCABJIJKKSSo6NvEpCABCQgAQlEE1BIRYdH5yQgAQlIQAISSCagkEqO jr5JQAISkIAEJBBNQCEVHR6dk4AEJCABCUggmYBCKjk6+iYBCUhAAhKQQDQBhVR0eHROAhKQgAQk IIFkAgqp5OjomwQkIAEJSEAC0QQUUtHh0TkJSEACEpCABJIJKKSSo6NvEpCABCQgAQlEE1BIRYdH 5yQgAQlIQAISSCagkEqOjr5JQAISkIAEJBBNQCEVHR6dk4AEJCABCUggmYBCKjk6+iYBCUhAAhKQ QDQBhVR0eHROAhKQgAQkIIFkAgqp5OjomwQkIAEJSEAC0QQUUtHh0TkJSEACEpCABJIJKKSSo6Nv EpCABCQgAQlEE1BIRYdH5yQgAQlIQAISSCagkEqOjr5JQAISkIAEJBBNQCEVHR6dk4AEJCABCUgg mYBCKjk6+iYBCUhAAhKQQDQBhVR0eHROAhKQgAQkIIFkAgqp5OjomwQkIAEJSEAC0QQUUtHh0TkJ SEACEpCABJIJKKSSo6NvEpCABCQgAQlEE1BIRYdH5yQgAQlIQAISSCagkEqOjr5JQAISkIAEJBBN QCEVHR6dk4AEJCABCUggmYBCKjk6+iYBCUhAAhKQQDQBhVR0eHROAhKQgAQkIIFkAgqp5OjomwQk IAEJSEAC0QQUUtHh0TkJSEACEpCABJIJKKSSo6NvEpCABCQgAQlEE1BIRYdH5yQgAQlIQAISSCag kEqOjr5JQAISkIAEJBBNQCEVHR6dk4AEJCABCUggmcA332u0Dz/QQzwAAAAASUVORK5CYIJ= ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/image004.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEAeAB4AAD/2wBDAAoHBwkHBgoJCAkLCwoMDxkQDw4ODx4WFxIZJCAmJSMg IyIoLTkwKCo2KyIjMkQyNjs9QEBAJjBGS0U+Sjk/QD3/2wBDAQsLCw8NDx0QEB09KSMpPT09PT09 PT09PT09PT09PT09PT09PT09PT09PT09PT09PT09PT09PT09PT09PT09PT3/wAARCAGzAaYDASIA AhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQA AAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3 ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWm p6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEA AwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSEx BhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElK U1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3 uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwD2aiii gAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKA CiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAhuf8AVj60UXP+rH1o oAmrI8SavNommx3MESyu88cO0gn7zYyAOSeela9Q3Npb3sYjuoI5kDBgsihgCOh570AYb69epead bFLMy3E/kzoHbdFlWdTjHGVXoe5qvc+KLyKwunSKA3EOomzULltwCBsgEjJ9sjp+FdIbS3NyLgwR eeBt8zYN2PTPWoE0XTUjkRLC1VJSDIoiXDkdzxzQBm2ut3l3c2QiitpI57ZZ3COcoCmdxJ6DdhQM ZPJ7VCde1L+yWuVhtWczeXCQTif5eAg6nL5XPTA3dK3P7NsvtHn/AGSDztuzzPLG7bjGM+mOKi/s XTfs6wfYLXyVbeqeUu0HGMgY4OOKAKNprzXHiGXT5kEHl/IqlSTK4RXbDdgAw7c81uVEttCs/nLF GJdu3eFG7Hpn0qWgCnFdTNqs9rJGgjSNZEcMSTkkHIxx0q5VVdNtU1Br5YsXLLtMm48j0xnFWqAK GtXv9naTcXeceSu7k4z7Z7VgjxO728M8bJ5bIju0s4QLuJAAOOTlW9OldLe2UV/Cscy5VXVx7MDk H86oN4asWfe0YLbzJnnlicknnnnnHSgDNXXL51idbc+Xc4FuxlHzE9AwxleATxn0ph17Uo72OGex kjQqWdxMG2gdSAByBkdx1rV/4RqxPm/ux+95frzznjnjn0xTk8PWkc0UqLiSJCiNz8qnqOv86AMe 78R3djprXtzBsiIRoj54+fcenTggc+nvTm16/N8YYLSSWExebHKJAC425HGOhPHWtSLw3ZQyrJGg V1Ysp5+UkEcc8cE8UsHhyytpVkgTY6x+UpGeEznHX1oAybXX9QuYUxaFZ5C+yMzfKyrjJ3bfU4xi j/hJJzfzWSRM11HbrKIhKMljjKdOMZHPPetQeGbEWq2wjxCjFlUE8E9cHOaju9I0zTrNri5KxQQs ZS2D8pYbSePY4oAzE8S3ZskmkhELlDKRLcBUEYwA27HcsB0HelPieV576C2Xz5rVFcKso+cHG7tw Bkeuav2ujaRfWvkWxSSC1cxBVzhGHVc55HPTpT7nQ9NtLNnnXbBCHJwrHaH+/wBOeaAKMOuajcRR +XZsZzGJXiMwGFJIXBxznGecVDN4nukjZ4Yll+Qyon2gBygPLFcZA/PtWpbaLpt9ZW0kA3wIo8kk MuF7deSPrSXWh6XCG+0qALthC3Bw5Y/d46ZP0oAoN4iuo1QzRrCwC+ass4XaWJwASPm4Ge3aov8A hJNUFpNM2nOpikCFTPx3zk7eCDgYx3rWh0jTr8JLHiQQMY1Yg8FTjHPXBHfNRX2kaTY2MiXeVt7i XLqFdt7nntk54oAr/wBt3oV3Ns4SAKbnMgDREruOBj5sD3FI+uX8QXzYAhkXfGWnGwqBliTjggY7 d+taMWj2N75N7GRJlAY5MHlcccd/xqte6To+nW6rdZSOV+AFdiWAJ4xyOM+gxQBRPiphGsxaPyDl dwuFJZguSEGMMOQMg0k3iTUIn8uO1SeVZPLdYroHYT0B+XqeeD6VsJ4esHZJkRD8gCkD5duMDjp0 4zVafRtHtGSCbCFc3Sg7j9zGWz7ZHFAFSbxJJDKQ23YWZEzMA7sDtwFx03cZz70txrerW88UTacz M77CVnBHTPHy88A8HHStNNCsLo/a1UOZ0zuKn5gR6HoSPbNQSaTpVrd2Vq5KzF2kt1w5+YDk5+nr QBQn8S3KBzDGsvys8afaArsqnBYrjgcE9+lOPiO6SJGmjWBtqtKJpwgTcSFwSOc7Se1areGrF2mL RgmZSsnX5geo68Z7461VvrDR7R7eO8kVTGAIwQx2jPGcds9N3egCuNdvTHHIID5VxjyHMwAbOSN3 Hy8AnvUI8UuYxLvhESkLI/2lcAnPCnGGOB0454rY/wCEbscS/IP3vL9fXPHPHPpiqsum6PbXlvBI VWZcCNQjEDJ4zjjOem6gCudcv1WMvbhBMu+FmnG0rgsdxxkEAZ6HrUK+LF+0pC8g+a1NxmOUP0yS ox14BOa1/wDhGbARugjwrkMQCeo6YOePwxVRdP0VL7+zlKicSCTy/LbG8Jxz0ztHT0oApT+JNQiJ SO1SaVXCOkd0DsJxgH5cgnPT2NST+JZIHJkwse5kG6YCRnHUBcc88dfetP8A4RfT/LEfljaHEmMn 7w6HOc8dqrLbaNdao0YkV7tmeMgxtyVHze2cHrQBSn8VNaeWLl4g7XP2dxHcBtnHJ6DkZ6HFPHiC /W5uY5rSSNYmCI/m53szAKCMcZznvxWonhiwjDhYh86NG2cksp6gkn2FV7XTtJnvLy2tyTNgLcKU bkAYHJ46dMUAVJ9fvLbctxEkTx4aTzLkKoUnCkNjuQeDjpTG8VYTVCrgnTzjHmDEnOBzj5fmyO9a x8M2BREMYKxklQcnr688/jmqdnp+iX9xHHakPLZZMY2Muz5jnGevzA+vIoArr4iu5Z7TyLd5La4j EnnCT7o43YGOcZGeakTW791hItyBcgG3YzDDZBPzcZU7Rnv6VpJ4cso50mRNsiFirDPBY5bv3NVL TStHvvtEVqyvggyABhjk4I9BwcbeKAKreI549QhspY2S5lgaXyxKCQwzhOnOQp5+lMh8R30lvult vJkLMFDz/IVX7xLbeMYx0rUl0LTrO2klcBIoyJnOCcFBw3rwBUFlpmjX9vJbWUiyxRsJGVC3ylxu BznPIOeD3oAoJ4muzI7PbN9lWHzfOjmDgjBwRxggkEZzT28SXCNLE3kefDlpF+1DaijGctt4OSBg itKfSNO06OW9mxGiQ+W77SQIx2x6fhUNpo2j38EkdsA8ccmH4YENgcZPJ4I9qAKg8TNy7PEsBSRl Yzjc2wHOFxyMg8g+9bHh7Uv7X0mO7/vkgru3bSOCM9+arX2haVBDLd3iqsaLudtpwAMc4H0HQVe0 pLTyZZrNtwnkLyNgglsAHIPQ8CgC/RRRQBDc/wCrH1oouf8AVj60UATUjMFGWIA9TS1h+LNKuNY0 qK3tVQutzFKSxHCq2TjIIJx2IxQBteYnHzrz0561DLf2kKb5bqBF3FdzSADI6j61hP4ckbVdOC29 mLOxm85JAMOcowZSMYGXbdxwMVBH4UmXSdSt1KL9pVYoI5Dv8lANpO7HLEE/kOaAOpE0ZcIJELsu 4LkZI9fpTftMHl+Z50ezO3duGM5xjPrmufuvDdzNrrXMM4igYAqwPzRgRPHsA9MsG+oqmvhm+i0l rdoYZjLKgZRJjy0EQjZlJGNzYP03Z6igDrBcwG4NuJo/OA3GPcN2PXHWpawbbR7i18Tte26rFbSx hbjc+8ybVCoFGMqR3Oea3qAE70tZUEMsfiS5lWzdIZYVUz7lwzAntnPQgdO1atADJJFiTc5wKi+3 Qf3j+RqPVGdLCRo4zI68qgIBY+mTwKzC8nmxqIiVYEs+R8h4wMd8+3pQBr/boP7x/I0fboP7x/I1 itLMIZXFsxdWISPeMuM9c9Bnrg08s/2gJ5Z8sqSZMjAOemOvvmgDX+3Qf3j+Ro+3Qf3j+RrF82by N/2Vt+/b5e8Zxuxuz06c4/DrTwz+eUMZEYUESZGCc9Mdff8AGgDX+3Qf3j+RqrqZh1HTprUTGPzR jds3YGfSs9ZZjDExtmDuwDpvGYx656H8PWnB5PMkUwkKoBVtw+c9xjtj39aALWlRWulQzQwyfunl MiIEI2AgfL79OvvU95cJcWcsMU/lPIpUOYy23PtxWaJJSkBNuwMn+sXcP3XGefXnjigySgT4t2JT /VjcP3vGePTnjmgDRsZktLGGCWfzWjQLvEZXOOnHNF9Jb3tlLbmVoy4+VwvKnqD+Bwaz98m+IeS2 HBLtuH7vjofXnjimtLMIpmFszOhIRN4/eDsQe2ff0oA1LOW2s7SK3RyRGoXJXk+9VNagt9Yskt2n 8tVlWQ5QtuA7cEH9ahLOJ1QREoVJMmRhTxgY688/lTDLN5DOLVi4faI94ywzjdnp05xQBsi9t1AA bAHbaaz9YtrXWIoYpZ2SONy5Cqct8pA5GMdc/hUO5/tGzyz5e3PmZGM56Y69Oc0wSzGFHNqwdnCt HvGVGcbs9DxzigDWgu4ooI42k3MqhSQm0HA9O30qrqkVtqkUSNM8eyQMSq8svRl+hBxVYM5mdDEQ iqCr5GGPORjqMcfnTFlmMULG2YM5AkTeP3QxySe+Pb1oA2vt0H94/kazdUja+mhkttQNqYldciHc fmGMg5GCKh3ybph5DYQDYdw/ecZwPTnjmkEkv7nMDDf/AKz5h+64zz688cUAbAvYAAN5OPY1SnCt ffaLe78reqpKpi371UkjHoeT61TaWURzkWzFo8+Wu8fveM8enPHPpTy7+bGoiJRgSz5HyHjAx3zz 09KANf7dB/eP5Gsu6tY578XEV/NAjOjypGCC5XgDIPQjgjmoTLMIZHFsxdWIWPeMuM9c9B64NPLP 9oCeWfL2kmTIwDnpjr70Aa/26D+8fyNZS2cSeIn1RbvAdQrR+UckAYxnPrz0z71F5s3kB/srb9+3 y94zjdjdnp05x+HWnhn89kMZEYUESZGCcnjHX3/GgDX+3Qf3j+RrIttMs7bXJNTF1MzuWPlkfKM4 /wDr/nTFlmMMTG2YO7AOm8ZjHc56HHt604PJ5kimEhVAKtuHznuMdse/rQBsfboP7x/I1RtP9H1G 7uZLwSJcEERiHbswMDnPPFVBJKUgJt2Bk/1g3D91xnn1544oMkoE+LdiY/8AVjcP3vGePTnjmgDZ +3Qf3j+RrJ0izj0q5upDeeatw5cqIiuGLE5zk+uOMDim75N8Q8lsOCXbcP3Zx09/TimtLMIpmFsz OhIRN4/eD1B7Z9/SgDa+3Qf3j+RrO0m3h0wzk3TS+aQceXtA69hxnntjoOKhLOJ1QREoVJMmRhTx gY688/lTDLN5DOLVi4faI94ywzjdnp05xQBqXc8N1ZzwLKUMsbIH2525GM4qnpFpaaOZhDL+7l2k IIyNpAwT+J5qLc/2jZ5Z8vbnzcjGc9MdffNMEsxhRzasHZwrR7xlRnG7PQ8c4oA0r6S3vrGe2aVk EqFNyjkZ71X0e3tdGtHgjuJJQ0hfc456AY/SoAzmZ1MRCKoKvkYY85GOoxx+dMWWYxQsbZgzkCRN 4/dcdSe+OnHrQBo6i8N/p09ss5iMqFd+zdt98VJpkIiilYzedLLJvkfZtBbAHA7DAFZm+TdMPIbC DKHcP3nGcD0545rT0ss1rudCjEglSc7TjpmgC7RRRQBDc/6sfWii5/1Y+tFAE1FFFABRRRQAUUUU AFFFFABRRRQAUmB6UtFACYHpRgelLRQAmB6UYHpS0UAJgelZ+u3UtjotzcWzRpNGoKNIMrnIHPSt GkIBGCMj3oAy9Bvrm/gumvVjSWO4aPy058sAAhSe5561a1OU2+mXEyTRwMiFhI4BVSPXOKtAAZwA M0EBhhgCD2NAFPSJ2utJtp3mjneSMMZIwApJ9ACenSjVZ5bSyNzEQFhYPKCucxg/Nj0OOc+1XAoU YUAD0FFAFTS5JriwSa4KlpSXUBcbUJyoPvjFU/EuoT6bp0ctqyrI86R8hTkHPA3EDP1NbFIyhhhg CPcUAR26yi2jFwUaYKN7IMAnuQKyvEmoXWnwWxsiPMklKlQgYsAjNwCR6c+1bVIQCRkA46UAR20n nW0UuUbegbKHKnI7H0rO1u+uNO8qWLaY5A0ITZk+a3+rOfTPGPcVqgYGB0o60AMhV1hQTMryBQGY LgE9zjtWVrGqrpmo2fm3cMNu6yNKjqCz7RkYOa2aayKxBZQSPUUAKMEAgdayNRvp4tQEEd1bWoCq yeeufPJJBUcjpgdM9RWxSFVYgkAkdMjpQAYHpWHqGry2urpAZBGm+NFjEO9pt3UjkYA6ZGcd63aQ qCwJAJHQ46UAGB6VgLq1wfGL6cZ4RAoGEKjcxKZx1znvnGMd810FN2Lu3bRu9cc0ALgelc3Y6xfT +KJLCT/Uo8uT5OAVGNo3Z7ZH1zXS0lABgelZOm3r3Gt6jbvewTJAVCRIoDLkZOTnnHTpWvTQiqxI UAnqQKAFwPSuf8O6vcajfXsU88MixMwVFUA4DsAeCeOMc4OQe1dDTVRVJKqAT1wOtAC4HpWN4f1O bUpLrznidYyNvlrwMluM5Oeg64PqORW1SAAZwAM9aAK2pTNbaZdTxsqPHC7qzDIBAJyRWb4d1K81 FroX4hR4/L2xx84BQHJOe55HoK2yMjB5FAAHQAUAU9YmltdIup7YgTRxllJTdyPbvVTw5qFxqdnP PcjGJiqKY9pAAHX15JrYooAoa1cvY6Nd3MTpHJFGWVnGQD7ijSLp7q3kLyJMI5CizxjCyjAO4dup I49KvEAjBGR6GgAKAFAAHYUALRRRQBDc/wCrH1oouf8AVj60UATVWvtQtdNgWa8mEUbOI1JBOWPQ cdzVmsvxBo39u6elqZvKCzRyk7Sd205xwQRn1BoAf/b+m7rYfalzdMUhG0/OwJBHTrwePakfxBpy Wzz/AGjciTfZyFRi3mYztxjOcc1FJoTSanbXBu3+z2ziSKDaPlYIU+91wQxJz371Qk8JTT2t5DcX 0brc3f2vH2f5d2MFSN3K8A9uRQBrprmnyTRRJdIWlQSIecEFSw56ZKgnHoDUf/CRaZ9lNx9pHlht p+U5Hy7s4xnG35s+nNQwaHNBd28hu1lit7cQxrLFllO3BfOcEnjPHTgdTUP/AAjtydLFq17CzvN5 s8htz+/HcMN3fjoegx0oA1o9Qt5rs28L+ZIqhm2AlVBGRk9ASOQKs1j2/h+O212TUop3UyZLxKMB mKqvPsAgIHY5rYoAryX9tFcGCSVVkCFyOflUdyeg/GpLe4iurdJ4HEkUg3Kw6EVkx6PcwaxcXkM6 bZCz7WZvmJUAKRnG0EZyBmrmjWlxY6ZFb3TRNJHkZiBAI/GgCxdXKWlu00pAReWJOAB65rOHiXT2 eNBcQF5fuKJly3bj1qxrNo95YeXFjzFkSRcjIJUggH24rEOhXEl7a3EltagozNMERhuJ5XHuDzk9 6ANU+ILMGUGaLMP+sHmr8nbn0pya5ayFAjxsXUumJAdyjqR6gd6w4/D+oxyRsJUKW4XyIynDEZ5c 9e/Y4zzQ/h29lvIrljGjQ4VIo0IjKnPmAjrk7jjBHbNAGyniSwkgeaO4gaJCAzrKpCk9ATSnxDZK VDTQguu9QZV+ZfUe1YsXh67ggzEkEdwsruhRTt2kMAD7gMcGpLbQbuFPKnWG6ich5TLH8xbbt+UD gDj+dAGqviSwa389biAw7tvmCVdufTPrSv4hso22vNCrbd+DKo+XGc/TFYkfh2+hso1iEKXS+YGd VO1g3fnPIAApU8PXyMiPIssALO6vGMysR0bA4GRnjHHFAGz/AMJHYGBZxPB5LNtWTzV2k+macdet BK8Zki8xF3MvmDKjGckemKwl8OX8VjFHAYorgRGKR1QlTkjLAHPPyjrwaU+Hb/cqCf8AcRkuoKDM jFt3z8dM+h5GKANr/hI7Hy0k8+HY5wreauGPoKcfEFmrSqZYg0IJkBlXKAdSfSsaHQ9RjdpJTDcP L8siyx5VV3ZAXAGevfrx6VFJ4b1GRfI+0bbXb5ZUIN7Ju3E5xw3b056UAb8mu2sTRrI8aNL9wNIB v+nrUb+JdPjDmS5gUIdrbplG0+hrJttBvrdBG3kzRkLGxlQlgiE7CO27B57ZGahk8N6hJbSRF4W2 xpHAHThdv8RxzkjIxnHJoA328QWasgaWIGRdyAyr8w9R6imr4ksHgadLiBoVbaZBKpUH0z61lSaB dGcCHbFasytJGEySAu3YMg/KQPYjJpttoF5bQxtHFbC4SR2+63lsGzgHvkA4FAGw3iGyRgrTQgld 4BlXleufpSDxHYG3E4uIDCW2iQSrtz6Z9azI9DuELRtb2slszeYUaMgq20DC9gvH1wSKrp4cvobC JITDHcqjo7qh2ndj5gDnnCgc8daAN4a9amYxCSPzAu7Z5gzjGc49Mc0xvEdighLzwqJwDFmVf3gP dfWsg6FqC2slvGYSGDbZ3jPmgvwx44HBOMe1Rx+GLiL7NHsilhglYqZVJcxEHC5GBkFifyoA3F8R WTtKqTQsYQTKBKp2fX0o/wCEisdsbefDtkOEPmrhj7VkDw9Ost1IsMKF5Ukh2qeNuDtb1BK54p40 a9ExkMFofOAEyGM7eGJyvqeec9wDQBpyeJLCIyeZcQJ5Zw+6ZRtPofSlXxFYvNHCs0JllAZEEq7n B6EDvWDJ4av3t5Id8bKsQjgV04U/3275xnocc5qy/h92vopVtoUiWJkYKp3BjjBU9OMcZ9aANN/E 2nRqzPc26hTtYmZRg+n6Gnr4gs3uBAksTTEbhGJVLEYznH05rFn8P3s9kImhszLGESKQxt91T39y OMdOTT5fDjyXkjLbxRwPbmIbFO9WxjcO3TigDTbxPpqpva6twuduTMuM+lSL4gs3uGgWWIzIMtGJ V3KPUisa50G8u4kMttZeasiEsI2wyDGQe+TgD2pZPDkkl1dMIYkiljCxlVO9Wyck9sHOPwoA1v8A hI7DyRL9og8sttD+auM9cZp39v2gleMyReYi7mXzBlRjOSPTFYb6DqrmWX7Qgnl3L/qxtjU4Py8c nj+LPHFSf2DeeT5JETojGSOVoz5hYsGIbtgkYOO1AGzHr1pKIzHJG4lJVNsgO8gZIHqcUh8QWYaV TLEGiGZB5q5Qe/pWJc6BqN1PFOWhhlgPmxrChCGUsCS+eSMADjB61IuhXixRoEgP2dg0DlDubDZw 59Pp7GgDW/4SGyxGfOhxL9w+avzduPWkTxHYSRSSx3EDRxf6xxKpCfU9qyJNBv2fdGYoPNZTOI4/ Qk4UHPXJznvzUZ8MXD2stsyRwxTT7pDACG8oHKoM5GQf0zQBvS67awSrFM8ccjDIVpACR9KYviSw eAzpcQNCrbTIJVKg+mfWsaPw/qIESSyo0ZKmfCZMgVdu3kdCAMng5JxRF4evYbVfKWCO5V5DuRTt IbOOvOQDgUAbn9u2vzfPH8sfmn94OE/vfT3psfiCyliWSOaJ43fy1dZVIZv7oPr7Vhw+Gr1bpbie UTvt8l0ZMI8W3GMAcNnn09qY3ha8l063tXZYjHukZoARvlxhG5zwB170AdCddtVmaFnjEqjcyGQb gMZzj6VZsL+HUYDLbOjoDt3IwYZ/Cuafw/qMzYeZVjy0jKqZ3uTuIOedufQ5xxW3oVpdWltN9tkD yySl8BQAoIHA4BPTqaANSiiigCG5/wBWPrRRc/6sfWigCaiisTxXq1xo2lRXFps8x7mKHDAHIZsH GSBn6mgDbormX1m/TU9NsRcQNcSTbLqPyCGVCjOpHzccAA9Rk1TbWdYk0nU5WmEU1nt2yQojpLIw +4M54DFeevPNAHZUVzFzrmpW2vG0WISqihRGF5k/dO5cH03KF9Oapx+JNQk0dpWuII5jKiRO6gCV miD7BngbWJBPYKe9AHZ0Vz1vql4vixrK7lVoZYgYEh2sFIUFy/8AEOTwehroaACisRdXmm1qW1TE UaFokLpkO4UNkndkAA+nbrV7R7t77Sre4lKGR1yxTpn2oAu0lVtQkEVozlwgByWJwAPrWd9oIZVM p3MMgbuT9KAHaMk3nu1y1/54TEyy/wCpL55Kf/W4xWlebvsM/l79/ltt2fezjt71lG6wjMZwFU4Z t/APoT2pfPbfs807yM7d3OPXFAEfhmLUomnGpy3ErGKEoZAQB8pyP97+971uTY8iTO/G052Z3dO2 O9Y32r5N/njbnbu38ZzjGfXPFL57bynmneBkru5x64oAk8OXE8mmxxXEF4jxRoGkus7nYjLdeePW r9/A9zYzQxSvFIynY6NtKntzWWLrKqwnBVjhTv4Y+g9aX7QdzL5x3KMsN3I+vpQBa0b7TJbyXV4s sctw+7yXbPlAcAAdumfxqbVPPOnyfZt+/K52fe25G7b74zj3rOFzkIRPw/3Dv+9349aPtON+Zvuf f+f7vGefTigC1oTTtYsZ4Z4v3jbBPKXcr2JyAR9DRr3mf2YfKFyT5sefs2d+3eN2Mc9M1V+0HKjz uX5Ub/vfT1oN1hWYz4VDhjv4X6+lAGhpXn/YF+0b925tnmff2ZO3d74xmo9YFwlqtzaCV5bdxJ5M bY80dCpHfg5+oFVPPYOEMp3EZC7uSPXFJ9q+Qt542g4Lb+Ac4xn1zxQBp6fBJbWEMU8jyyhcu7tu JY8nn0z09qpeI/tf2BBZfaN5fnyc5xg+nPXHTPbIxmovPbfs8078Z27uceuKT7VlA4nG0nAbfwT0 xn1oA17cOLaISbt4Qbtxyc45yRWdrQmLw83gttrBjZ58wPxtPHb73tnGai89i5USncBkru5A+lIL rKownyr8KQ/DfT1oA2YVKwRqSxIUAl+p47+9ZWs7/wC0NO2C/K+afM+zFtm3afvY/wBrb+tR/aDl h53Kfe+f7v19KPtJ+T999/7vz/e78evFAG5WFrSX0usWCWZuFRlbfIjMI0OVILAcNwGGDxzSm5wr kz4CffO/7v19KX7Qdyr5p3MMgbuSPagDbrClhvJvF6lZLmOzSFXOCwRmy2R/d6EZzz0xSm6wjMZw FU4Zt/APoT2pfPbfs8078Z27uceuKANusKGG8k8XXLvJcpZxopRSW2OSuCB/DjnPrkUv2r5N/njb nbu38ZzjGfXPFL57bynmneBkru5A9cUAbdYlrPPF4iu4jBfPFK6hXfd5UYCEkrnjrxx60gusqrCc FWOFO/hj6D1pftB3MvnHK8sN/I+vpQBt1g6dPqR164kuIZhY3OVhDEnyinGSMfKG5I5OeKcLnIQi fIf7h3/e78etH2nAfM33Pv8Az/d4zz6cUAblYeg2tzBfX5uLm+lVZNiC5ztYYB3LntnI49qPtByo 87luVG/7309aDdYVmM4CocMS/C/X0oA2nXejLkjIxkHBFZWiw3omla9afECi3j3uSJQDnzCO5OQM +xqPz23hDKdxGQu7kj1xSfavkL+eNoOC2/gHOMZ9c8UAbE0XnQSRb3TepXchwy57g9jWdocd4Vlm vzKsgxCqM2QQnBcD/aOTn0xUPntv2ead+M7d3OPXFJ9qygYTjaxwG38E9MZ9aANe4x9mk3eZjac+ Xnd07Y5zVDw55v8AY0Pni7E3O/7UW35/HtUHnsXKiU7gMkbuQKQXWVRhPlX4U7+G+nrQBpan5/8A Z8v2Xd5uBjb97GRux74zj3qtoTTNaS+dDcRL5p8v7RKXdlwMHkAj6HNVvtByw87lPvfP936+laOn P5kBbduBOQc5yMUAW6KKKAIbn/Vj60UXP+rH1ooAmprxpIuHVWHXDDNOooAbtXfu2jdjGcc4oVFV dqqAo7AcU6igBNo3bsDOMZpjQxOu140ZQc4KgipKKAGhFDlgqhiMZA5xTqKKAIGsrV5nla3hMki7 HcoMsvoT3FOt7WC0i8q2hjhjznZGoUZ+gqWigCK5t47qBoZlDRtwykZBHoarnS7curkHcgIVuMqD 1A9Ku0UAYlomnX0klvHDLscGTLw4jlGR8wOMHn8e9XJrC2hV7lwxaND8wALbepA79ulPsdP+w5VL iZ4QNscT42xj0GBk/iTVieITwSRFiodSuR1GRigDF0t9I1iN47IM8ceyRgY8KC3zDt97PJ7g+9aD 6dbxl5grmQLglQNxA5x/9ak03R4NLZzbs2HREKkAD5QRngDk55q66lkZQxUkYDDqPegDLsLOxvtP t54IXSBgHiR0C7fQgY4/+vT7u0tLG3nupEkICgyFFyzAevHIGT+tSaVpQ0uIoLqe4G1UHmlflVRg AAAVddFkjZHGVYEEHuKAMy2tLG4keKKNsWjhFOwBVO3+E47A44+lOurGytbeaWZTsfAcBQTIT8oB GOSeBVnTrCPTLJLaFnZUydznLMSc5NSXdql5btE5ZQSCGU8qQcgj6EA0AUrWztbuJJRDNGY8qolj 2MnY4yOn0pl/aWNjZySTQySRyOA6RxhjIzEAZGOcnFWtM02LS7Zoondy7mR2c8lj9OB9BT9Qsvt9 r5PnSQ/Orh48ZBVgw6gjqKAK1taWd4iXMe4sAVywwyc/Mp4yORyPamXNlYW3kwyxNsuJdoAQFd/3 stxgcjr61etLVLOARIWbkszN1Zickn6k03ULGPUbGS1lZ1VwPmQ4ZSDkEH1oAq2dtaX0KXkSyDzF wrOu1iufzx3/AFqK/g07TbVDPG3l7/kjjjDfNy2QAOowTWrHGsMSRxjaiAKo9AKranpseqWwglkd FDbvlwc8Ecggg9fzxQAyLTraQCdAwMijLEYYjsDxnv0qrew6fp6Qo8Mj7MtHHDFuKBerAAcAZ7et a0cYiiSNc7VAUZOTx71XvLD7VJHLHPLbzICokjxnacZHII7D8qAI49NtZYzKqnEygsSoBYY4zx6e tVbuKysrizhe3ndnbZCY4twQ49f4eAfwFbCjaoGScDGT1NU73T2vLm2lF1ND9nfeFQLhjgjnIPYk fjQAh0i1KyKUBWX/AFgIGH4xzxzx61TvmsLC6gWdJi5UlZFj3CNcgHJ7DkVtVn3ujwX+oWl3OzE2 27bHgFWzjrkewoAcdHtDG6GMFHO5lIGGPqRjk1SmksIdZS0eOc3LKAJBHkANnA3emVNbdUf7Ki/t o6mWJm8oRBSqkKMk8HGR19cUAH9j2nl+X5Y2bt23AxnOc4x1zz9apCSw/ttrIJP9qwFaQR8YwWA3 enX2zW3VGHSoYdYuNRDEzToIyCq/KBjocZ7dM4oABo9oERBGAkZyigDCn1AxxVe3hs7i/u4EilWW LasrsmA+Rxz34rWrOXSNuqte/a7g7nDmH5QmQpUdBnofXrQA8aRahYwEwIv9WAB8nGOOOOOOKrQw afcXt5ZoreagXzgUAD5Hrj5uODWvWXaaBb2eofbo5JftLlzK5xmUMeA3HQYGMY6UAT/2VbbkO3mM YQ4Hy9uOOKzNOl0rV5Lm3gil4+aQSQ7Vkz35HPb9K6CqlnYi0mupBNJJ9ok8whwuEOAMDAHGAOtA DH023U+cVZnRSAQAWx3A/IcVTtI9NvtsMMTlJIhcENGAvzNxnj72QTjrxW1VSx02HT2uGhLkzyGR txzj2Ht1/OgCKewtoEkuWWRnRDkouXIHOB3P0qtaQadeHyII22Rqkw+QBBu+YY4xnv7ZrZqpp2mw 6ZC8VvuKvIZDuOcZ7fQDAH0oAjk063iEkwR2fb82wAswHQe/f86radbWOo2MM0EEkcKnMSyRhNuO MgY4rWkUvGyq5RiMBhjI9+arabY/2bYpbCeSZU+60mM49OAKAILmxsrWCaeYYVgPMOAS/YA8c+mK m0wxG1/cwzQqDt2SxlCMAdB6fTiprq2S7tnhkyFbHKnBBByCPoQDUGmaZHpkMiRvJI0shkd3IyWP sOB07UAXaKKKAIbn/Vj60UXP+rH1ooAmoorC8XG/Gkxf2X5/nm5iB8ndnZu+bO3nbjOcUAbtFcu9 vqI1XTbVG1HZBNunmMmY5YyjNjPfD7RzyRVCd9VuNMv4ol1IEajujaRHz5BXj0ZhuHQHPQ9KAO3o rl7UXx1KyEzajE0dorTFlLqzeXgoCBtJz8xPqAB3qr/pp0HIbVlkmuMRoY3LwDbjc/GTj7+BxuOO lAHZUVz1kNUXxPL9pjkltSuIpSSojUIvOOhZm3ZGMjA7V0NABRXPXuoLDqWoxNdXewW6PtjQkoQT kIcYzjH51CL9oNP02Vr24Ia6wQFZspk5ViVyQPXjNAHTFgoyxAHvTfNj/vr+dZ3iO4kt9FmaAMZ2 ISIKMneTgdeB65PFcqNYvA9oWilAtuNR+QYHO3I4+bu3yUAd35sf99fzo82P++v51wEupX72d65k mtgT9otnEQZmiyV2gYODnacEZ5NW/wDTxqtpD/aRYPCXI8kbXxjknHBOSeo6dKAO18xD0dfzpPNQ dXX868vnnuZpJopL+W4un2pbhm8jbtd95/hXBCjk+vFW9L1Ga6UrazXKrJcOkKhQ6omPvMWySA2R wf4enNAHovmx/wB9fzo82P8Avr+dcLa3V1/Z0UlzfzeVI75nEA3oRwqkbeh5PT8ae9zeG4Fv9ouE lIYbxCuxEC8SEEZyeTxnnAxQB2/mx/31/OjzY/76/nXBpe3kek280tzcyeYhdXjiUSF+AIyCuP7x 6DPrT11S+a4uD5cyW8uBAxQEptIEhwBnOCx567eKAO582P8Avr+dHmx/31/OuDS5vZ7mz8u9uYop ZWQCWFT5gXnJIXoeAOh60k2pX0kN+4eW3jYGe0k8sMTGpIKgYOCTtPzDPJoA73zY/wC+v50ebH/f X864oG+XUNPj/tFnWSMuV8kASY5+Y44JBx1HSkS7mMau97OAdouh5ABtjgk7Tt9cL345oA7bzY/7 6/nR5sf99fzrhzqN7HeR+V5lzbpH5byNEEDysCUO3Gf7oyOOTmkjv5mZle4vEt1IEly0S/K2Cdqg LnrwcjjjnmgDufNj/vr+dHmx/wB9fzriGubw3CW/2i4Er/KHWFQgTbkSsCM9c8A8Yxioor28TSIZ 5rq4kWQOwdIlEm4YCoQVx/ePQZ4GaAO882P++v50ebH/AH1/OuE/tm6imuJJYZ/s0kXl24KDd5yg ZBAGRkk8nj5eKQ6lfR2aLdfaUuIQY38lELSyg8DJG05Ug8YGc+lAHeebH/fX86PNj/vr+dcPDNfp LfeZeySLE6ow8kAxKcEsvHO0Fh36UvmXR1CxWLVJXhmZiA1uBuCnOGO3uOAeOlAHceYh6Ov50eYn 99fzrzSeWdrtE1DU5WtlmkjkcDyjGAF+ZcAZHOO+Oajubn7NY3cVnqV3KHMYR05GG6sSeRxjOCDj nHNAHp/mIOrr+dJ5sf8AfX8680s2jtikq6tPL/pEseUcs2FVuMHIwcKc449a0YNSvp7mMYnit3iE DSSxrlJiCQxUfh0+XmgDuvNj/vr+dHmx/wB9fzrgBPqDaTbzDVZQZLjy9xtxuwSByNvQYJ6d+tWb nUp7O8cS/aXZN/7qONSm0L8rHjPJ9D7cUAdt5sf99fzo82P++v51wP2nU3htIpruS1ulm8iYeUr7 yRuDEgEYxgcY61auJ7lxdFb6W3njDs0IgDKig/KQdvUgepyT7UAdp5sf99fzo82P++v51wv9oXsM WnsHluUVfPu38sKfLYgAEYGSMnhefl96ZcX16YbjbPcxSxxGSQiJSkZB4RRjOTxjr3oA73zY/wC+ v50ebH/fX864mW6u4DbxtNcSuwQRmGNf32SclsjjAxxx3NR29xeJazvNfSzRrcGN5BCFaMKDyvy9 GO0ZwcUAd15sf99fzo82P++v51xEF5dzKhaW4in2hoYJIVPnjGfmIGBk8cEYFJDfzPIVe4vEtgwE ly0S/K2M7VAXPXg5HHHPNAHc+Yn95fzpPNj/AL6/nXlEd7/o8k0lzM48t4vPMxUm4BJ3eXnI9MY2 8Yreu5bkrE1pq8/lyTiIM1sMgkd/l6D6Dr1oA7nzY/76/nTlYMPlIP0NcNJqV6L+6CRyfZnHlwNs Bw6Y3kDGehYjPB2jHWug8MXDXFjOxM7oJiqSTBQXGByNoHH1GetAG1RRRQBDc/6sfWii5/1Y+tFA E1FFU9S1O30m3Sa6L7HkWJdiFiWY4AwPegC5RWWfEFmHs1KXIN3IYoswN94ZyDxx90nnsKrnxZZN YS3cEVxPFCu+Ty1GVTBYOQSOCAcd/agDcorMbxBYpei1kdkfaCxYYVSULhSfXapP4VCPFNgbF7oC YohwyiP5lGzfuPoNnzf/AF+KANmis611u2vdVnsIFkaSBEd3wAoDDK989PatGgAoqnJqttFLcRsZ N9uqs4EbHOTgY4559KYms2jpAcyKZpDEqtGwIcdQ3HH40AXXRXXawyPSozbRAcRjI6UtxMYIt4Ge cYqodRYggxjB96AKei6pHq0m02QgYQrK4MmSrEkY6egBz3Bq7qbRafpV3diFX8iF5dvTdtUnH6VV tPs1ic2tpHGfLWLIJztXO0fhk1LcXS3VtLBPCrRSoUddx5BGCKAOQ8KeMofF3iabTbjR7byorbzV uGG7J+U7cEf7XrXbzW0dtZyG1tI2ZFLJCvyBj6e2a5RrjRPCeoLPHYTicxbQ6MXAUnGME9fkHbtW /Y6+uoWonihZVJK4fg8fTNAEum3UOptLJFAohQKFk3Z3EqCRjtjIqa+VbSxmnitlmaNd/l7tucde fpVe2uI7OLyra2jjTcW2rwMk5J/M1L/aLEcxr+dABYTQ35nkjhUQq+yOQNnzBgZOO3OR+FSXvlWd lNOLfzDGu7YOpqtbXEdnbpBbW6RxIMKingUtxdJd27wXFukkTjDKx4IoAk02SLULJbhoFjLFgVDb uhI68encZpdSIsdPnuYbZJmiQuUL7MgDJ5we1RW9ylpCsUECpGvQAn8abeTRX9s9vdW6yQvwy7iM /lQBdggV7dGmgRHYZZFbcAfrxmq2rTR6ZYNciCN9rIvzybFG5guScHAGaSC7FvAkUUQWNBhRuJwP xqO8liv7cwXVuskRIJUsRyDkdPegC1YNFfWMVx5GzzBnaTnv69xVbXdQttD08XcsSsN6pgvt69ef YAnHtUq6gVUARjAGBzUUs8c80UsturSRbthJPy5GD+lAF9IIHjVlRSrDIx3qjqs72Btzbac10ZZA r7Gx5a92NLbXKWltHBBAqRRrtRQx4HpUn9pN/wA8x+dAFv7NF/cFZuq3semPAq2gkEpwSX2gcgdc e/fA4PNT/wBpN/zzH51Xujb3skUlzaRyPF9wknjofy4HHtQBp/ZoeP3Y4qlPKkGpxW7W8YgkiaR5 mkxt2kDGMc/eHenf2k3/ADzH51SvIbO/uEnurRJJIxhSXPAznGOnUD8qANWSwtZgBNbxSBem9Q2P pmsiW7tbXXE0hdOh2TqrHZxuzuySu3BA285Pen6l4lTTIw81vI6lWc+Xg7VXGSckeoqq2rWcour6 bT5Flg8tn3EbjjlCMHH8R79zQBuR6ZZRPvitII3AxuSMA/mKoPfLHqr2z2aiBZEiEwkySzDI+XHT 8aq2fi+G9vBbJazpIc4MgAHQn16HBwenFWQtsNQa9+yJ9pbGX3HsMDjpnHegDV+zRZzsGaz4J3k1 iezbTmjt41DJcFhtc9wB+IqX+0m/55j86P7Sb/nmPzoAt/Zof7grNtbyO41aeyNoEWIEhy/JwR2x 79QT74qf+0m/55j86rQm3t7qS4htY0mlyXYE856/nx+VAGp9mi/uCs3T72O9v7i2NoIhBnDF+T8x HTHtnIyOfXip/wC0m/55j86rWxt7OWWW3tI43lOXIJ55JP6kmgDSa2jCMUiUtjgE4yaz9NvE1GXa LRUCRK0h35KSEkFOnOMdan/tJv8AnmPzqKC4jtjKYLZEMrmR9p+8x6k/lQBekgiSJ2ESkgE4zjNZ ug6jFrdmbj7KItpA4YsOQDjJAORnB4qw9+ZEZGiBVhgjPUVDavDZjbbWyRgqqcMeijC/kKAJ7vT7 OGCWePTIJ5lUsqCNQXPpnH61Ho851Ox+0T2QtmLYC794YYHIOB/kVlS+NrbLI1ndFOQWCjGBnPOf YnHXFadpLFp9stta26xwp91QxOPzoAn1N49P0y4u1txKYUL7N2N2Pfml0e8W/wBPW4SIRh2I4JIb BxkEgHH1AqC5uUvLZ4LiBXikGGUseRVqw8vy5DHGI98hZgD1Y9TQBbooooAhuf8AVj60UXP+rH1o oAmrO1vRoddsVtbh2WNZUlICqQ205AIIIIrRooAy20KB9TguzNPtgYPHBu/dowQoCB1Hyk8dO9MH huzNtexSF2a+ZTO4AUsB0GAMAf4n1rXooAyp/D1lc6m17KGLPy8eflZthQN652sR+NVx4Vgjsxbw XU8YMqSOxCt5gRQqKwIwQAq/lW7RQBnHRon1mLUpJXaWJSqKAAOQASSBk8DoelaNFFAGXc6ZeTXt zPDqAhEsIiUCHJTBJznPPU1G2jXP2K1gjvIozbzebkW/DYPAxu/XJJrYooAq6hDLcWTxwPslI+V8 A7T64PWqJ0+782NgwCKCHTA+c8YOe2OfzrYprcoeM8dPWgDGOm3xhlUTASMxKPsX5BngY7+maebC 688PkCIKQY+OTnrn6cYqt4b029sZQbxHCLaxxoXl3MDliynk9M9e4x6VqazDJcaHfwwKWlkt5FQD qWKkD9aAOc1DQtUumY20lpK7KqmSTgrhywAAz2IGc9ver2naRfWwlM/lBZHZxDFjahJ7NwemBjHa uV8D6JrVn45mub6xmgsVsmjjkcjDMWU47HseMcetej3Nul3aywS52SqUbBwcH3oAyV02+EMStMDI rAu+xR5g7jHb6+1OGn3fmSEsCrABFwPkPOTnvnj8ql0SzuYI5Zr8AXMhCEBsjag2qfTnk/jVy/tB fWE1sxI8xSAQSMHsePegDNGnXoSAGUFk/wBado/e8Y/4Dzzx9KDp14RPiQAv/qztH7rjH/Aueefp VnR7e4jt5J71Nl3cPvlUNkLgYAHboB0qXVYpZ9LuI7dWaVkIUK4Uk/U0AUv7Pu98R3jaoIcYH7w4 6+3PPFNbTb4xTKsoDuSY32KfLHYY/ix7+tXNEt5rXS44p1KOGY7S2SAWJHc447ZOOlN163a60W5h jgeeR0IREcKd3Y5JGMHmgCA2F156sCBGFIaPA+Y8YOe2OePemHTb7yGUTASF8iTYvyrnO3HfjjP4 1p2KCOxhQQtCFQDy2OSvtnJ/nVPxHbT3WjvFawefLvjYJu2ggOCc8jjAPegCP7BdfaN+R5W3Hl8d c9c/TjFMGm3whRTMDIHBZ9i/Muc7cduOM/jWlp1u9pp8MMjl2RcEn+X0HT8KoeI7S+1C1itbAiMs +9pmJwm3kcAgnJx09OaAAafdec7EgxlQFTA+U85Oe+eOPamLpt6IoVaUF0IMjbVHmDHIx/D+HpWr aSSy2kT3ERimZQXjJB2nuMjiquq6SuqfZ9080XkSCQeU5XcR64PIoArf2febpjvGHA8sYH7vj9ee eaQadefucyD5P9Z8o/ecY/4Dzzx9K2qxNfsru8ns/s0buqMS2JNoHK9eQegPIz3GDmgBW069KTgS gM+fLbaD5XHp/FzzzTjp92ZY2DAIoIZMD5zxg57Y5/OtisXU4rlNbt7q0sHuGSFo9/mhVUllxkE9 hu7HrQBm6t4d1K+aDY8ckaSOZEZjGWQ7SEDLkjBUc9TVeDwvqo028tp5YWE0QiSMNkYGAMtjPQY6 e9dpWJfWV3N4jtZ443MCBct5mAPvZ4Bz6diDx0xQBmQ6JrrT232iS1SO3PyGP5m27cbTkDOQev6V rCwuvPLkgxlQBHxwcnJz+XHtWxWA1hdHxLLcRwSIpkjb7QZBtKBcMu3OeT7e9AEi6bfCGJWmBkVg XfYo8wdxjt9acNPu/MkJYFWACLgfIe5z3z/Stms+DSVg1ifUBPMzTIEMZclAB0wM49fzoAqjTr0J ADKCyf6w7R+94x/wHnnj6UHTr3E+JAC/+rO0fuuMf8C555+lbVYun2V3F4hu7iaNxC4YKzSZzyMY APseoGPU5oAX+z7vfEd42qCHGB+8OOD7c801tNvjFMqygO5JjfYp8sdhjv36+tbdYmj2V3b6rezX EbrHITtLSbt3zEjgHHTHOARwOcZoAebC6M6sCBGFIMeB8x4wc9sc8e9MOm33kMomAkL5EmxeFznb jvxxn8a2XUOjKwyrDBFZWi6dPazSvdD/AFSi3gO/OYlJIY89TnvzxQAn2C6+0b8jytuPL4656569 OMUxdOvhFGpmBkVwzPsX5lznbjtxxn8a151LW8igFiVIABxnisfwvp93ptg0N4CGIRhzwPlGRjJ5 BHJzg9RQBgv4U1ry2t4pIEt2d3KidhuLHqQBgjpwe4610A0692QgyguhBkbYo8wY5GP4ex49K071 5o7KZ7aIyzBDsQEDce3JrP8ADtpe6dZPZXxEnkt+7mUnDqRnoSTwcjmgBv8AZ15um+cYcfuxgfu+ P1555q/p8Etvb7JjufjLYA3HHXHaotct5brRLyC3RnmkjKoFbBz25yP503RLWay0/wAi4zvSRsEH 5SM5BUZOB7E8UAaNFFFAENz/AKsfWii5/wBWPrRQBNRRWX4g1oaDpy3bQ+arTJERu27dxxk8HgUA alFYbeIJ0l06NrFc3sxiOLgHyztZgenIKrkdDzUFz4qkgsLmYWQ82C9Nns3lskKG3cDJ69AP0oA6 OisWHXZp7mzRbEmO6gEoKyBiPk3Z442g4XOeSwxUJ8RXS6ZNc/2flopTGQJQVbjOFOPmO75OB972 oA6Cise019LzW5bAIIjENp8wkMz7VYheMHAYZ5rYoAKKzrjVjbTXqSW74toBMGDD94Oenp071Db6 759taTC2O2ecwMQ4IQ9M9iQfpQBr0VT1W8/s/TZro9Il3HGOQO3PFY6+JWkjheBHlWRFckbBsDEg ZyRk5B6Z6GgDpKK5efxTNDbmcWd1JCRuR1VMOvr149ecU8eJJSqkQTfdBkBCAxk8gEE8nHPGaAOl orl7bxTNdRnbaXCSl9iROEBc4JODnAxg5zU0PiJpb+KzZXimkh84LIqgryflIznPBPpQB0VFcqPF 8R0tL/cRE03kkfLlT69cYxz649+KsS+JBBfXFrI5DwRCViADkHsB1zyPzFAHRUVzU3iWS1EX2uGW 3MkwhAfZ1IzuyDyO3FNXxTIbi4ia3uE8k4DMi4c7goA54ySMZxQB09Fc2fEVwG2NaTiUffRtgKjO Ack4IJzjHoaP+EjlIDLBM0cnEMgVdspzgAc8Z98cA0AdJRXODxG4u7W2mjkhmud4VZAoKlT3579i M02LxP8AaBKIA0ksc5gEY25dgCcg5wBgHr6UAdLRXN/8JNtuYoJhJBJJC02JFUFAucgjOc4UnjsK F8RzsQgtpfNb7keY8sMZJ68YHY46igDpKK5o+J2E7QGOYTLbi48squ4/7OM/e/T3pkPiqWe2WVba cO24iNtgO0Yy2ScY+YDr1oA6iiudHiGVtzCGXyFDkzYXaCoJYHnI6Yz0JqNfFStb2E2SFvX8tAdu UPQ559eOM9aAOmorm28Susc0pR/JjRnEmUAcLwcDORznGR2oHiZS9gAx/wBOBMZwvHsfxOOM80Ad JRXMt4qVbe/lBY/YX2Oo25Y5wMc45ORzjpT28RncpjDSRFVZpBtAQMMjqQTxzxmgDo6K5afxXNBC JDZ3DgkbQvlkkHoevHbg+oqU+JWX5mjkESgGRyFHlnaGIIJySARnAPWgDpKK5o+I5x8rW0ol5IjL R5IAyTndgYyODzk0+PxHvvZbUsUkjgE7Z29CMkcHqMjPbmgDoqK5mHxQ9zaQz20M0zSIz+UgTcoU 4PfBOeMA07/hJH2yOUcQojv5h2AHb1GM5HII6dqAOkormh4oUpp7biBfHamdvyn0PPrxxnmhvFAV NQbJJsDiRRty3059cjnHIoA6Wiuc/wCElXz7KPzP+PyMyRthcAAZ578+3pUM/iqeC3Exsrp42AZG VUw6nODnPHToeeRQB1NFcv8A8JVL9qWE2l0N0fmbti8fLnGM5z2+tMHi8rpz3k0E0KJKIyrhMnPc c44wc9+KAOrornZvEiwX0trJJhooPPLAAgr6Adc9/wAaa3iOdcq1tKJRkmPdHnAxk53Y7gYznNAH SUVy6eK3a4mje3uIxEM72VcMc4AGD3PTNbWlXk15BI08EkLo+zbIB6A5BBII560AXqKKKAIbn/Vj 60UXP+rH1ooAmqtfafbalCkV3H5iJIsqjcRhlOQcj0qzRQBTOlWTagL426fah/y075xjP1wSM9cG qy+GtKSOZBa5WaTzXzI5Jf8AvZJ4OOMjtWrSZoAox6LYRXPnxQeXJ5Yh+R2UbAMAYBxgA+lRjw9p otIbYQMIYX3xqJX+RsYyDnI4rTooArLp1qt79rECfaMbfM79APzwAM9eKs0meaWgDPm0a2nu5riV p2M0flOhlOwr6be3U/nTH0G2eCGLzLlRFJ525ZmDM/qx71p0UAVNS0+PU7T7PNnZvViM8Ng5wfUe 1ZTeELN12sP3e/eY8naec4x0wCSQO2TW87rGu5yAPU1GbqLBxIme2TQBir4ftbmC5t4rt2jJ8qRI 5ziLuVGD8vbin3Xh22lkW4unB8rDku3ykr0ZvUj1pujWL6ZeTTy3scv2ob5x6S5JynouCRzk8Ctk 3MBBBkUg9QaAMSHRLSRPIhvWd2JuVZZyZF35+ZTnIB59utJceFLMxySTSupzvafzCHUBcY39QuM5 GcdauaTaxacJvMuUkLNtjPTbGPur+HP51cupY5rSaNJYwzoygt0yR3oAw7fw5pN5I720kEyKNjRR sGiUlcZ2DgNtxz1p7eFbC1gMk0mFjyzzTSEsQVwQzHkrgDg8DAq3odsukWItXuI5EUDacktnA3ZJ 685x7cdqu3T29zbSROYnDD7r/dJ7ZoAxovD+n6nB5q3f26Mq0YkabzQM4yQezcDkcirD+H4IkuZJ rh9soUyNJIcDaOGGehGOtWNFhi03S4reR4PNA/eNFkKzYxnn2AqXUvLvdOnt0miDSLgFwSAfwxQB mf8ACOWWo2yH7QbmI9X80v5gznDHuAfyp8+g2trbyST3RhgX5stKVSHnOV5wvNXtLVLGwSGWeN3D MxK+5J69T16nk03WUGoaTcWsFxHHLIuFZuQDnrQBQTw1ZXkQmS4abeF2TiUsy7TkFX6jnrjrTJ/D 2mabCsstylmoCxiUy+XyM4Oe7cnnqQTWvYCCytFiMwZyS7sTncxOWP5k1X1uBNS05oYXt/OBDI0u SFPc8e2fzoAqp4Ys5ws4fzi5V1lLliQBgAN/dIJyOhyaY/hqxsw00lwYHdlHnmUq47BQ3pzjHvW1 BJbQQRxRtGiooUKvQfSs/XLNNZgitjdiG33FpCh+ckD5cZBHXk/SgCNPC9uk4nVmEwfzBLuO/O3b jd1xjt0qC68P6fbadFb3l15cC5jVpZsEg8lSx6g+ntWzaXGy0iW6niedVAdk4BPqM1V1GPz5op7a S2Z0Royk4JQq2M9O/wAv6mgCqfC9tLCUSV1t3Ufuo5CI8cdAOOe/rVa78PaRbSSfariGEzKSEeQK qZIyYx/Cc45HfFdBHPBHGqB4wFAGF4A+grL1WyF/qFrdRXMSG2VigbOC5KkZHQrhT+eR0oAifwhZ yzCSTLEdAWJAGckY9CRkjoarz+HtItpWjnuY4pJSCitLtMeXyPLH8GW/u10f2qH/AJ6L+dZN9Y/a dbg1CK5iUwRhUVskE7vmyOh+XOO4NAES+D7NWiIH+rxlSTiXByDIP4zk5yahPh3SVuorN54jKhDr bPJndySMqeoHOPQcV0P2qH/nov51kXNgJ9eXUBcxhEEYERJw20tkkevzcHtQAz/hEbXZKA8gMu3c 4kIbCnKqD1wD2qKfSNKu9RAnubeS4D48lpAcvt7r/e2/pW/9qh/56L+dYg0lB4kOp/bl8vfv8nb3 2bc5oAP+EPtCsgJfdKfnkLHewxjBPce1Vh4c0aWZrGK5iE6ElkimxIBgAqcHO3GPl6V0n2qH/nov 51jWti8HiK4v3uLcwSkkLliy/Ko4B4B45I68elADh4Wt1dmid4Czbj5LFAOBkADoDgZHrzVX/hHt K1C8lC3EUs0RIeNJc+XzkjHbJHI78+tdD9qh/wCei/nWRp1gLLVri8e6jcTPIdmT8gYgjb6E459c CgCM+D7MtKSD+8zgAnEWTnMY/g554qvB4e0i4mSOC5ilkiG51WXcZBvzmQfx/MD97vXR/aof+ei/ nWTo1l/Zc1w73MTrcM8jgZOGLkjGegwenqMjqaAIl8IWabiM8kMpLH91hiwCf3RkngVHb6Pp+o2s 8FpqPnwnCusNyWEYByFGD8o46e1b5uIGUgyKQeCKzNFtItMW43m1VpJSVMIIwmTtBz6ZNADm0ULe C8a4cSJGY8lzt25ycjpnIzmqlr4fsLu0hMNwt3bKzuhaTzUJbO49wepx6ZNbbXUW07ZE3Y4yeM1m 6Gk9hbCG8ubVkRVWNYQQBySSc+uR+VAFX/hE7C2g3yv8seXaWVyW27duGY87cdulMg8MaZe2rvbz idJid8ySbjJ2ILDqOBxWzfvHdafcwRyxh5YmQFugJBHNVtGt00u1eF7lZcsGDliWPygck9cYwPYC gCE+HbeFZ2aQrHJGqOrOQiqg+XA/hx61d0eGGKy/0e6N0jMT5pl8wk/Wl1AxXmnz26yxBpUKguMg Z9RSaNbG0sPLeVJX3szMvqTnqeT9TzQBfooooAhuf9WPrRRc/wCrH1ooAmrC8XWd7e6TFFp6yGYX MTHY2MIG+bPzLkYzxnmt2igDmH0e7/tXTYkhkFtaTeY0/wBpbEilGJUrnPDlcA54HWqn/CNXkuj6 lA6ecJNqWi3BG9Dja8hIONxzn8M8ZrsqKAOYudG1M+IDLaylIQoEUu7iNBE67Me7lW/D2qiujalH orW81vO5kmTascgJhxEFeT7wySwZgM9SDXa0UAc9baZc23i17uKJ3gniCzST7SU2qAuwg5yTncDx XQ0UUAc/em4/tHU47aK9LSWgCPhtm8bvuk8A4I6VWjFzbafp5eK+YpeFgI0fiPP8S5JAx0BJrqaK AKeqSeVYSSbHfbztQZZvYD1rLMuJY08uQ7wTuA+VcY4J7Hn9DW+VDDDAEe9N8qP+4n5CgDnzc4hl k8ic+WxXYF+Z8HGVGeRUhkxcCLY/Klt+PlHOMZ9al0bV4tUu72Ewxr5Eh8pgpHmR5I3DI55B5HHI rVkiHlP5UcfmYO3cOM9s+1AGD9p/ceZ5E/39mzb833sZxnp3z6VIJMzmLY4wobeR8pyemfXirGkX zam7kwwrHEirJgcib+NfoOKv3QWG0mlSOPciMw3DjIHegDEW53QxSeROPMYLsK/Mme7DPAp4lzJI nlyfIAd2OGz2HqeP1qz4fvZNVsTcXEMMZJGI1UhkGAfmB7nOR7EVdvFeOzla0giecD5FfhSfc0AY 4uMpA3kzDzuxXmPjPzenp9aUz4E58qU+V6L/AKzjPy+vp9avaHPNqGlx3N5Bbo8nzL5XKspAIPP+ eKn1KVbLTp7hIomaNCwDYA/OgDK8754l8uT94Cc7eE4z83p6fWka52xTP5Mx8okbQvzPjuozyK09 Jn+3WCzTRRK5ZlIRTgYJHQ8g8dO1N1m4GnaRcXcUcJeJdw3r8vXvjmgCiZMTrHsc7lLbwPlGMcE+ vP6Gozc4gaTyJ/lfbsCfMecZAz0759K1dMkN5YpNPAiOSRwhAYA4DAHkAjnmoNduJ9P077RZwWzM rDeZuFVfXj3xQBV8z/SPK2P93dvx8nXGM+vf6VGLnMCSeRONzhdhT5l5xkjPTvn0rbtUZ7WJrmGN JioLqvIDd8GqHiDUl0ewWaKBJZWkCrHsLFh1bAUE9AaAKwlzM8exxtUNvI+Vs54B9Rj9RTVuN0UL +TMPNIG0rzHkdWHatyHyJ4UliVGR1DKQBgg1S1K4kgmigtIrbzXR5N0/C4XHHHc7v0NAFHzvmmHl S/ugDnbw/Gfl9fT60CfPk/upf3v+z/q+M/N6en1rbiRXhRnjjDFQSF5GfY1k6zqMthf2lvbwW5W4 B3SSKcR4ZRk46D5sfXFAELXG2OdvJmPlE/KF5k4z8vr6fWnGXEsaeXId4J3AfKuMcE9jz+hrd8qP +4v5VjajqUtrrltYwwW/lzKGaWRThPmxg46Z6D3oAgNziGSTyJz5bFdgT5nwcZUZ5FSGTFwItj8q W34+Uc4xn1rc8qP+4v5VjXGpyQeJItPW3haF1Q7tpyCd3Vug+7wOp7UAQfaf3Ak8if7+zZs+b72M 4z0759KkEmZzFsfhQ28j5Tk9AfXj9a3PKj/uL+Vc8utyHxQdK8m22iXGdp3bNm7PpnP6UAKtzuhi k8iceYwXYV+ZM92GeBTxLmSRPLk+QA7scNnsvqa3fKj/ALi/lWLa6nLP4jubB4bYQREgNtIZvlU8 HoTzyB04oAiFxlIG8mYeb2K8x8Z+b09PrSmfAnPlSnyuwX/WcZ+X19PrW95Uf/PNfyrG0vU5L3WL y0lt4RHCzhWVCMgEAcnhvfHTHPWgCPzvniXy5P3gJzt4TAz83pTWudsUz+RMfKJG0L8z47qM8jn9 K3/Kj/uL+VY2iajLqV1dJPBbxpCzKoCkM+HZdwzwV4x9QaAGGTE6x7HO5S28D5RjHBPrz+hqM3OI Gk8if5X27AnzHnGQM9O+fSt9okCkrGhOOBgc1laFdXl8tyb+2tI/Kk8tTCc8gkMDn04/OgCHzP8A SPK2P93dvx8nXGM+vf6VGLnMKSeRON7hdhT5l5xkjPA7/St9ok2HaiZxxleKz9FvF1GxjecW32ko HdIhkKCSB1+hoApiXMzx7HG1Q28j5WzngH1GP1FNW43RQv5Mw80gbSvMeRn5h26Vr37La6fczxxx l4omcBhwSATzVXQrxtU0/wA6eCNHDlcBCvYfwnkde/pnoaAKfnfNMPKl/dDOdv3+M/L6+n1rU0pt 9ru2su4g7WGCOOh96dfulnYT3CxRsYkLANhQcDuaj0a7e9sPNkSNHDspCAjoccg8g+1AF+iiigCG 5/1Y+tFFz/qx9aKAJqKKiuLqC0j8y5mjhTON0jhRn0yaAJaKq/2nYnysXtt++/1f71fn5xxzzz6U 19WsI7d52vIPKR/LZw4IDf3fr7UAXKKrrqFo06QrcxGR08xVDgll65HtUf8Aa1h9m+0fbIPJ3bN+ 8Y3en9fpzQBcoqH7XAboW4lQzFd+wHJx61NQAUVEl1BJO8KTRtLHy8auCy/UdqX7RCNmZY/nbavz D5j6D1PFAElIQCCCMg0yaZYIy7/dFQHUoBjJIz0zjmgCWO0t4WQxQRIY08tCqAbV/uj0HtU1Uzqc ABJJAHBJxxR/advkDdyeQMjn9aALMcUcW7y0VNzFm2jGSepPvSuiyIyOoZWGCCMgj0qr/aluVLBv lHU5GB+tH9p2+7aCd3pxmgCxFbwwZ8mJI8gA7FA4AwPyFOZVdCrgMrDBBGQRVU6nAFyScevGKDqc AJBJBAzg46etAFiCCK2hWK3iSKJfuoihQPoBTpI0ljZJUV0YYKsMg/hVX+1LbAO7g9Dkc/rQNTgJ IBJI6jjigCzFFHBEscKLHGvAVRgD8KSaCK5haKeNJY24ZHUMD9QagGpQEDBJz0xjmk/tO3OcNnb1 5HH15oAtIioioihVUYAAwAKZcW0N3CYrmGOaM9UkUMD+BqD+04OOTz06c0v9pQYzzgd+KALQAUAA YA4AFMeGKSRJHjRnTO1ioJXPXB7ZqD+0Yc4+bPpik/tOAjIJxnHbrQBZiijgiWKGNY41GFRBgAew ptxawXaBLmGOZAchZFDAH15qH+0Yc4+bPpik/tOAAEk4PQ8YNAFsDAwOAKjltYJ23TQRSNtKZZAT tPUfTgcVD/aMOT97jr04pP7UtuPm69ORz+tAFyoZLWCWQvJBE7kBSzICcA5Az6Z5qH+07c5wScde nH1pRqUBxgk56YxzQBbqJrWB5TI0ERkO3LFBk7eRz7dqgGp25Bw2QOuCOP1pTqUAIB3AnoOMmgC3 UfkReb5nlp5n97aM+nWq/wDadvgnJwOCeOP1pf7Sg/2vXtQBbqBLG1jumuUtoVuG+9KEAY/U9e1R f2pb7d275emcjH86X+0oBnOeOT04oAt1ElrBG++OCJXyzblQA5bqfxwM/SoP7UtsA7uD05HP60HU 7cEgkgjrnHFAFyoorWCAgwwRRkAgFUA6nJ/M81CNSgOMEnPTGOaQ6nbjOWxjrkjj9aALlRQWsFqH FvDHEHYswRQu4nucd6hGpQHGMnPIxjmj+0oMZ5wO/FAFpgGUqwBBGCD3qG1sbWxDC0toYA33hFGF z+VRf2nBu25O704z+VB1O3AyWwPUkY/nQBakjSWNo5EV0YYZWGQR6EU2OGKHPlRom7GdqgZwMD9A BVf+07fJG7kckZGf50f2pb7c7uM4zkYz+dAFp0WVGSRVZGGCrDIIpIYY7eIRwxpHGvRUUAD8BVb+ 1LfJG7kdeRx+tTwXCXKF4zlc4zQBLRRRQBDc/wCrH1oouf8AVj60UATVj+JtHm1vTYra3kSNkuI5 izEg4Vs8EdD71sUUAYMnh+V9VspPMg+x2cvnxr5f7zdsZSCehyWLZ9aoP4X1Ce0vYpZLRfPvvtih C46rtK54I6A5H06V1tFAHP2+g3EN5amQWc0FtbrGh2lGMgTYXIAweOAM8An1qA+Hb1tJ8hksDPLN uuGBYB027SqnHy/LhOP4eK6eigDEs9CmstemvYrnbbzfM8IycnYqhfQAbcg9eSK26KKAMRdNu5dR umeKK3RkkSGaJxlN2Pm27eWPUknsMVUt9I1C10jToPs1tLPbXLSk7wu1d5OBx1INdNRQBmeIbee8 0eW2twu6bCMW52qT8xx3OM8VzsOi3SJHFdWkN4kaiJC7bSiqxIYDHBIIyB/dFdrRQBwUnh6/ltb1 Z4Yrhrs/aNjHasc2SPT5htPU/wB0Va/4R2ManayrYKsUcJUtvO5DxtA46AZHUda0fDt/f3d7Kl67 mNYdyblxu/eOMn5Rg4CjHPr3roW+6cnHHWgDh7fw9LbWbCGxhRvOZvJzuSRcMEJyMZG7PI7UttoN xaXqXa2Vu1xHbYWRSUHm4wBjHC446/hW94c1I3tqYpJZ55o8s8skezqzADoOcAdu9atyjyW0qRyt C7KQsigEofXB4NAHF2ugXlnAsEkMV9BGWZUkGwMXA3cYIGCCQe+49KnGhbi0U+nQyx8lZNxDKNuB H0zgdOTjHat7Qbma+smuppWbzHICFNoTb8vGQDzjPPrVvUZDFptzIsjRssTEOoyVOOoGDmgDjF8M f6Dp8b6dEXifM4D8KCPmK8dSQD26VP8A8I+63d/LFaIhmKlG3HMoyGdX44BI9+tdHoV+L/TkO6aR 41VXkkTbvbaCcDA7nHSrV9HcS2UyWkoinZcJIRkKfXFAHGf2JqpeGVUtoWtZGnhjjjADMSMqcDj5 QRuHXd0qSHw88Bu2hso03TKyruyJoxg7X49cnnNddp8dzDYQx3swmuFXDyAY3H1xVPxFPe2+nJLp 4laVZkysagllzgjkHjpQBzSaJqKJGfIs2k3K3MQ2wgMThRjqcjkY5FM/4R/Untp7SQp5N84muH2g mJsksFXGHB+UZOOldboclzLo1vJemQzsCW8xQG6nGQAO2Kh8Rz3sFjD/AGaxFw86IBjgg5yCcHFA HOf2Rq81zFdTFEmii+zYU53oQQz7sZByQ231A5pbjQLm7tfsyWkFkGKmWWP5y2wHaduAPvHPqK6/ TpPN0+B/MlkJQEvKoVyfcADBqlr999ghhklujZ2hY+dcAAlOPlHIPU8dKAOd/s7WvtraiIoftTR+ QYd3y7dv3t+M53c7cfjSW+gXdpbrbSQRX1vFuVEk+QEOBk4wQCCD+Ddq7DTppLnTraacKJZI1Zgv TJFZniSS8iNn9kvntRJL5Z2xB9xPQng4AwfTrQBhnQ9Q+1zzqEVbhRE0QzhY0xs+bGTnBBB6Bj1p v/COzTTW8txYW3yzlisYCeVHjjGBgtnByMdBXcjOBnr3rI1mW+huIhaSS7blfIG1ARE5ORJ09N3X jgUAYKeH3invpIrONDJIrJ8xPnICCyvxxkg+vWkk0a+NzbXFtbQ2otWMkcKHIdmb5wTj5RtHYd67 ZQQoBJJA6nvXP63f31vq8UVs7iBliMhA+7mUAkfKc5GRjIwOaAMZfDUi2l5aw2kdul1MFZwd/wC5 HPK4wW4IwfXrU0WkXjBBeW0U8m1FE5Y7odnAZeOp4bAI59a7SsO5e9Hiq3hS/ZIHjMnkeUCpAwCC 2OpyT17UAY39i3AiUrp9uskYCsM5FxhSAzArjIJ3c55qOHQdQFzFNcJCyrELV4Yl2K0RB3EHGQcn 7vTiu5rAa9uh4llgjmldQ8Y8gx/IIyuWbdjqD7+1AGNa6BLbWMK/2dAxDOZbYt+7YtwGB24yAPTu aUaDdm9lmkgjMEsf2Z7YEgCJQNnzYyTkdD2Y129c9Bf37eKDbs7m086RQcdcRoQv3egJJznnpQBi L4YzY6fHJp0ReJ8zgPwoI+Yrx1JAPbpVmfQ3nW4Sewhmc+YyTsxDSFjkKwx0HA5zwK7OsXT7y7m8 Q3kMskhgQNtUx4UcjHJAPr3IPPTFAGB/YV6ken/ZoY4fsK+asY5DykjcM4+VcZ5H948Uyfw7dzQz xva20g8ohCy4aWTOQzNjOB3Bz0Fd5WJo95d3Gq3qXEkjRISFBj2qPmIHYHoB65655xQBiSaLex3V pPZwpGtigEUBPD7j+8BbHyjsMA5qAeHtSa2ntJGj8m+cTXDhRmJsksFXGHz8vJx0rvD0rC8MXV7d RSNqEsrSFQyKyALsyQG+6PmODkHpxQBjw6NdrqMN9NZRPdR2+DL5hy0oACnp0IHP1PWq3/CM3QsP ss0Ed4olWZS/yBSxHmjGCO3B77jXdzI0kEiJIYmZSA6gEqfXnis7Qbma8tZLiedpMuUClNoXb8ue QD82N348UAYP/COxf2rNK1gDC8AQPvO9jggg8dCMDr2qK20CW30+CNtOgkIDiW3L/uyzYG8Hb1wM dO5rrtTkeHS7uSJmWRIXZCoyQQDjA71V8PPdS6PFNezNLLL8/wA2MqPTIAz0z0HXHagDnV8NoLm+ Y6fHsljCoQ5y56kNx0zjrnpW/wCGbE6do0du0KwuOXRTld2BkjgcZqxrs8ttod5NbuyTJESjKuSD 24wf5UujfaDpcL3cxllcb8nHAPIGQBnHrgUAXqKKKAIbn/Vj60UXP+rH1ooAmrI8SaxLommx3MEK ys88cO0hj95sZAAyTz0rXqG5tLe9jEd1BHMgYMFkUMAR0PPegDDbXrxLvTbYpZmW4n8mdA7bosqz qcY4yq9D3NVZPEmp/wBm6lI0MNtc2Cq0iSRlwxZSVjGGHIOAT7jiumNpbm6FyYIvPAx5uwbsfXrQ lnbxwGFIIliJ3FAgwTnOcUAYVz4luLXWGtHtgyR4RwudzMYXkyP9n5Nv1NQQeKL640uSaOCAzpJG oHOJN8SyKijqWywU+nJ9q6Y28JuBOYkMwXaJNo3Aemagk0mwlhWKSyt2jVi6qYxgMepA9aAM+DV7 v/hJWsbyNIIZEBtsLuMrBQXG7PG3Ppz61t1Ctnbpcm4WCMTFdpkCjdj0zU1AGSdVmgvboXMUf2WC NpGaMksgHTdxjJGTgdO9R2uuyXlhY3cUERjuLgwviTOz5ioxgc9Kvw6XaW95JdRQ7ZpCSzbjyT14 zjnAqFtB057eGA2/7qFzJGodhtYnJPXrmgCzeOyW5KEg5HIqh9pn/wCejVoXlpHfWr28wzHIMMPU elVTo0JljkLfPGCqNj7oOMj9BQBD9pn/AOejUfaZv+ejVBbWml36S20EokWUGZ02EbssQW5/2lP5 VdOkxeeLgsfNVCu/HIXOSPzFAEP2mf8A56NR9pm/56NUdlp2nahp6m1ffamQuPlIG4Nknnn73NTz 6fbWglvppChSP95Jtydgyen4mgBn2mf/AJ6NR9pn/wCejUy203T7hBb27hktHUhQpwjY3D9Gz+NS zaZbWqXF1K+0FP3r7ScqoPp6AmgBv2mf/no1H2mf/no1FrpVlc2lpLbtuhjAa3O0jaMYBGfY96Lr TLK0tbqe5kWOF1zOzDgjGOfw4oAPtM//AD0aj7TP/wA9GotbCyvoLa7tpVljVf3DqOACMcfhxUd7 p+n2ds63bhIrqTa4Kk73b6euKAJPtM3/AD0aj7TP/wA9GpbWytL9Yr63l8wbWRJNpHGeRz7j9Kiv NO06xtCt3II4JJckFSQXJ3Z49xmgCT7TN/z0akNxMerk455FSW+n29zsvoZCxkjAWQqQSuc9D71B dadp1haRrcOEhWQMihSfmzuyAOeuTQBJ9pmx/rGxR9pn/wCejVLHpUDObiOQFpUALjncozj+Z/Oq N/FpGjx2kV5OsKIcwKVJ2lRjIx6Z7+tAFn7TP/z0aj7TP/z0apRosBMrA8zgCQ4++MYH6VVuLbTb N0WeYI1pCZlBU/u0xtJH4cUAS/aZ/wDno1H2mf8A56NT/wCxLaWGYdUueZRj7+Rjn8AKguYdPtru MXE+2eNBs+QnarsFHT1OBQBJ9pn/AOejUfaZ/wDno1POg2zQywsAY5WLuuOGYnJP5iqsraXFrSW8 l2BfsuxRtOcHnGenagCf7TP/AM9Go+0z/wDPRqf/AGDbeQIcfug/mbccbt27P581AE0/+13gFxi9 2qjfIen3gM9O5OOtAEn2mf8A56NR9pn/AOejU9dBtlhiiUYjhYNGuPukdD+tQJDpzX8kKz/6TKxi cbD8xVc49OA360ASfaZ/+ejUfaZ/+ejVINDt1SBRwtv/AKoY+5xjj8Diq8dpps93dWiTK00gJnTB +YABT+QIHFAEn2mf/no1H2mf/no1S/2LDvibPzQgiM4+6CMH9KqQ2WmXj3dnFMsjMS08eD8xJwT7 8jHHpQBN9pm/56NR9pn/AOejVMdIiM6zFj5iKVVscgHGR+gqjZWulalDLBayiWPcJXUIwGSd2cnv kZoAsfaZv+ejUfaZ/wDno1STadb27SXsshVkjIaTbkhBz0/Wq9rp+nXUf2e2kDpAySbQpwpPzqf1 z+NAEn2mf/no1H2mf/no1Pl022tRPeSybMR/vZMfwrk/pk1XsLHTr61iNm+6G2cCMbCvlsBxweej frQBL9pn/wCejVdsZHkiYuxJDY5qldadZ2dvdXNxJsjdczttJyAMc49vSrOkNbNZD7FJvhU7B8pX bt4xg88YoAvUUUUAQ3P+rH1oouf9WPrRQBNRRRQAUUUUAFFFFABRRRQAUUUUAFFFJmgDJ0fQRpNz LMs/mGVNrjYRk72bPU/3sY9q1jnBx1ozRmgDO0nTLnTgyz332hMYVRFsC/MST1OTz+laJ5BAozRm gCnpNg2m6ets8qylWY71j2ZySemT61PdRNcWk0SOI2kQqHK525HXHepc0ZoApaXZT2NuY7i7NyeA p2bAoCgYAyfTP41bliSaJo5FDIwwVPQinZozQA2KJIIljiUKi8BR0FVNX0tNXsfs0krxjerbk68H pV3NGaAK2nWQ07T4bVXaQRDG9up75qLV9Kj1i2jt5mxEsqyOuM7wO3UY+tXs0ZoAjto5IbaOOaUz SKoBkIwW98VU1ayurlYpdPliiu4SfLeVSyAEYOQCM8e9X80ZoAgsbb7HYQW4wfKjVOPYVDqenHUP s+2RIzFKHbdFv3qOq9RgGruaM0AHQcVS1HTF1CW2dpGTyX3MAM+YvBKn2yFP4VdzRmgBayNS0Eaj qMV2Z9jRBAg2E4KuHJ6jrjHNa2aM0ALVGXTjJrEN7vjCRxsrRmIEsSRht2eowO3rV3NGaAFrLfR3 k1V7p7nMLSJKIRHghlGB82enfGK080ZoAWsiLQRHrran5+XZ2YrsP3SiqF64425zjvWtmjNAC1m2 mkm11W4vDcFhNn92E2gZI6+uMemeTnNaOaM0ALWbp2kmwvLmc3BcTEnYE2gZYn8Tzjt75PNaOaM0 ALWZoujf2NC0ST70f5mG3GXyct1OM8ce1aWaM0ALVLSrBtNszA8qSnzGfcsez7xJxjJ6ZxVzNGaA IryA3VlPbh9hljZN2M7cjGcVFpdgumabDaIQwjGNwBGT68kn9atZozQBW1OzOoabcWgk8szIU37c 4z7U6xtVsrKG3TGI1C5AIz+ZJ/U1PmloAKKKKAIbn/Vj60UXP+rH1ooAmrD8XX95p2kxS6e5WZrm KM4UHKlsNyQQOO+OK3KKAOYkvNSXVdNsVurkyiX/AEvNuu1oyjMCGxjghVJGOvSs6fXb6XTL8W93 K7xaj5ayeXtxBt4JIXgbsjIB54ruKKAOXtdSvJdTsopL145Psiy3EcsG0DMZ4wOrbvmODwBjvVQ6 tdHQfPXU33S3GyBmiww+XjzOPlGcvjHTC9a7OigDnrK/v28US210kjQhcRNHwm0IpLsMd2LAc8bc Y710NFFAHO32q3Nvf3iW92kwS2kkCAKfKZSMAgcjrnJOD26U3+2ZIre0kk1GLyzemDzHCDz0zjOe n4iui2KGLBRk9TjrSGKMqAY1IXoMdKAM3xJNPbaHPNbSRRvGN++UZUAcmubbW7i3awE0kUqMvmXc sa/JGjHCMTn5fXv0NdtLEk0ZSQZU9qh/s+2xjyxjpQBxsWvyymdWZYkaUNbzOnHkZI39fmGQOePv ihNdmkWIibBdlRFNsczEkjcBuyADxkZ9elb+k3VnrBm8m0kWOEmNmZlI3A4K4BPI/rWjJZQJGXWE uyKSqqeT7D0oA4s6pqa6VNctf2H7u48oyBBgYbaRjdjrg9elWLnV7m1nEcjK0y4X7PHEWMp2biwO chScgHBHBroLB7PUH2RWzhPKSVmOMAtn5Tz94Y5q99gt8htnI755FAHIS6rNDFu/tG1kiIJ86OMH aQM7CN2CTnjnOAe9JBqGpXF1OiXVoAtusqo8e1kDZwzDOR0yQemRXRaTJp+s2H2i3iIj3lSrY4I+ mRyMH8anvYbaysri6eFnEUbOwU8sAMkc0Acrbapdy6fbSS3tnEZo2lS4K/u26YTGeDyc4OeKPt+p +ZqS/bLH/RUDY2/6vOCCeeflz1xziuk0s2mq2K3EduyRljtDMrA47ggkEe4p+pLaaZp895LCXSNd zBSASPqSB+dAHMJqGpFtLzd2JF2M/d/1nVuOePlwOM80g1W/jh1AyXFtNLE4ghjiTLCU4wuM/Nwf boa6nT47XULKK5W3aNWyVDEHjPUEEjB6gim6ktrpmnzXZtZJvLGdkQyzHtigDmV8R7p7M8LAFxfE ji3cnaAxz8vIPHNRDxFcva3CxoftkkgNihj5mjY8MFz8wABOeK7C2trW6tY5lhZVlUNtcYPPrVbV 5rHRrRbm4hJTeI8qQNuenUj6fjQBzy+JY3voH3qunmMCeU42wykEhWbPBGMYx3FQDxFdnTyohb+0 jIGjg8v5nhI3btuem0EZz15x2rsrezgmtkd7YxFwGMbEEqfQ4yM1U1e4stGihlmt3fzX8pdpAO7B IHJHXGB9aAMD/hJYRfs/mKdM8r5Z+Nvm7d23dnrjjGOtV/8AhIrtLGJXiP8AaCSFriDy8MIgNxbb n5Rgjnmu0jsLd4lLQbCQCUODtP4cVQ1S7sdKnRJraRzJDJIrLjB2AfLknqc8dqAMIahfy3d+sF7Y tFFGJI+PuK3KsTnn5QfTkikg1O8ksrZpL2zieaHzUmZfkkyeExngjvgk11yWFsyBhFjcBkf0qlqU 1lpr28cltJIZWwoTHHIHGSOeeg56+lAHOP4idXvhxg5Fg23/AF7A7SF5+f5j7cfnQviJzJZZHC8a gNv+oOdo3c/J82T34/Ouy/s+24/djjp7Vl3d7Y2eoNZvaytJiNgRjD7329z1B5PtQBzranqcen38 73thm1k2MwXhMDkYzz1AHTvVh9XuYL+2t5GjkXywtxKg/drK+fL5zwDgcc/eFdb/AGdbYI8sYPUe tUZZbaLURZ/YpjIzLtIxhlxy/XovQ9+R60Ac5b6re/Y3kubu1K+e0XnxoMR7d2QRuxkkADJHWiPW ricwrHMqSS4SON7cgvlchyN2VXJ9xgGux/s622keWMHqOxqk0lr/AGh9nS1kcK3lNKGUBWwDjk56 EdB3oA5y01S7lsYZJ76zVZmfbchRsXbwFIzjJOe/QVL/AGtJCJJbm8tUEIbfBtwzgLwynOcMcYyM Y966v+zrbbt8sbfTtWf9pszrTWDWz7wQolJUgkqWxjO7GAecYyKAOfg1i6mtkjnmhsrpFYTNOmBv GNq7d3GQQepOOlStqdyA7/abYMpKvblfniG4KHPOcY+Y5A4xXWHT7c9Ywec81nQ3VnNrEtibaRJF JTzCykPhQx6HOMMOooAxDqFxu8salY9N0c5T5JucbfvdR3xnqKgbxFKReqn33bGnZTPn/Nt+UZ+f B57cH8a7L+z7bAHljA6D0qjZS2V7OEW2dAyl4XbGJFBAJGDkckdcdaAOdXxGzz2e1cxbcXnH+okJ 2qrHPyncDxz1pE1yZm2NcIpKq0j+T8tvkE7Sd2Ccjbg45rsf7Pt+cRjnr71m6Nd2OtRzNDbsm0je GZWznPXaSM8dDyOPWgDn11+YrE+8sWwEhFuQ8+RncBuyozxnkcE0o1yT51+1oVXBacQfIh2k7Ad2 GJ6dQRj3rr5bW0giaaRdqxKWLf3QBzVaxFvfCRTZvCBhsOVO4HocAn9aAOdh1lmT7RPdwQxoNzQy xlJHTZneATkZJ4HI465qt/bOpSWdvmW3tbvzhDMlwmCWblPl3cAj612N3b21raTXLwlxFGzkDqQB nAzVfTJbDV4pZbeLKRuE3blYMdobggnpuxQBz51G/jvr9GmtXjt1U+Wo+aMMeCeeQByelb3hq8N5 ZTsZvO8uYoJBFsDYA6ckH6iptRFrptlJdvAzhMAhCATkgdSR60/RbuC9smltYmjjEjIASOcdxg9D QBoUUUUAQ3P+rH1oouf9WPrRQBNVa+1C102FZbyZYo2cICc8seg+pqzWX4g0b+3dPS187yQs8cpO 0nO05xwQRn1BoAf/AG/pu62X7WmblikIwfnYEgjp1GDx7Ux/EmmpaNdCZ5IUyWaOJ3wAM7jgfdwM 56GmPoTSapa3Bu3+zWriWKDaPlbYU+91IIYk55z3qBPCsC2WoQ+bsa/2rIYk2qqL0VVzwMZ/OgDR /tey+1LbG4USsm8KQRxgnk9jgE464BqL/hIdM+yfaftQ8rdtztOc7d3TGcbfmz6c1WufDFvdas95 JI2yQhniA6sI2jBz2G1zx64qunhR4bBreG8XMsiGYyRZEiIgRUwCMDCjPPPPY0Aa8Gq2tzfy2cDt JNEqs+1CVUMMj5sY5HPWrlZK6GF15NSWRIyqFWSKPaZOABvOeQMcDHFa1AFQ6pZiaWI3EYeFS0gJ +6B159u/pQmq2UiQMtzHidikWTgsw6jHrVC80e4vru5eSSFEeB4YyoYn5sHJBOBjHUdaa+lah9nh 8t7Uzfazcy7g23r0Xv8AnQBsTzCCPeQTzjFVv7SX/nm350/UkmksXW22+d/BuBIB9wO1ZxtbvzY8 IPLwd4KnJPGMe3WgBbFLXT2Jt4pQSu07pM7vmLZPvljz6Vd/tJf+ebfnWc1rf+TLtWPzSx8slTtC 54zzknHpUhtrr7QCIx5O05GDu3Z456YxmgCSze2sBKLeBlEshkb5s/Mf6e1SXN3HdW0kDpIqyKVJ R9pAPoR0qn9lv/Ixtj87f12nbt3emc52/rUgtrrzyTGPJ2jAwd27PPPTGMUAOsls9OeQ2luYlkC5 RTheBjIHQH1PfFTXVzFeWktvLG/lyoUba2DgjB5qmtrf+TFuWPzQw80hTtK99vOQenWni1u/Mkyi 7MDyxtOQec59R06UAWba6jtbaOGNHKoMAs2SfrTL6aDULOS1njk8uQYbY+0/nVcWt9sg3Km4f67C nB4/h5459e1Btb7E+ETJ/wBTlTxx/Fzzz6dqALsV8kMSRrGxCAKMnnin/wBpL/zzP51Q+y3m+L5F 2gHzflOSccbfTn1prWt/5U21Y/MJPkkqdoHbdzyevSgDR/tJf+eZ/Oq93Lb3yxrPE5WOQSABsAke vqOelQm1uvPUhB5W07gQd27jGD0x1/SmG1v/ACGAWPzd/wAp2nbtz3Gc5x+tAFy2uorW2jgjjkKR rtXc2Tj61FeNbX/lC4hdljJYKGwDlSpz68E0z7NdfaM+WPJ29MfNuz69MYqMWt/5CArH5u8byFO0 rnnAznOP1oAvRXyQwpGqOQihQWbJOPU96qahDZ6mT9rhkYGJoiokIGCQT075Uc0C1u/OfKDyto2A A7gec57Y6frTVtb/AMqHcsfmAjziFOCMc7eeOcdaAL41FQABGcD3qpfLa6g8TXEUp8voFkIBGQcE Dr0FM+y3m6b5FwQPK+U8HHO7159O1Atb39zlE4/13ynnj+Hnjn17UAX/AO0l/wCebfnVG4hsru6+ 0TQyNIGjcfvDgFCSpA/E59aa1rfbJ9qx7znySVOBxxu555z07U42t35seEHl4O8EHJPGMe3X9KAL 39pL/wA82/OqzyQvqMV4RMJI0aNVEmFwcZyOh6D8qrm1v/Jk2rH5u4+WSp2hc8ZGck4z0qQ2119o BEY8nacjB3bs8c9MYzQBd/tJf+ebfnVCa3sZ9QjvJLdzJG/mBd3y7wMBseuMc+wpv2W/8gDbH52/ rtO3bu9M5zt/WpBbXXnsSg8naMAA7t2TnnpjGKALv9pL/wA82/Oqca2sWqTagsLm4mUIxLZAA6Y9 KiW1v/Ji3LH5oYeaQp2le+3nIPTrTxa3fmSZRdmB5Y2nIPfPqOnSgC9/aS/882/Oqdstra39zeRx P51yQZCzZ6DHHp0FRi1vtkG5U3D/AF2FODx/Dzxzjr2oNrfYnwiZP+pyp44/i5559O1AGh/aS/8A PNvzrOsoILG+luUe4cOCqQuwKQgnJCDGRkj1p32W83xfIu0A+b8pyTjjb6c+tNa1v/Km2rH5hJ8o lTtA7bueT16UAaP9pL/zzb86p2CWumri2ilAKhSC+c4zyffnGfYelNNrdeepCDytp3Ag7t3GMHpj r+lMNrf+QwCx+dv+U7Tt257jOc4/WgC+9/HJGyPCWRgQwJ4INVLCOz02SaSCGQyTYDu77mIHQZ9B mj7NdfaM+WPJ29MfNuz69MYqMWt/5KArH5u8byFO0rnnAznOP1oAuXF3FdW0sEkb7JUKNtbBwRg8 1HZPb2AkEEcmJGDMGfPIULx6cKKiFrd+c+UHlbRsAB3A85z2x0/Wmra3/lQ7lj8wEecQpwRjnbzx zjrQBau57e+tZLe4gLxSDDLuxmpdKgtrW0MNnD5USsTtznk8mqP2W93TfIuCP3Xyng4/i9efTtWj pscsdticAScbsDAJxzj2oAt0UUUAQ3P+rH1oouf9WPrRQBNRRRQAUUUUAFFFFABRRRQAUUUUAFFF FAGB4bS+SSc6gbpmfJjMjNtCbmABB6N3z3BFbsieZE6bmXcCMqcEfQ+tOooAyNEjvS0r3xmBjAt0 V2yHC9ZMerZ6+1aVzMbe2lmEbylFLBIxlmx2A9alooAxvDh1GO1kttVVzPGwYSFiysrc4DEDJByM duKu6v5v9j3n2fzfO8l/L8rO7dg4x75q5RQBnaFDPDpUX2qSV5n+dvMLErnt83OPrR4g+0f2Fd/Y /N+0bPk8nO7OR0xz+VaNFAFPSoZYNNhSeWSSQruYuSSCecc84Gcc80up2kt9p8tvBcyW0kgwJY/v L64q3RQBDaxPDaxRyyNLIqgM7dWPrWf4iS9ksYU015EnadBuXOAOclsdv/rVrUUAVtOz/Z1vlZlO wZE5y4P+0e5rO8SR30sNqmnNMshlO8xkj5NjZyR0PTBPQ4raooAitjm1iIEgGwcSffHHf3rE8SDU fOVtO+1HFrNuSIkBidoGD2cckfQ10FFADYwVjUEkkAAk1ja/9tM9mLP7VtJO/wAngdV6n6Z6jHXv ituigArndUXUjrTfZTdm2Y26sEJCj94SzKfoMMPQ+1dFRQAVj3EU58Qwost4LeRfOcrnYrLwFz0A bJJHfA9a2KKACsKdr4a9GPKu5EMo2lJSkSxbRkkYIJ3buDg9MVu0UAFYUSXz+LLgg3CWiBWy7N5b jZgqq4xnODnOeDW7RQAVhWCXzeJb5nNwlqj/AC+YzFZAVXAUEYGCG5B71u0UAFc/ot1PJqssEr3J lRGNyJFbyw+4bfLJGMYznHtnmugooAQ9KwfC66hHFKNRNwSyq6eaWbjJzkno3qOnAI61v0UARXPm /ZZfs+PO2Hy89N2OP1rL0Frky3Imiu1jAXD3MhJZsHdhSOBn0JHpWzRQBV1PzP7Ku/I8zzfJfZ5f 3t2DjHvmqXh77b5Nz/aHmeb5o27t23b5a/d3c9c5981r0UAZ+upcyaPOLLzPtHBQRttY4YEjP0zU fh5L1NNJ1ESCdpXYrI+7AzwAfT0rUooAKKKKAIbn/Vj60UXP+rH1ooAmrP1nWINDslurlXaNpVi+ XaMFjgEliABnvmtCqWqaVb6xbJBdb9iSrKNjY+ZTkfUZ7UAVW8QIjWCtZXYN9IYo+EwrAE8/N0wp IIzkVBc+K4LewublraUfZ7o2jqxUYbAOSc4A5/OrzaHZtqaXxR/NQhlXedgYKVDbemQpI/Gqq+Fb IRzKZbtjNP8AaCzTHKyYxuHpxxQBImvo9zax/ZLlVuYw6MV77N+MdeBwT0BIHeoW8TIthPctZXI8 iQpKnHy4XceemcHGOu75etWYNCtra6Sa3knj2QC3WMSHaqAYAAPT1+tRjw3bLYQWgubzy4JfNQ+b zu9zjnnnnvzQBJa65Be6rLYwD54VBkLMFIJAbAXqeGGfTNadUE0azTU/t4jP2jk5zxkgKWx6kKBn 2q/QBnvrMEV5LbzpJF5cbSF3A2lR1PXOPcjntTY9bhkitpPJmCXEvlIw2sAexJBOP5+1FxosV3NO 9zPLIssTRBDtARW6gEDJ6d84qI6APJjRL2dGWcXDOqoN7AADjbgDA7AUAXdQvFsLQzN2IAAGSxJw AB3JrGbxZFHcxW8kU6SykABrdhjJwM+nIrY1Ky+32Zh3FW3KysOqkHII/Gse28Lm0e3aK4f9yzuQ SCHLdc8cewGKAEm8XQW6F3SYr1VlgYhx6qe4qZPEqSiMxpIyuoYsIWIjB6b/AO7+NRHw48llNZre yCFl8tVBU+UPQcfhzmluvC4vJleaRiMqXQHAkKjAJwMjj0xmgBJvFsVvCJZIbgIxAUi3b589CPUc fyqU+JYgwB72/wBpH7s8p1/P261VHhQOk4S8k3ybFLhlJUIchcYx2HOM8VNJ4ZU6h/aDS4uQ4YSZ HyqBjZ0xtOT780AEHiuK5h8yGOZjuK+X5DbzgZJ2+gz1pp8YW4mliKTBolLNmBh07D39qT/hF99i tr9qcmPcPM+XdhzkgjGMfhnipofD7WcjyJcFUMKxBWIIQLnByRknk9TQAyHxVHcQLLDHM+4n5FgY uAMZJXrjkfnTD4xtw06lZswDLfuG55C8evJFI3hQTafDb/aXKpH5XmArudMg4OBjsORzxU3/AAj7 RC7P2kqlwgTnbiMBdowSPT1zQBCPGVsTAAsuZ/u/uG45I+b05Bqx/wAJIvzERylQcKwhYrIc4wh7 nNJHoLkWLJdFhaD5SNpEny7fm49PTFVz4SRJTN57qUXER3DEIBzxxz+OeKALDeJVXbuimBONwMDZ jycDd6ZP+PSkHidGOFjlLEAoBC370HOCnr0J+nNR2fhj7Iq/ZbmRVP8ArMMD5vJPORx1I4xxTj4f kigVTeuqxEGEkr+5wCMDjng45zQA4eKImCELJsbALmFgIyegb+7689qB4nU5Ahn38YTyG3ODk5Ud xgZpR4fkZi32qRklXEy5GJuMZJxkcccYpr6DLHEhfUJFaM/upWKZjBGCMbcHI9eeKAFHimEhWw4j Yf6wwtsU43YJ7HHY0HxQoDZhnDr1j+ztvAxknHpgjn3pT4ddvMU3EhhmB82LcMOSMFicZzwOhxTZ NDnUI8moyLMuVWYlAdpxlcbcdgemaAHHxPEDyH2EHEnlNsJA5XPr2x68Uh8UIqsTDOGTO9Ps7b0A xkkenPWlbw47CVDcSeTISxiyMBic7s4znPPXGaRtEnR45H1GRZ/u+aSgLrnO3G3A59BnmgBT4njD ldrkc7WETFZCCBhT3OTjFJ/wlCYz5U2QcOvkNmPnHzDsM/yo/wCEckCNGtzIIt26OMEYibO7I4ye fXNH9iSxzxub9xMQFdiVBlAJIGMcYyemOtAA3iiNI5ZCkmyJPM3CFiHXOMr/AHuT2pH8VQpfR2pz vkAYOIyUwRkZboOCPzpr+FzJAtvLcPJaKykW7EbMDkKeMkdO+eKIPDf2d4QLotHDG0AiYrjaxzg8 Z4AAHPQUASjxIGUEQTndjYPIbMmcnK+owCfpT49fEt0luFKyvF5oV42X5c45z0Pt1qmPCADO4uJP NYBVckfIoBGMYweDjJGaiXwdDG4EN3JHdKMJKHBkRNpG0ZHQ5J5HU0AXB4ohNil3z5LSeVkxnIbO OR2HfPpzT5fEiQzNHIGAUlTII2KBgMld3r/+qqX/AAhFrt8rH+i9fs2R5Yfbt39M7se+KnTw8dr2 7XryI4/eRFl+ZuMscDOc4PpmgB58UIqsWhnDJndH9nbeoABJI9ORzSnxPGGwVfHO1xE21yOCAe5y cY9aDoFyWWQ383nrlfN+XJUkHbjbgcjPTNN/sAsZIVu28sneIQw/dtu3bhxn73PPFACnxQgUkxT5 UkOn2dtyY4yw7DPenf8ACSLgkRylc4VhCxWQ5xhD/Ec0DQbkSJKL6UTAbXk+XLrnIGNuBjJ6Y61V XwrE05ljuG3RjbFtcHyec8cc/wDAs8UAWx4i3OqiCcscbl8hspk4G4ds4P8AOkbxNEttcznJS2cx yARknOccDuPcVUHg2NYkjSeVVDB3w/LsCSD04xk8DAxxTIvB1q2FSUPCSpni3ArOwyQz8Zzk54xQ Ben8SJbvhgzKACzxxMyrkZGSOmRzUUfi6CWze5CyLGjrG2+FgwJ6cenv7GnWnhySx2eVdyBFA3KS uHwMDJxngADjsBUX/CKx3NnHBPP9qgWR5NrlcOWz1wB0ycfWgCzL4kSCZo5AQFJVpBGxjUgZwW6A 4ph8UKA2YZw6/ejNu28DGScemCOfemp4ZeOFomupXhdcSoxGJDjG4nGc8DpxxSjQ55Qsi6jI0q5A mGwkKcZXG3HYds0AOPieINyH2kHEnlNsJA5XPr2x68VpaXqH9owSPskjKPsZZIyhBwD0P1rMbw8+ 2VWuXEDksY9wwGzndnGc5564zWnpdu9valZLk3BZifMOOfyAFAF2iiigCG5/1Y+tFFz/AKsfWigC aiisPxcb8aTF/Zfn+ebmIHyd2dm75s7QSBjOcUAblFcw8OpDVdNtUfUdsE264lL5jkjKM2M98PtX nkiqZ0/VptH1JJHupmXatm+94ndyMM5GQQMkEDpwcDFAHZ0Vy9zDrSeICLVpDCqgRMxJj2eUwO7t u8zYfXFUkGrrorJcHUFd5kWIqrMyHyhvd8ZO0SbmA7nA6GgDtaK522hvYPFzOxuLm3miALOGRYNq jkc7W3HPAGRXRUAFFc5dXl1Dql6bKWacx20jGJgSFkGNoxgAD0IyTzUEepPDZ2Ukl1cD/TNrMNzr MuBk8rkKM47DINAHUlgoyxAHvTfNT++v51W1SVYdPklkzsT5jgEnA9hyayzMgljjOd0gLL8pxgYz k9uvegCTRNPksLy8ln+zqJT8pR9xPzMeTgf3u+TnPOMVrysskLosoRmUgMD096wWu4VgllO/ZExR v3bZyDjgYyfqKkMiC4EHPmFS4+U4wDjr079KAH6HZTWNxM0y2cUZREXygNzkZyzNxnPXB55PNXtW jF5pF5bR+VI80Loqu2FJII5rK+1w+QJvn2F9n+rbOd23pjOM9+nfpUgkQ3BhGfMVQ5+U4wTjr07d KAJdA03+yDeI8isssiusjSBmbCKOeO2MD2FX9QC3GnXEKCKRpI2UI7ABiR0NY63cLQxSjfsmYKn7 ts5PqMZHTvTxNGZJIxndEAzfKcYOcYPfp2oAuaIJ7awWC7S2hEQVI0ifcAoUAknA75pdetzqOiXV rAYmklXCh2AGcj1B/lVAXMTJAw3Yn/1fyH0zzxxx64oNzEBOTuxB9/5D6Z44549KANXTLeGw0+G3 Qou0ZYAjljyTxgdc9ABTNWh+2WYSJonKurmJ2wsoB+6fY1nefHvhX5szAlPlPYZ59PxprXUKxTSH dtgJV8IScjrgYyevagDS0aJ7PTUiuWtlk3M22FQqqCScYHeo/EFu+oaQ8FsLeSUvGwWUjb8rgnIO c9KqGVBOsJzvZSw+U4wMZ56dxTDdwiBpjv2K+w/u2znO3pjPXv070AbGnwx2NhDbiUNsXGSR9fy9 qpeIrSTUbGGK2Fu7pOkhEuCuB14OQTUHmJ9o8jnzNu/7pxjOOvT8KjF3CYEmG/Y7hF/dtnJOOmMj nvQBt2kcVpZw26y7liQIGZhk4FZniKxfVIrRIBbt5c+5zJtO1SrKSARyeaiEqGZ4hneihm+U4wc4 56HoaYt1C0UEg3bZyAnyHPIzyMcdO9AG7D5cMKRLICEUKCzZJwO9ZHiDTG1W4sfLMHlRs4ldiCyK wxlcjr79qj8+PdMPmzCAX+Q+mePXj0pBcRHyPvfv+U+Q+mefTj1oA3xJGABvXj3rE1nTG1LVrGRT CII1ZZJCRvXJUjbkcfd6j1qNrqJY53O7bASJPkPYZ4GOeD2zTjMgljjOd0gLL8pxgYzk9uvegDd8 1P76/nXOXehvP4j/ALRUxbRcQuF80AMFUgsRj7wycfWntdwrDLKd+yJijfu2zkHHAxk9eoqQyILg Qc+YVLj5TjAOOvTv0oA3PNT++v51gLpko8YPqJS3MDAYcuu5SExnGM57dcY7ZpPtcPkCb59hfZ/q 2zndt6YzjPfp36VIJENw0Iz5iqHPynGCSOvTt0oA3PNT++v51i2ukwQeJbm/EEKq6ApMJcszHO7I x05HftUK3cLQxSjfsmYKn7ts5PqMZHTvTxNGZJYxndEAzfKcYPTB79O1AG75qf31/OsSx0xovEd7 fymFI3fdF5ZG58qoO44z/D096jFzEyQMN2J/9X8h9M88ccDvig3MQE5O7EH+s+Q+meOOePSgDf8A NT++v51haDpb6ZeXM0phCzl2wjAbMyMQOAN2QQcnkdOlJ58e+JfmzMCU+U9hnn0/GmtdQrFNId22 AlX+RicjHQYyevagDoDKmPvr+dYPhXTJdJhuFuUt42cjDRupJHPHCjgZ4zk8nJpTKgnWE53spYfK cYGM89O4phu4RA0x37FfYf3bZznb0xnGe/40Ab7yIY2GUbIPykjB9qyfDsNxY2K21zDa28cSAIsU gbJySx6DHUfrUXmJ9o8jnzNu/wC6cYzjr0/CoxdwmBJhv2O4Rf3bZyTjpjI570AbszI8EihkYspG C3B4rK8M6cdJ0xY7holnYKHSMgIMDHGPXHWohKhmeIZ3ooY/KcYOcc9D0NMW6haKCQbts5AT5CDy M8jHHTvQBr6koutMuoIzGzywuihmwCSCOag0CxbT9MWOQx+ax3OsYARTgDCgcAcfmTVHz490w+bM IBf5D6Z49ePStPSnWS13pnaxDDIxwR6UAXqKKKAIbn/Vj60UXP8Aqx9aKAJqKKKACiiigAooooAK KKKACiiigBrosi4cZFR/ZYf+ea1NRQBkabeRahd3MJsxF5HAJfJPJHI7dPcc9avyw28MLyPGNqAs ce1Jaada2LyNbQrG0hyxHfkn8OST+NWCMjB5BoAydNu4r+Z0e3gjYIsgVZw77W6bl6rxj86s34is 9PuLhLdZWhjaQJu27sDOM9qktNNtbF5GtoRG0n3jkn6DnoOeg4qW4t4ru2kgnTfFIpV1PcHqKAMz Rb6HWUuJBZtCkbhBvPLfKCeO3Jx+FXbqKO3tJZY4FkaNCwQnGcDOM9qlgtIbaSWSFNrykFzkncQA B+gFOnhjuYHhmXdHIpVhnGQaAKtj5N5aRytDGkjorPGH3bCQDgn8aZqskWmaZPeC3WXyV3bN2M8+ uD/Kp7HTrXTYmjs4hGjHJGScnAHU+wAqS7tIb61e3uU3xSDDLkjP5UAVtO2X1hHcSWqxGTkLu3Aj PBzgdRzyAeaL9obKFGW3EkjuI41ztBY9MnsKuoixxqi52qMDJzTLi2iu4GhnQPG3Uf56UAVNOe3v 7MTCOHlipEUokUEHH3hTdWli0ywa5EEb7WRcPJsUbmC5LYOAM1ctrWGzgWG3QJGvQCkvLKDULYwX UfmREglckcg5HT3FAEFh5F9YxXH2cJ5gztPPt17j0PpUGsXMWlWqTC3iffKsZMkvlque5bBrUUBV CjoBgVBeWNvqESx3UfmIjh1GSMMOh4oAjtFgu7OGfyNgkQPsbquR0qprV5FpEMMgtopBLJsJeXyw PlLdcHJO3GPU1r1XurG3vTCbiPeYX8yPkja3rx9aAEhhhmgjk8nbuUNtYYIz2NZ2tahFpDW4+yxy CbdndLsPyjOAMHcT2FbVV7ixt7qeCaaPdJbsWibJG0nr0oAcLaEgHywP6VlarqEWmXltD9kjkWcE 58zaxwVGFXHzH5s446Gtuq8tjbz3kN1JHmeEERvkjaD1oAd9lh/55isS41iK31waZ/ZxYtJGolDf LhgSSeOCOBjvmuhqo+mWklw0zwgyNIkpbJ5ZRhT+AoAl+yw/88xWUt+j+In0tbJCqKGaTzDkArnO MY68dc98Yrbqn/ZVn/aP27yR9p679x6425xnGccUATfZYf8AnmKy7e7ebWpbJ9KMcMYyJ/Mzkc4O 3HAOD37VtVXSxt476W8SPFxKoR33HkDoMdKAHfZYf+eY5rKt9Qim1ybTzaIPKJAdZNzcKrZK4+UH dwc9RW3VeCxt7a5nuIY9ss5DSNk/MQMZxQA77LD/AM81rK0fUotUurqE2axtbsVJVy2MMVweBg8Z 4zxW3Va2061tHDwQhGAYZBPQtuP6kn8aAH/ZYcf6taytB1BNaillayWFUO0ESFsnnI5A6ce3PWtu qdhpVnpgf7HCI9+A3zE8DOByenJ/OgCVrWIIdsSk9geMmqmlyx6hYxTy26Qyuu4xB95UZIHOB1xW iyhlKnoRg1U0/SbPS1cWUAiDgA/MTwM4HJ9z+dAEklvEkTMIVYqCQPWs7Q76HWbVpvsqRkbfuSeY pyAcbsDkZwR2rXdBIjIwyrDBHtUVnZwWFqlvap5cKDCrknA/GgCK8SK1sp7gQK5hjZwucZwM4z2q LRL5NRsjMkSRjfg7H3q3AOQ2Bnrj6g1dmhjuIJIZl3RyKVZT3B4IpLa3itLdIIF2xRjCrknA/GgC WiiigCG5/wBWPrRRc/6sfWigCakJCjJIA96WsPxbpVxrGkxW9oqmRbmKQliOFVskjIIJx2NAG1vX j5hz05pr3EMcbSPLGqKcFiwAH41zsnhyRtV04LbWgs7GbzkkA+c5Rgylegy7bhjgYqjJ4d1Kewvo DaRQiTUTdxqswztK7cA4wDxnkEYJ70Adj5ieYE3rvI3Bc8keuKT7RD5fmebHszt3bhjOcYz65rnb bQ7iK/szNZxGO2tVTzYpSu+QRlOQeQoBIA98noKrf2BdtonkNp0Qmmn3Sos42xps2fu+MZ2/KCee rdaAOsMqCURl1EjDIXPJHrin1gWOkXtn4jmuxKhtJgMhzuZQEVVQcZGCGOc87vWt+gBM4HNAIIBB BBrnL6w1BtbvZ2txeWr2m2OPdt53LhOW9iTxz0pv2GaGx08x6bO0sV0ZSoMa+WM84G7AB7AE0AdH JIsS7nOB0qP7ZDz8x4/2TVTX45JtLZYgW+dSyA4LrkblB7ZGRXNiwO9AbO78lsGNPtGGgbcSSTu6 EY4GeBigDr/tcXqf++TR9sh5+Y8f7JrhW0Nxp+oqkN4ZDLmJDOP3oHQ53cck56dBVmfT7uOSFLWJ pAoQRSTSn9wo65wwyc89CDjFAHY/bIf7x/75NH22HGdxx9DXDSadqM0MltDbi3WXYGneVmOVyWYg N3OORg88jirP2a8uWMk9vNHeMuY5llAWE7MYIB5G7J6HqPSgDsPtkOcbj/3yaPtkOM7jj/dNcQbG 82S7bDEGflg85tzNjhm+fGAc9CM5zjinRaTcpdXMqrNHO1uoV/OJjLn7yjJzgDABIoA7X7XF6n/v k0fbIcD5jz/smuKudIW4a2aK0voU8/5o/tA/drjlvveoHHPfinjSpUvNRkiS5HmFdpaXiZSQXA54 PBA6daAOy+2Rc8nj/ZNH2uLjk8/7JrjH0gSXljLHbXsUYkJZTOD5QHI43dCccDPAqJtEcWuqBIrw uzfuVM4/fYGQfvcfNn04oA7j7ZDg/MeP9k0fbIePmPP+ya40aPs1DT3RbvbHGcu0uRGRyoIzz3B6 9qVLCURqXtLhmG0XK+dxc8HJUbv72DzjgYoA7H7ZD/ePHsaPtcXqf++TXILp8ocAQXIYAG3lM+fI 46Pz83zc9Dnp2qvdaQZ7MbbK9SQSIGQXAw/PzOPm9M9+c9KAO3+2Q4zuOPoaPtkP94/98muRmsJz NKESczgHyLrzcKq7MBWGeTnPbqc5qC6sLuWFE022ls9snnnzpdw3KPlUANxkn6cc9aAO0+2w/wB4 /kaX7bDz8x468GuLdNW+1Xd3HaMBdxmJbcuN0JAAV2O7aR977vPNR/YtXSG1gRATpzF1l3HFyMja o+bIO0kfNxQB3H22Hj5jz7Gj7ZDz8x49jXFrbam1xdSyQt5N2wdoQ+GjVWA2E7sZZf7vHrSvaXqX NrLZW0sUNqTJ5Usu5pN7YZQd2BhR0ORzxQB2f2yHj5jz/smj7ZD/AHj/AN8muJWxvg7B7XcgA88+ ad1ye+BuxgnB/hPGKEsNQIgElqu4lQpEz7YEyd38Wd3f+Idu1AHbfbIc4yc/7po+2Q/3j/3ya4q0 0uS2tGBtrpozcMZLd5gWkQZCEHd7gkZHSpk0wtII5oLvaQPLmW45iTbjaxzyc57HORzxQB1/2yEH BY5/3TSfbYcfeP5GuGXSr4aRFbWqS28rTNO7TSbghX7oGGzzx3xwc1M39r/bZ79LNgJ4/JFsXXdG QPlcndtxuz05waAO0+2Q8/MeP9k0fbIeOTz/ALJrhf7GujBZ210s8ptpvLE0Mu1TGRndgtnIOBzn pUzaMWn1VjHeYkH7siYfvSfmIHPHzDHbigDtPtkXPJ4/2TR9ri45PP8AsmuKTRWDaUTHefux+9/f D90eW555+Y478Co20RxaamEivC7N+5Uzj97gZB+9x82fTigDuRdxHufT7pqeuIj0fZqumyKl3siT 5maXiMggqpGee4PXtXb0AFFFFABRRRQAUUUUAFFFFAENz/qx9aKLn/Vj60UATUUVl+INaXQdOW7e HzVMyREbtu3ccZJweBQBqUVht4gmSXTkaxGb2UxHE4PlnDMD05BVSR06iqbeLLhtPvp47JI5rFRJ NFO7KQrAlV4X72Rgjp7mgDqKKwJ/FCWupm1mt2Cx4WRgckOYmlwB3G1Dz64qKPxXJNpk1zHZZkhZ N6eZxh4xImDjJYhlXGPvH0oA6Sise31uWXxBJp81uLdBGrRNISGmJUMwXjB25wec1sUAFFZkutIN RnsreFp54YvMIDADOQNvP1BJ7U2LWmkt7SU2rbZ5/JLLICq9QGB/iB9RQBqUYHpUN3I0UBZDg5FU ft0/94flQAzRNWS9ea3ku4Li4SSXAiUDaivtGcE81qSsY4XdU3sqkhR3PpWYtzIhJQIpPXCAZp32 6f8AvD8qAItD1R7+4mjkmWVlRHISHasZbPy7snJHTHB4rTvJDDZTyqVVkjZgWHAwO9UFu5VJ27Rk 5OFHNKb2cjBYYP8AsigCPw1qNxqWnl7zZ5oK8BQpwVByQCRg5455GK0b2Y21hcTrsDRxs4L/AHeB nn2qkLyZehUfRRR9tn/vD/vmgB2g3suoaeZZ2R2EhUFVAGBj0JB+oOKn1W5ay0u4uIzGrRoSC/QV WF5MowpUAdgoo+2znqw/75FAE2jXUl7piTTFGcswyq4BwxA7kduoJHpUXiK+l03RpLmBkWRXQDcA c5YAjkgZ57mkF5MoAUqAOwUcUjXcrrtYqwPYqDQBdsPPawha7KNOVBcouB+WTVTxDfPpukPcxyLE yvGu5kDcFwDgZGTg+tJ9tnA4YY/3RSNdyuNrFWB7FQaALmnPNNYQyXSBZmXLADH0OO3GOKq65fGw S0ZbmC3WS4WNzKBgqc5xkjB96T7bOB94Y/3RSPdSyDD7WHoVBoA0LaeK7tYriE5jlUOpxjIPSs7W 9RewMYWaC3QozmWYZViuMJ1HJyfypwvZwAAwA/3RUVw4vIxHdRRTIDuCyRhhn1waANW3czW0Ujps Z0DFT/CSOlY2u6nc2Wo2kFvJFHFKjNM7IG8pQyDdjI4+bHtnPQVZF7MAACAB0AUUhu5SckqTjHKi gDVwPSsXVtVlsr4Ro8KBVQpE4+a5LMQVU56jGeM9am+2z/3h+VRTMLl43uIoZWiOULxhth9RnoaA NnA9Kw9Q1eS11dIDIsab40WMQ72m3dSORgDpnBx3qz9tn/vD8qabuUsGO0kdCVHFAGrgelYc+pXQ 8VLYQMjx+WkjR7BkKSwYls9sDAx3qz9tn/vD8qb9rl37/l3dM7RmgDVwPSsK01O5n8S3NpJJEttE 7LHhBmRtqsVzngrnPTn8DVr7bP8A3h+VN+1yg5BXOc52igDVwPSsTRr+8vtW1FJXia2tpWiUKoBz njkMTwM5yB2xVj7bP/eH5U1buVSSu0FuuFHNAGrgelYnh6/vNRlvHuJIXgileJNqgHIYjPDHjGOu Dn2qf7dP/eH5Ui3cqZ27Rnk4Uc0AauB6UtZa3s5YAsME+lalABRRRQAUUUUAFFFFABRRRQBDc/6s fWii5/1Y+tFAE1Vr7T7bUoUiu4/MRJFlUbiuGU5ByD2NWaKAKZ0myOoi+Nun2oc+Z74wDjpnBIz1 waBpVmLeWHyFaOVg8gYli5GMEk8noPyq5RQBWbTrR70XbQIbgLt3kdun8iR9CarN4f00wRwi22pH J5qhHZSGxjOQc9OPYVpUUAVRptqL5bzys3CqVV2YnaD1wDwCccnvVqiigDNutCsru6muHRllmh8h 2jbaSuQe3fgc0SaJDLbwQtcXeIZPMVvPOSe2T6DsK0qKAK99a/bLR4CzKHGCykgj6Ecg+9UzpBMs cnmnMYKgZODnHUdzxWpRQBiQ6bb3ttMtve+bG8h3tHMSVbOSAQeMenarB0km4E3mncFK4yduM56d M+9N0qyv7SeX7TJbfZ2aR1SIHJZn3ZJPoOK0pY/NheMkgOpXI6jNAGNBp9tcxPBb3wl8uTc2yYsy ndnBIOcZ4x6cVYbTBFI9w8+35MNuY7ABk5x0H1pNJ067sppGuJ42iEaRRxxoAAF7k4zk+mSOtaF1 E01pNEm0M6Mo3dMkd6AMi1023urSH7Le+fDGwKyJMWyR2LZ5HPQ1OdJ2PLKZiN6gNljhQAeQO3Xr S6FpUmkWrQySCXO07ySWJCgEEnsMce2Ku3kBubKeBduZI2QbxkcjHI7igDMttNhuYIGtrwTRwn5X SUtuwMfMc/N179+afJpKpHcNJcFEkGXYuQEGMcHPy8enfmrGj2EmnWRimdXdnLkrnv7nk/U1LqVq 17p09uhQNIuAXBIB/DFAFGHTY7lYJoLoSJGCEZHJVuMc4OG6d+9MutMgtrSc3N55MMrZd3lK7ScD AbPy+wFX9Ks3sbBIZWVnDMxK+5J69+vU8mo9csJtT0qS2t3VJGZCGJIxhgeCOQeOtAEMWnJctHdQ 3KyLsIUoxKMDjnA4PTr9aiudMgtbN/tN55MJfcZHlK4JbONxPAzxj04rWtYEtbWOGNQqooGBVXWr K4v9NaC0kSOYujq7jgbWDf0oAhj00SyLdRzhwyYG1iUIznIHTPvUE2m29pBDFcXvlKZR5ZkmIZ2z kLknJ+npxWrZWq2VnHAmcIOpOck8k/mTVbV7S5u47f7J5G+KZZT52cHGfSgBg0giZ5fNO51CkEna MZ6DoDz1qvLpsFnBbrPeeUkbgI0kpBc4IAJJ+b6Gta1WZLWJbmRZJggEjqMBmxyQKztcsru4CS2E cEswR4Sk7FVCtjLZAPI2+negB39jHdMfObMwAb5jxxj5fT8Krz2lrZtALm/jhMQygkm27hjbk5Pz dR17kd617aLyLWKLJOxAuSck4GKzdW0ia/1C1uopI0NsjFA2cFyVIyO64U/mCOlACtom6OdDM+Jy SxDsCuRj5T/D07U2WxhiurcS3aJKQViRpMb84z8ufmPFbFYmsabeXN2GtEheKcIk7SOVaNVbIKcH JOT6dBQBKdD3QyRGeTbIxYkO24EnPBzkD2FMltYIb6Pzr2OOd12pG0mNwJHRc8nPetmsi80q6l1I T21wkcckkbykoGb5ewyCMH8CDzQAv9h/uBF58m0PvzvbdnduxnOcZ7enFM+zW6akYzexC6dAPJMn OMk5CZ+vPt7Vs1kS6RLP4hF7JIv2ZY0xGOCXUtgnjp8x70AKuh7YYoxNJtiYMpLsWOPU5yRz0NRL bWxvZIlvozcSDaYvNyRtHOFzwcHnHtW3WRa6RNba7c3/AJkZFw53JycLtUDHocg59QfYUAKNF2pA omfEH3cu2W4x83978e/NQR2lrcz3VvDfpJM2fNjSbLR8bTgA5X8O9btZWlaS9jf39zMyO1xKXjwS dik9MHp2zjrigBf7HO+JvObMQIX5jg5GOR3/ABqrDZWl6LmC31BJWZiZBHOSyE8cYOV6dvet6snR NIfTTdPOUeWaV3DKSdqliQBnp16DjvQBJ/ZJ+0JMZTuQFQATtIJB5HQnjrWlRRQAUUUUAFFFFABR RRQAUUUUAQ3P+rH1oouf9WPrRQBNRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFAB RRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFF FFABRRRQAUUUUAQ3P+rH1oouf9WPrRQBD58n979BR58n979BRRQAefJ/e/QUefJ/e/QUUUAHnyf3 v0FHnyf3v0FFFAB58n979BR58n979BRRQAefJ/e/QUefJ/e/QUUUAHnyf3v0FHnyf3v0FFFAB58n 979BR58n979BRRQAefJ/e/QUefJ/e/QUUUAHnyf3v0FHnyf3v0FFFAB58n979BR58n979BRRQAef J/e/QUefJ/e/QUUUAHnyf3v0FHnyf3v0FFFAB58n979BR58n979BRRQAefJ/e/QUefJ/e/QUUUAH nyf3v0FHnyf3v0FFFAB58n979BR58n979BRRQAefJ/e/QUefJ/e/QUUUAHnyf3v0FHnyf3v0FFFA B58n979BR58n979BRRQAefJ/e/QUefJ/e/QUUUAHnyf3v0FHnyf3v0FFFAB58n979BR58n979BRR QAefJ/e/QUefJ/e/QUUUAHnyf3v0FHnyf3v0FFFAB58n979BR58n979BRRQAefJ/e/QUefJ/e/QU UUARXE8nlj5u/oKKKKAP/9k= ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/image005.png Content-Transfer-Encoding: base64 Content-Type: image/png iVBORw0KGgoAAAANSUhEUgAAA20AAAG+CAYAAAAAx+xiAAAAAXNSR0ICQMB9xQAAAAlwSFlzAAAS dAAAEnQB3mYfeAAAABl0RVh0U29mdHdhcmUATWljcm9zb2Z0IE9mZmljZX/tNXEAAFzOSURBVHja 7Z1rrqs6tGYjBUWIKH2sZtTPui3ZTamWHa0bIIbp6ekHhIBJxpA+nXWyefntDxv78j//8z8XhBBC CCGEEEJ1ikhACCGEEEIIoTOYtr+/v39/AAAAAADfxf+j048wbQAAAAAA9YJpQ5g2AAAAAICKwbQh TBsAAAAAQMVg2hCmDQAAAACgYjBtCNMGAAAAAFAxmDaEaQMAAAAAqBhMG8K0AQAAAABUDKYNfY9p +++///4tLQH32/XvcrmYatqHec7jfv9rr+Mx19s9cr3mr7s/VpXKx737a9xzXNu/+4LryGfz1HQF 97z+td3jrwYeXft3NeKwtufcKj5rCdeYfz77HFuGtbp8u+J5zpKnf4WucfXm9mkSq9fOHU9jO6j/ Xx4z/PvNb8tkWxVra/esn94ph1uV4UfbeG12//+puJn6Cgv7CWdjTV6p47k3r9sxbejXTVszFChd +WUry6HxDU3b3FC91zBPldTKyrh/Bvf8qWf1n7mOjuNcQdfTuXH55N1j3jl+D/bIB1veo6Z8u+R5 akz72tkjzvp6P1VPvvPcNdZr74ft6sWX/P/BgLzar+FlpmjLpvY28zKx9vK+ed0h42gwcPm8otNg L/Z8AeH6M++Wz9JnfrRtrXkM04Z+27RNhXThG6szmbbpmRIN5B4jLMvTo57OTdfk46bkmHeO3yfe 9xhp2+4e9eXbsuepMe1rZ484+0QHWD53bfXa1vEVmDbR5siRtr49WhPPtZX3zeoNYXC9sDbp9v9b 48MLY9/X2nkkUY8KVwSmDWHa5sb0Ylec13Dax2TartdgGqM2be7Yy4I3i5uOtL3C5p5dTgmdwjNV /mJq5isM8/M///9VgXY3EW43pUM8q32PscPSDv/m7vW8ppgSoo/t1LXldANvysStez7bY6rgc8+X jXd5TfF8w9u+uxFH5jGJ50wc78ff6/rGNYrys3cNO06nTsOlfFrY46184Hc0pmlV5nn9s7uwjOGQ b9vltVJhnvPcI1tu5mcRZb+fqqRGSsrKkfHMxWlfWh5SYZbTpI3yfM9NvUqVz1xcR+qSgnyj84SO M/OY4P7Lyow3VV6OEGXrsUe6Mx6ktV0GrXKQe1ZrVMtrb8S942FZP+0sadoio2lutKNpytvEWP1k hqkgj8Xzr6xL7HSKl5W15+aNlxyFk8Z/+Hv63a+vZJ2jRzpz9V9z69NoPDd277mfI/tOYT9qyTV1 GGT6uvw55/12uNeSvK37ZsG1bq7spJ/Tut/W+QLThjBta0zbq4D1hV4W+Klh7DtzatTNO+51XdnZ L2kctzBt1jdt8q2Ve+7x2UTnV/w+N8aN1wnqwyob5eD84B76XL9ylubWM0bDteeKT3d+5zi/Fj9f rnPgX/NZQT87n/Jc1zGR19THpJ8zf7yLE/dG2rpGSWdqfkZtQERjIqaMjH9nOqL3d/KBymteuOaw BuEPGvbQtKXCXPJW33wWNTLips0UhS3yzMm0z5QdnXYlYY6X57I0tspnyX1zx0TzjZEOOs7CY7ow 3AvLTGA6Cuqx7PX0c0fqNSvMJc86pU0ff7cueAEwTSsz6j+vbVo57Sxl2vyOszJaTd95LWsTY/VT WTtj5zGrDp/LYby8pdvbdefmRpKGTzVuKg5cur/qSldep7ZTvHS4Nv35+bSVs3Ems5K69+vvxzPM 9yH/9Hn99WJXGrvCa8bCIF9Ayzw/Gqf+GuV5Wz6/fa0xztx58ecsq0/eyReYNoRpW2HavAbSeFut G4bAtHlvCBd0IDeeHhlrVOfO6T0wJt4bpqlzkOo8+x268B6qA2xMFZob03wnfTLOwbcS6edLxrt5 TatR8D+M1sfknzN+vJV21jWK85B+y3+3zU4srPHysjYf+PfWLxfM8Bfkh1yYizrBxosO2Yl202ZK wrbsmcO0KDGtpWGOlefSNDZNTcF9S/Ogzjc6Hcz6KThG1S8ryowMX2k9li+D9vTIXDnIXluaFutl guoY9v/WKIO19JuypabNL1vpPF5yj3fKim4DUnV4qrzl0nnxuQXT/2RaefWR+NZLm7fSa0/m72pP X43d25mb6fdr4710XHpN24DaLwGlYV2StydDFrnWeD81EmeEXd/vE/kC04YwbStMm5xaaI20lZq2 pW8xP2naZGVmvXGU9x87UU220xF0usx7bGvadGe7tFNY2hmJGrIhTee3ZznTVnTNjGmzrpFthINn 3N+05fKabPhTebfIxGfCXJLmVrxOb/qf/22NN76xsK01bbmysybMsfK81rSV3HdJHtT5Jkz/0LSl 8siaMmOZtpJ6bCvTtnR64jQaIUYP5vbHnvKoO9pL7mlNCct906a/q5YGI2f0SkzborIizUCmDq/J tHnPLUcag6mK4dT20oU3woXLjDgLfpfPcR1GOeW1ll7TCoOMG/+Tj7A9z+XtWBsbPI+abqqfM9de YNoQqmJ6pP89i2fa1PQja3pk6aqUKdMmp2quNW3xitcYTbK+fSppEJOVuzZtukNT3uGVKzy5KRBv j7SZ1wy/wZob+YKRtoJrBh1xNSpiXaMk/YMpJ9GOv/6moPB7p1X5QN1bjuKqN7TTb/o7jmnUO2yI Y2HOljnjWbyOsCwHJWEreOYg7QvKzmNlmB8Lv6VIlc+S+y7Kg7pDrfOE9eIkOMaeylpaZgKDUFiP bWHaUnlvaZt1v7WhYW/ENELVCS5Z8KIkvizTdrE6wMH3viXfBRr108KyIp8hV4fvatpcmFSauym9 s/Hq0+kqRlebYZpp+3qhLKcQynRtC8z5FB9qdDp6b2+Ut1FTqGcjueSaZhjUVHmZZlNdWpi3o/9+ 9V+y++VfP6d9PUwbQjuaNv+jZKtzNr79aZr54283PN6pj6mtj9n13ivZ5wk+JPdH7dL7ttgLp+iG NvZxr+4AmKtQeh86j+d06nzrHvbCARfzA3N5H/ls/sflfaXpx1Hp86VMm76mfJ75Le34vNdreG9v ilfkOfU1dfzrt46x50p3dPxnbCJx6t+vbFGCd/JB/N5h3Jh5YgiTmlYmFxuwwlxoVKxncWWyie7J WBK2+ZlzaZ8sOzrtFoZ5yehKqnw+Cu6by4OpfJPKE0Gc6LIvpgyuKzP2ok2xeqw0T83fRefKYKkh zE9HtdJx+l2kz5rVB3P7tA2mubUX4bIWlim9l1neImUlmseMvNmKf28T6RQzr2vPtdrtaDrdGhU2 vbjQRY2EP4pGmvXze8bbuLe8pjdq1TZm2EuuqcOg66s5ra9zvuq/1yvM2/KZ7Wt10XZ+fk77fqXx ujRfYNoQpg0WmNn1b2DLO4Xfs/w1wDeVZ8rn+ZALrmyx9Qz8YB2x8RYCa69J/WOCaUOYNohUmoVT OddX5lTKALWWZ8rnydLXmK7VNaQfvJeH9r6mW6XxqE3DKwfThjBt4NMt2D9ndUUup4Ncq93IEuAn yzPl8+Rp/cbea/CblO499ulryu2UIADThr7HtD0z9D/KNAAAAAB8GZg2hGkDAAAAAKgYTBvCtAEA AAAAVAymDWHaAAAAAAAqBtOGMG0AAAAAABWDaUPfY9pqWD1yXPnoHMss681Qi8In9lwZlwTfdk8X AAAAAAjAtCFM27vcb83LxLhlsrc3be4e2z/7sr1QRqOHUQMAAADYEUwbwrS9S9fMJuZTG9LKe2zJ UtMmR9oAAAAAYBcwbei3Tdtkstom2EjW2hjSHd8O//Y0L7fG28g0db1pOuLrt/FYN0VxNHpyU9vm 1v11/Qhe2wSbpdrXEs/VxZ9DIk1b6tnlM7iRNjk90goLAAAAAGwCpg39rmmTBunSdL4J6b9Nc4Zo +E6tN0zz8c7o3J/mSI48TeZFX+9petw5veHq/3aGyftOzDtu/C24R3CtznuuVLg0/jMk4sKZyuHv 8Xc5VdIKCwAAAABsAqYNMdLWeKNcvglxOKOlpz9qk5K63jxSNRqj+XwxUvcyiN4ol7qHda3wuezn 0JgjbYm48Bci0WH3wwIAAAAAm4BpQ5i2qMl6GaueeSRpvWnTRmacctj/+2h25L87YzZOuQxNW3Ct g01bKiwAAAAA8BaYNoRps4yKnAYYLnO/3LQNpmYaXXse8/y7H72bTdnr77YNpkEG9zCu9UnTNhoy /c1d///zMVZYAAAAAGATMG3ot03btKDH0/hM0w5fUxPlNMTYAiDyt/6Y1PXmfdFeBmha3ONpnJwR atvX3/6CHvIe3nO8jtHPlXqOIOyvb+HKnn1+Du8YKyzC+AIAAADAajBt6HtM2zND/6NMAwAAAMCX gWlDmDYAAAAAgIrBtCFMGwAAAABAxWDaEKYNAAAAAKBiMG0I0wYAAAAAUDGYNoRpAwAAAACoGEwb wrQBAAAAAFQMpg1h2gAAAAAAKgbThjBtAAAAAAAVg2lDmDYAAAAAgIrBtCFMGwAAAABAxWDaEKYN AAAAAKBiMG0I0wYAAAAAUDGYNoRpAwAAAACoGEwbwrQBAAAAAFQMpg1h2gAAAAAAKgbThjBtAAAA AAAVg2lDmDYAAAAAgIrBtKHvMW3//fffv8vl8ocQQgghhNBewrQhtNC08SIGACDPo2v/rpfmr7s/ iAwAgPrBtCFMGwDAt9I17k3w9a/tHvP/Xy9/Tdv9NRg3AIAzgGlDmDYAgG/lcb//tdfRsD3uT5PW dMPvXTOatUfbDv8GAABVg2lDmDYAgG9lMGrX9u+upkM+2uY14vb8N0baAABqB9OGMG0AAN9Kb86u 1yvmDADg3GDaEKYNAOBbGb9huzIFEgDg3GDaEKYNYG/Glfv6hSDoSMMH89n0Pdv3LjgyTfPEmALA d4NpQ5g2gL25t93fve9Q3zoiAz7G8HLgNS1y+rbty4xb13aiTGHaAOBrwbQhTBvAO8xLqo8jZ/Ob /6ca35RN//b8vT/versTgfARZD7s81kqX542bJMhvT/Nm1+WLBM3GFdG5OpKy2E02NiseEEeHdN1 zusl99GzHGTecMd+on7+tfDCpmDaEKYN4B1cgycbxfvtGm2Ee7PWPDuY92HPLPbIAlhU3sToYde8 Op1d99cJI/YoHMW+31rKXw1pKralGP9/3pqihL6+HV6Y9ddp4qPJ+j7ZZ/rQTIhfCy9sBqYNYdoA 3mF8Y+mbr9GYPaLH3pr0W1IAsJEvOpxp06NqvbFrM9+Ljh1aXprUgN5LsF1YL/YmZhhNzqT7EhNz vzUfG5H9tfDCZmDaEKYN4B28aWeTxH5YYppKc5tHCQBgYVl7LeBjlTOJG0Gbju+NXvvwXrBYC5hM U50po/umq5rKNxgSNwWw6aa0ii3cNKXzkG5u6mBoVlImxnr5Flz/lY8ILxwEpg1h2gDewb31dPiL P/jfCvAdG8B6hj3nXuVHljPvGDHNa5pG9jyv/+9oysaO6r3rvJE2d4xVpuHD6SpHnp7p2sg0bvy0 1AxT0Z/5oG3m78Jio0YpEyPzhnUPmY8ILxwEpg1h2mA9R3wTUtNy+VajKDt88u8zLoLAdw4hqc4O fBbZkY0ZKzllbB7RkAsuvEba1PTIoTO8cmEI2KCeMcxFzsR4Jv414tRvJJ9enOOaMDiRkSeVjwgv HASmDWHaYG3Dc8zeT93NLUJwfMc59z2b+3tuBM/V2e8aOq9eehd8KwWfYxoBGF7cpKdGyr+H6Wb9 tLOMaWNU4aByVWhidP2pF3ySx1hl1bqPG01KmRidjwgvHASmDWHaoIzpe4++8/NqID490ubefjdt fArUUegl1OUyzNMUrOnt/bPhvDWnWnxkbNzDVc3OupR6MJJSMJoS5Pnb3ZuWBDvnyembtsTogagX 7v3IhFjyfMoDk4GLfNO2Qzk182PRMu7zAhbvlrmlS72vKUOlz2BtkO7XqbFl6/14m55RTZ2NLrWv 62ojPDofEd4Ny/TCLRA2ybPnXQQM04YwbVBQscppGYNZcRX/Z01bbDSPla4+nN6RPX7OvJS6G6Ed wtHlF4SJ5flawwfnwq18Oeanq/etXrNjh3LJC7BwqXr294KN8uCCLRCWvrSVZe2IMrYhmDaEaYOC StWYJjHNqf9g5Wd1rue34XxX9PF0V43nNyylXjqt18rzHVs1wAc4cuGTJS/ArLJz1DR5+B6WboGw OM9OC4Mt2w+vQjBtCNMGZQwd1p2Xwp72o3FTEZmWthnh8un5D8+/YSl1+dbVPWssjx2R5+H3sEyb v5WInNImp0fO3zP1L7c6MeVNT5uzrhetEyJLvcdf3mHaYD3vbIGQzbOqnWvacCueE/UrMG0I0wbl uOWG9+jETm/fbs1ccWPatovf7j7s8dO/1SxZ1OUbllIPtmd4NdxNE89je+Z5+E1S5cIfhZj/nsvc 3PmUnd3xb2MhisSKgrml3k1z2bH3JLzHu1sglOZZOa19uGdzunyLaUOYNshUqG0bLGm/xypr8k1b j1yVEbZM27LG6+xLqaem+Oo8dlSeh98ktX2BXHglNHCuzMkpYLosipHlkoVcrss2ambvSXiXtVsg 5PKsy5+pTcpP9m0bpg1h2iCNbJRTb2k3r8j7Traci84UnI0byldHr7DhOvNS6no0wDXWsTx2VJ6H 38QybXKE103pfce0WdeLlfGSaZBTZ5nZD/Ama7dAWJpnvfs19WwdtABMG8K0QaYyvXXeaMleb1W9 FdUq+qZNripox9lr9Gb4xqQZR7KsJY2FiTjC2EhjMk61ihuTMy2lbj67Ef/uucM81h6W5+G3ymCQ N9XzhEu1KxP2KnNygRyvLIp6076e6gBHlnr3v4eLL0l/FKVbEXzLbI2SZezPEtZ3tkBI5ln5LVts hkUl31kvANOGMG0AxQ2M9TbPmEo3fE8yNBrhG3Kv0RANBtM/ASiDybBXvjLrsfES34rAbdnRfx89 7pd5/jiMLWP/jWGFCUwbwrQBlBCdahHpMI5/N2aHcb6eXs2KBhaAMmiFm1HfJfkinM7pf796+vAm lrH/prCCB6YNYdoASoitXqk7jFaDWfoRPwteAFAG4f18EW5D8j2jT7Fl7Ke4YKTtW8G0IUwbQAne 909qrr31TYpcBn9Jh5E36QCUQViXLxzWVgTf9E2btYy9zte8fPg6MG0I0wZQQnRZ7mBqVjP9//Rt TcHUrNQ9AIAyCCG/uBUBhuxnwbQhTBtACaVTs/y3oHaH0VoEwR1PYwxAGYTCPPFjWxGw/c1Pg2lD mDaAErxvJBJTs/olxpvmqpbpvmSXpGYhEijKh5nl7h33tvvIUtZHmhrKIOiyUPNWBJuHN7GMPfwE mDaEaQMoRW7GvDVMeYGi/FfQWdP76n1TXqUMAsCPgmlDmDaAJZSOdCyBKVmQzXcLpkX1b+TbD+an o0ekKIMA8INg2hCmDQCgdvQom172e9T4zZZbUS445jVCNa6qOP+/W2mvbcKpV/pYByYHAGBXMG0I 0wYAUDt6VcNHd3+aqO6vff7WNWohhtfUSDciJRfh6H9zZmu8Zjd979X/rve38o9laXwAgIPAtCFM GwBA7Zh7UQ2rJj4NWTOPgsmpkQ+5AMdrpKy/jl6MYzBqbtRNTH20jk09DwAAfAxMG8K0AQDUTjA9 0hmtp0lrvBGwebNdOVI2/3s4rTFl2mJTIJkeCQCwK5g2hGkDAKgdvRCJ3Dx4/O7sOo66iVUj9ZLo /vHzb+7/+7+n0bWXQdTHjs/C0vgAADuDaUOYNgCAM7B0uftH25nfur0LS+MDAOwOpg1h2gAAzsKS 5e7lKJlbWfJdmBYJAHAImDb0PabtmaH/UaYBAAAA4MvAtCFMGwAAAABAxWDaEKYNAAAAAKBiMG0I 0wYAAAAAUDGYNoRpAwAAAACoGEwbwrQBAAAAAFQMpg1h2gAAAAAAKgbThjBtAAAAAAAVg2lDmDYA AAAAgIrBtCFMGwAAAABAxWDaEKYNAAAAAKBiMG0I0wYAAAAAUDGYNoRpAwAAAACoGEwbwrQBAAAA AFQMpg1h2gAAAAAAKgbThjBtAAAAAAAVg2lD32Pa/vvvv3+Xy+UPIYQQQgihvYRpQ2ihaeNFDAB8 gq5p/rr74+9+a/7a7kGEAADAnmDa0G+Ytsf9/tderbcj16o6YI9799dU9Ez323WIp+vtfuhzdE0d 6fXo2r9r4XP0z9y0jyAudXx6efPa/t3vj2rCEjsm9vscxrLf90+30Xjl4r1PO53nazVt35Qnj8ir Op1lnMi4qqW+XVrGUmlZVi76Nmn8u/tg3i/Nx/PzzcedMewl4c3lRV2eU+1kTWm9TT4/Z9jfBNOG fmekbSykugLgrXm2cWmbQ01bf39XOQ8V9kGdyNFQj5W+/Dv2zLJRSZ37aNvd82BJWGLHRP9+NozN K58M4W+6qcG0fj+CoWFX9+9uqjP3DFP7NGjXa/h7U4mJ+cY8uWdejdVtQ+fO5dtMfB5R364pYyVp mSoXfZ3bP8/Y8f3MS5fSfOw63zrNzhb2ojydyYtBeS5sJ49O63fzuRUnZwv7G2Da0O+aNgzb+5Xr 7s9yUEfK6hDot5zeMz6Pk/8uR1CHv1+Ninzbt+db/ZKwxI6J/t7dp4bSC3vk9yPoG+ju1TjrRnsO d9/Rs17wXOsbmf+iPLlnXo3VbXeVN/r/3zsO0p3ZZWWsNC1T5ULGyafazKI0foVFx80Zw14S3lRe tMpzUN4j7eTRaf1OPi8pn2cI+xtg2tCvmbZwaqT3+7MidMPvrjKYh90v/hufZyenbfzfvYrD/fur MzRdx3WOpiF7PUQ/Vzhr7r1n5bo3rrE6gtIOnZtGZ3UQL8YUjbvrNO84DbUkLLFjkp0JI4yp3/dm bKB9Q6ZNm9WI18o35cm986pVtw3xId7SH/GSIVffLiljpWmZKhfTCPMH692izvjQXjbP+j9s984W 9qLwJvJirDxP5ybayaPT+p18XlI+zxD2N8C0IUba5o7NWGBdhThVEtNw/GjumtZ/gxdMLTLe8Onh +2EY/lVpyecaTdo85L/03kdUrnty79+UHdTpL21opdn3OojPTkd7C6f3eI3NTlPvPtkRdr9ZU1SO nN7qNdCvDuDQ8RGmbZga6ablvF6O1DIV8tvz5BF5NTBtkRd7e1Ja3y4tY6m0zJULl3c+9dKl2MT0 bXM7d7BL653awl42YhR5yZwoz/P14u3k0Wn9Tj4vKZ9nCPsbYNrQb3/TFhRqNedZL0gwGa5gOpF6 66kaCfnxrHtLaH0kLa+19t5HVa61dGY+eX8/byQ+ehey08zOh7oBOSosqWOKzo3kyz3yawrPoL3C EfxW8UJF35wnj8irue9qjjDtpfXcmjIWS8tUuZAvNz81+lyaxmVGp/6wl4TXzovx8lyaf45O683y uVE+zxL2N8C0od82be7D1nkk6+G/2Rk6cf50xWmEa6FpS70Btyqotfc+qnL9dEdGTg9t2woWIsl0 6PxvTuY3e7EO8p7xXBKW2DFF54oPxkt+3wvzraqcbqP+vfYpkt+UJ4/Iq7HwjXXvQSudlnZmF5ax 1HVT5cL/1udDpm1xGkfy60nCvqTcpvKiOd05004endZb5HMrTs4U9jfAtKHfMG3xJf/llMN5hEuO fsnvylxBdr/1/z+NoqkRuuhv7k23eqtvXWvNvbfEGyE88FsyP82OG6mZ02xuMGLbNKSWV58aF5kH do7fkrBYx8R+98IXG2U+bOVPe+nv4ffGf4Ptyllty97/Qp7cK69mw35QepvPJMK5tIzl0jJfLsYR iKa5frzuXZbG/uIUZwx7LrwleVEv0pFqJ2tK67X5PBYnZwr7m2Da0O+MtNXX2er87+BuVX8ACwAA AADHgGlDmLaj8FaGrPzbGQAAAAA4DEwb+h7T9szQ/yjTAAAAAPBlYNoQpg0AAAAAoGIwbQjTBgAA AABQMZg2hGkDAAAAAKgYTBtiIRKAFHI/mXFvq/TCMalj5qWH08uxW/v6AVDeystb7He3PLjeh0ku Gy73a7KWmKdsAsABYNoQpg0ghrdhp94Q1djLJXWM60TGN/P199DSe2oBUN7KylvuXL2xr3m82NRX X4OyCQAHgGlDmDYAi8B0iQ5lj9Vxix3jRthMw9bf53mOvt54TrWbfALUW94y59qm7bWpcf/3tf3r blfvGDnCRtkEgAPAtCFMG4CF7vjdE5243DHjKFvzNGevffm8DuXY+bM6pUzFAsrb8vKWO1ebtun+ w1TI14hb//9P83aPjK5RNgFgZzBtCNMGYGF1/FabtqFD+uwMtm761Twi4K4RM23W6BwA5W1j09a1 f+1tnsI8f3/qFH4bR9kEgB3BtCFMG4CF7pSFU66MhUYix+hO4tiJ1J3CS7BAAh1DoLytK2+pc83p ka9RtdGsGYuaiFE3yiYAHACmDWHaACx0xy9YrEB14lLH+L+HncIepkcC5e0T5S08NzBtr+nLVvkc p02G5ZWyCQA7g2lDmDYAi9iqc3qqlFzEIHaM/7u98hwLkQDl7RPlzV7yX39bqn+fzjfNImUTAHYH 04YwbQAx9GIEe8Ky4kB5qxPKJgAcAKYNYdoAUliLFnwapl4B5a1OKJsAcBCYNvQ9pu2Zof9RpgEA AADgy8C0IUbajsQt/84qZAAAAAAQAdOGMG1Hcr+1w8fs7r8AAAAAAApMG/o90zZ+M9F5e2R9+hsF a5+f4feCkTa3qlnsGPlRvLch7PN+Hd9fAAAAAJwdTBv6LdMm9wKK7Ze1FW70bDJShmlzx3RNevno 2Mf5blnqybS1bdH+XwAAAABwGjBt6HdMm94H6JOmTe/jE90cdtpLaLlpG675NKDOlMlRNvb7AgAA APgaMG3oh0ybGGUb/j9j2nozJDdXdVMc28bfmHX4/TJPtRyOVxu7OtOmz/WeT20aq59dmzY3OidN 293dS02nZJlqAAAAgNOCaUO/Y9p64yKNTMq09SbJmZzxvM4bxZKjds5Qyevduy4caTPOLUWbNvl8 1vRHPbKnww4AAAAApwHThjBtlmlzi39MajrPCMkph3rxD/3v473sc0uRps27n1AwEnfDtAEAAAB8 AZg2xPRIadrcCJY1nTBq2sSol3/tz5g2jTnSpo5neiQAAADAacG0od9ciCQ2WiUXBJm+aXuNYrn/ 7/+eRuL6Ebjp+7X53+frj6Ywdm74fOHInzfqZ3wLN33TJp8jMKcsRAIAAABwUjBt6HdMW89gbIxV HN/h0Xb+ipS3rqpSzpL/AAAAAKcG04Z+y7T1pKYarkGOyF0un9v3bQ1MiwQAAAA4PZg29D2m7Zmh /1GmAQAAAODLwLQhTBsAAAAAQMVg2hCmDQAAAACgYjBtCNMGAAAAAFAxmDaEaQMAAAAAqBhMG8K0 AQAAAABUDKYNYdoAAAAAACoG04YwbQAAAAAAFYNpQ5g2AAAAAICKwbQhTBsAAAAAQMVg2hCmDQAA AACgYjBtCNMGAAAAAFAxmDaEaQMAAAAAqBhMG8K0AQAAAABUDKYNYdoAAAAAACoG04YwbQAAAAAA FYNpQ5g2AAAAAICKwbQhTBsAAAAAQMVg2hCmDQAAAACgYjBtCNMGAAAAAFAxmDaEaQMAAAAAqBhM G8K0AQAAAABUDKYNYdoAAAAAACoG04YwbQAAAAAAFYNpQ99j2v77779/qdzeNZe/y+WlpjtFCX3c u7/mcv1ru0cVz3O/XV9xuO8zzWl3bFw8uvbvWvgc/TM37SOIu+vtbqTz/a+97hu+krDEjon9Hssf 8+92+D+RR1P3KQ3X/P/NX3d/qLR66tr+3YcyOv7d3Zrd82dJeHPlR+bVhwuPkMzHtZa7M+bVNWmZ f27/91Ta15S/S9JYpo1Vt+rfaw77O+U2fM7HqdI6149I1UG5eNPtbm1hfxNMG/od0+YKfElDfL+1 U+GGueJrXnH3aJvdjG9/L6/CFo3UruEfKvWx0pd/x57Z6uz2v+v85xqUPTuIJWGJHRP9O5I/lsTb lnkmFp9Lw+U6Ajq/d7cxH7o6ZUzHY14qJMObKT86rz7azkufrmkOrQu/Pa8uSsvYc8d+L6w7j87f RWnc399Kp9jvJwj72nL7aNvQlJ0lrQv6Ebk6KBZvsXa3lrBvAKYNYdrCBqR/A9Ng2oLK9u690Tvi 7ftRHSmrgYnFwfCMz+PMN36qsXFv+/Z+o18Sltgx0d8j+UOOFg9/72C6c52hJeFyDXun6g7d2I/1 S1OdaUuVn1Relf9+aL3z5Xl1Ud6NPXdB3ZyqO4/O3yVprNvu/v/7Y2K/nyHsa8qtHCGKtcFVp/XC foRVB5kvPzN12Rnq8QIwbeh3TdvwRuXZKLeNP2XSva25qMZ7OO7ViFtTLWPXmyqU2DVe/z8P4esh e/XGf8F9P9K4qmkGu3ZoDuxElnQOxjQa46bItA1p3jzDtO+03ZKwrOkkxfLH3vkm1RlaE66xYe87 S/MbWNfYT1N5DjQ3izp/Xuc4nlfddY+eGvnteXVpWq597lTdeXT+LjJeffjUVMDJmBu/nyHsa8pt b9ru3fxs9nT7etN6aRmz6iAr3nJ12Rnq8QIwbeg3TZt+WyXfTN27bhpps95q+dNpxn9v2vj1YteQ UxmGZ3pVRA9RqYwmbZ7useS+n+5IHTFN8chpq6Udi6mjX2LahjR9plc7Nxp7dJI/1RGO5Y/enLa3 /aaBfsa0PSaTPXQObn7+l2V1b0o7f7L85PKq7Agdybfn1fVpadfB8d/jdefR+btstEx8g+S9VLV/ P0PY15RbP07s0eCa07okr+bqIKsdzdVlZ6jHC8C0oR8eaRMVnpwSqadH6oqxL9S6gRnNln096xry w2k3wmJ9XCyvs+a+H+tYHDCFtLSB++T9/Sk8iY/DhXTjkvr/2Ojd3mFJHVN0rleedP78/PcCy6ZH 5sMlG3Z33DytZp5KU/rN7BFlQx5TlFcrmBr5C3l1bT0Xq4Ot33PXPDp/l6STd/xrdsnd+u7N+Gaz 1rAvLbe55z9DWpfk4VwdtLQuqzHsK8G0IUzbUtM2Du37UxanUa4Fpi01SmN2KFbc92OVrfj4e6+O jJwO2rYVLESSfUNY8k2bHpHdp5NYEpbYMUXnysUBxFvNKkzbinCZb2Ov1rcQdZq2XPmJ5dWjp0b+ Ql5dmpa5Olj/XlJ3Hp2/l9StYzsYMe56lcXKw/5uubVnbtSd1iV5OFcHpeKtZKSt1nq8AEwb+h3T pr8Hc//fF85p5Msb8ZJTFC/Bh9L6jU7set7xiWvM87wLrlN43y3xRgd3nBoZjEoeOHVBf+84dzjC TkRsyf/ge0eR7nt2kkvCYh0T+z2VP2Jh/3h+8VaVWx6u2NLaw+/N/Ia2aa6H5c1ceEvKj9XRqWFq 5Lfn1bfSMjZzIzWjQ38HV1H+zqXx9O+R1U+T6Vhh2NeWW6+fIPLnWdI6lletdtSqg3Ll0/6msf56 vBBMG/qtkbaakcvcDpXJ7Rx7yQEAAADAR8G0IUxbLXgjgfXuEwIAAAAA+4JpQ99j2p4Z+h9lGgAA AAC+DEwbwrQBAAAAAFQMpg1h2gAAAAAAKgbThjBtAAAAAAAVg2lDLEQCUIq3qeewp1N60ZjYMXLZ Yrc88V4bawP8QhnLl714mdR7NMllxCmnAHAQmDaEaQMowdu4VG8Ga+zrEjvG28xXnZvaGBSAMlZY xhJlr3GGsPBebl8sWS4ppwBwAJg2hGkDyGF25NRG6cGGnpFj+jf18k2+fHM/bgJa7caeAKcoY9Hf u/u0sa68nreJc//3awPe4e/ndfS9KacAcACYNoRpA8ihO4Ep45U7ZrjWq1PYozuETL8Cyth7ZSz5 YuQ1cnZRI3fW710z/m0ZRsopAOwMpg1h2gByWJ3A1aZteEsf30hdnwdAGdvOtMnf5MuTfupkexu/ g+vP7U2cOydm2iinALAjmDaEaQPIoTto4fSrcKGEomP679tEx9G6FwBlbFkZKzpXTHH0p0TqlyoX c4ESyikA7AymDWHaAHLoTmCwcIEyXiXHjNOxws4k066AMvZeGSs6Vy4INKw06Y7vTZtfLpkeCQAV gGlDmDaAHNbqdfM3MHMHTy5oED3G/WZ2QlngAChj75ax2O9yWf+LMcI9/Zswjz0sRAIAFYBpQ5g2 gBL0AiKfgKXEgTL22TJGOQWAk4JpQ5g2gFLkxr9bw3QrgM+WMcopAJwYTBv6HtP2zND/KNMAAAAA 8GVg2hAjbUcyfp9xYRUyAAAAAIiBaUOYtiO539rhY3b3XwAAAAAABaYN/Z5pG7+Z6Ly9eD79jYK1 H9fwe8FI27yqWbgMdbiymthj6Hm/ju8vAAAAAM4Opg39lmmTewFZ+/FsiRs9m4yUYdrcMV1jLx/d m73mZei8Z3/+7czYYOrc/kRtG4SHlc4AAAAATg2mDf2OadP7AH3StOl9fKIbvE57CcVM2306J2a+ 5nDNo2zsKQQAAADwNWDa0A+ZNjFSNfx/xrRN0w/dKNZrimPb+BuwDr9fLv6mrWpjV2fa9Lne86lN Y73nThm7/rzn9frw3N291JRLlqkGAAAAOC2YNvQ7pq03LtLIpEybnn4ov4Hrf5ejdm5fIXm9e9eF I23GuUuQ0yD938NFTPTIng47AAAAAJwGTBvCtFmmbV78Yx4Zk0ZITjnUi3/ofx/vZZ+7BOu81Ea0 3Q3TBgAAAPAFYNoQ0yOlaXMjbNZ0wqhpE6Ny/rU3Nm39NEz5/HJhkue/tW3czDE9EgAAAOC0YNrQ by5E4o2OeZrN1Lyk/vh9mPv//u9pJK4fgZu+OZv/fb7+aApj54bP55tIb8RPTXcMnls+R2BOWYgE AAAA4KRg2tDvmLaewWAZ34W9w6Pt/BUpb11VpZwl/wEAAABODaYN/ZZp60l9B7YGOSJ3uXxu37c1 MC0SAAAA4PRg2tD3mLZnhv5HmQYAAACALwPThjBtAAAAAAAVg2lDmDYAAAAAgIrBtCFMGwAAAABA xWDaEKYNAAAAAKBiMG0I0wYAAAAAUDGYNoRpAwAAAACoGEwbwrQBAAAAAFQMpg1h2gAAAAAAKgbT hjBtAAAAAAAVg2lDmDYAAAAAgIrBtCFMGwAAAABAxWDaEKYNAAAAAKBiMG0I0wYAAAAAUDGYNoRp AwAAAACoGEwbwrQBAAAAAFQMpg1h2gAAAAAAKgbThjBtAAAAAAAVg2lDmDYAAAAAgIrBtCFMGwAA AABAxWDaEKYNAAAAAKBiMG0I0wYAAAAAUDGYNoRpAwAAAACoGEwbwrQBAAAAAFQMpg19j2n777// /sVy+uN+/2uvl7/LRanpIsd3f82l+evuD+/v2DFb8+jav+u1/bt/4Npb0DWXv6bd79nut+srza5/ bXdcnAzpknkOL6+JNLTCMOYhP0/uFa9FYYkcE/u9hjCWhGt+zsvf9XaPPv98rbmch+n7Ct/z7+7W 7J4/3TPLcIT1lB3/sXLVl+8aytsn82osjEfWNbm0DOuY+RnXhKem/F0S9ny9E9YtVlzVEPbStHZp K8OVTNNKw6vDc1lRR+fakjOE/U0wbeg3TNtcSFVnMmLaxkplLODy79gx21Ti7cskviqTSk3bo212 NxeNq7T7e0fS7OPPUWDkx2dszc6RFYZH23nX6JrPvARYE5bYMdG/KwjjW+FK5LOhrKt8193G8tl3 LvpOxdgxOMbk9M8bNW2R+I+nV+ObuoProY/k1UgYa6hrUmnp6pKr6uy/G55a8ncyHyfK7dXlXZU/ rLiqKey5tJ7STbS3qTStPbyl9Uu83MbbkjOEfQMwbeg3TVtfEbSphnE4thEmyuoo2L+v65j41xoq qgpNmzO6e460Pbr7FA97j/AFjafqyMff6qo3gAVhSL1EOCQskWOiv1cQxrI06jsBcz3QTB3c+PP3 DXv3atRjjf3YCWmqM22x+C9Or8s+LxL2zKuxMNZQ16SNy1i/JE3divDUkr/TLx/stLyr5+7/f0j7 grg6OuxZg260t7E0PUN4S+uXWB0drctOGPaVYNrQr5m2izfkPg23Pwu/fKO1xrRNQ/7iLWc/xbFt /KmY81C9OP5174uqqPS5R+PebO3doXlM8XNcBzLWOdB54u7Sz3gbngqDfANZQ1hix6TOPTqMJeFK PWfs97Fh90fqXWMv65CjKDZtKv6z6bXji4S982osjEfXNUnjMrQdzzRMtAtrwlNL/k6FPWrO+vCJ Tv38EikfV0eHPVduY+2tlaZnCO+S+mVJW3LGsK8E04Z+dKRNTjEQ0yv8t3Tlpk0P+V9vnTfioqfm jIZxfp5714Ujbca5RyLDeNRb6COna5UaAq9BMp41Foa9pkaWhuWdjvBRYSw2bc8y397i02n0808N +6tzMHSkbn74tp4uvbRsln0bYz9fLL3clO0j+XxebRfFyZFpOY42PdOwfXhtxLvhqSV/rzJtwffq rza+IK6ODnsurXPtrTcV9gThDZ8/Xr/k6mhvauQJw74STBv63W/aZOXwrmmTH826Nz3e1KvgempU LjE9cstpmKsbl8hCLiUdxe2f47iOsT89Jz/vXTcIsTDsPaJREpbYMUXnHhTGsmfTZSv//DId3T3m aTXzVBrdsdwzPfOLVyTealvpVWgEz5xX81MR969rch35lAldG55a8vey6ZGRtlyYmJIXOEeGPRbe 0vZWvziuPbzFaZ2po63R5DOF/Q0wbQjTpk3b+JZluWkzp91Yps2YIla7aQsqv6O+9xBptfu99cfR mbfw0QbZCMOeUyNLwxI7pujcg8JY/GwXWbbTdYJu7F3+dy9c/G8hKjZtifjX4fUWJunfeLcVLUSy UV7NhfGouqZ8MQ61sNYb4aklfy9aiETlg3E6nV61Nl3Ojw57+Qj5JTpjwFqEpdbwltYvuTo6mOZ9 orC/CaYN/YZp899cGW9t1BKy08jZs2KRf0v07/MytuMbMff//d/y2Hmutvy2zl+qNnZuLexp2rxR zKNXslPfHs75R7zZN7aTyIVhz6mRpWGJHRP7vZYwloTLe1bvhY01Ah6Gafi9md/QNs31sO+grLDo 8FrxH0uvYNZAJVOzP5ZXRRiPrmtK0lLWMeHWDcvCU1P+XhZ24zcrfEZc1RL20nI7lt1IWpvGtc7w muEW9ympo1NtyRnCvgGYNvQ7I221IJetHSqNW9UfvgIAAADAsWDaEKZtb+SIXC2b1wIAAABAtWDa 0PeYtmeG/keZBgAAAIAvA9OGMG0AAAAAABWDaUOYNgAAAACAisG0IUwbAAAAAEDFYNoQC5EAlCL3 1Rn3kkkvJhM7Ri5nLJdybloWpQHK2BZlLFf29D5M+ne9FYzcDoZyCgAHgGlDmDaAErwNQfVGrxdr 83X7mNiGqD1HbVoO8FVlLHNudON7aRjF1ixj2aScAsChYNoQpg0gh+74yc5lj9WJix3Tv6mXHUb5 5n7cBLTajT0BTlHGcueWmLbg2cT1KKcAcACYNoRpA8ihO4Ep45U7ZrjWtf27R97aM/0KKGPvlbHc uYtN2/N3696UUwDYEUwbwrQB5LA6gatN2/CWPr7Buj4PgDJ2rGmTUyMppwBwEJg2hGkDyKE7aOH0 q3ChhKJj+u/bxKibdS8AytiyMpY7d4lp01MjKacAcBCYNoRpA8ihO4HBQgfKeJUcM1zTWBWPaVdA GXuvjJWUvWLTZkyNpJwCwAFg2hCmDSBHbAU6Pb1xPE78v3WM+83shLLAAVDG3i1jqd/ldhv6Gzrr d2tqJOUUAA4A04YwbQAl6AVEPgFLiQNl7LNljHIKACcF04YwbQClxKZVbQHTrQA+W8YopwBwYjBt 6HtM2zND/6NMAwAAAMCXgWlDjLQdyfh9xoVVyAAAAAAgBqYNYdqO5H5rh4/Z3X8BAAAAABSYNvR7 pm38ZqLzNjj+9DcK1n5cw+8LRtrkx+/uvMvFD8NwH7FiGt9fAAAAAJweTBv6LdMm9wIal20O98na Cjd6Nt7HXuLdHWMtKx08tzCXj7bzjh/PV3sTvf5mpTMAAACAU4NpQ79j2vQ+QJ80bXofn+jmsNNe QnHTNpz7NJox8+X+XW9O645nTyEAAACAU4NpQz9k2pSpyZm23vTITZDdFMe28TdgnackiuPVxq7O tOlzvedTm8bOz5EeMevD1f/eT4WU0yzl1EimSQIAAACcFkwb+h3Tpk1NyrQ5IzSfN38DN45eiamI r32F5PXuXReOtBnn5pDPETNtztTlTBsrVAIAAACcEkwbwrRZpq0/Vi7y0Y+MySmOcsrh9M2aHJVL TI8sna7oXVfID8M4NXL4O5geOYcN0wYAAABwWjBtiOmR0rTJqYZ6VCtq2sRomH/t90ybxhppk/d+ 6IVIxDd0TI8EAAAAOC2YNvSbC5HERrHkgiDTN22v0S33//3f00icWwBEjYTN1x9NYezc8PnS39hp 46VXnXyob+nG67IQCQAAAMCJwbSh3zFtPYOpMVZxfAe5/P5gkG5dVaWcJf8BAAAATg2mDf2Waetx C4dshRyRu1w+t+/bGpgWCQAAAHB6MG3oe0zbM0P/o0wDAAAAwJeBaUOYNgAAAACAisG0IUwbAAAA AEDFYNoQpg0AAAAAoGIwbQjTBgAAAABQMZg2hGkDAAAAAKgYTBvCtAEAAAAAVAymDWHaAAAAAAAq BtOGMG0AAAAAABWDaUOYNgAAAACAisG0IUwbAAAAAEDFYNoQpg0AAAAAoGIwbQjTBgAAAABQMZg2 hGkDAAAAAKgYTBvCtAEAAAAAVAymDWHaAAAAAAAqBtOGMG0AAAAAABWDaUOYNgAAAACAisG0IUwb AAAAAEDFYNoQpg0AAAAAoGIwbQjTBgAAAABQMZg2hGkDAAAAAKgYTBv6HtP25A8hhBBCCKE91fO4 3//aW4dpQyhn2v77779/S0vA4979NZfmr7s/eIcDSbpb+3d/5pOuIb+chXvbPdPso40oAADAQNc8 DVyDaUPoI6at5/7sjOtO+FDwLmPhe3TtX9t+vpP+aJtPFvY5TNfRfNTGaKCvf233qPJ64zV9A3C/ XYc4bdr94nPXfPLM+9c38ksNL0X68Fxv9zB8r3Qb4vMyl3cvni9hA/w4cZz0YZJxsRV9OciVgT7e h/j+QLn8VHn/9L15aTjni63KV21skS/Ha4x1cndrntd6tkNXY7TnoHjTafjuOWuutzSeP9I/eNav Tfu8LqYNof1Mm+zYjB23zzeqU6X8ocL+qc7aFlimudb73IcG86HSbb9O1575ZDCo1/c6AqNBysfP p/JAH4Z754+OunDJTsFgvo04DTqUJ46TPcx+rKPlDPCeLzf2qlfejbM17YsVttrCW/I8Ol+sKV9n SOd3n7evn/p6eTC0L6MxxtVsOqSxW1I3vRt/a8p26pxP1hWfzCtT3hUvBD8Apg0xPbKv6KSh+XTn JlmRfei+JW/Cj2Cs6PYwxe/fZx6hEQbggLfCe+aToXy8NaqUj/dP5gGXZl75Noy2ZThihvyMcbLH y4XcM+9ZB+1VrxzxnNY5tYV3yfO8U+ecJZ3ffV5n2sa/G9O0zeW83DBsFX9rynbqnE/UFfv1NRhp Q+ijI20WQ2cv03C4Dnsrp1KKkRD5xsgd272m0/X/7qbWufuMnfFmPF90sPS0RteotcYzyqlfrmM/ 3UdP/xre2l2Ge3Zt5F7uGG/6RXj/ovPkNLRX+OapaX3jM3csrbj1ntmYDqLDIzuq/n0yYRXxUdqY xqbSnT2feNeQv1tpqcM53NNvKK37+teaTZb35jK47mP1dF/rflMYxD2bm23Izxgn2ujHypFZJoyw WvnN7oCHb59luewiZaIoPxeV91j82Z238J5+fmjbSLktCJOZP2J5QUxNjuczMcqifrPyVDycIo1E fePyf2ukc5f6rQ9b7HmMeNWjErHyZaZP9j5+nmlz9V4qv+TKjPic4q18OZyvTXk4w8IybS6OYrNq gmdT8VdUh01tg1G2zTwu0+DZbkXT3c4TXayO0+UrGs92H0C/yDLr4UT9V9TW6Dyjyi2mDWHaNmSo zCMdQq8x1xVzX1BFg9C087FjBT2P7smKV07FdNO1xjnSD2EQOu++QWdUVajyXH28+83dI7zXfZou Nz/nPbh/2XkPs7G5d93UaZmnCiXiNnFdHR459UjeJ/bM+vyyN3fPZ7g1c6dMf/908nwi39xaozXz c70aT9XYjs8hGk3jvjJtHqrDIhtf77rXa5B+S8q1N/I2jZaOz+T+Ldb5OWOcBGE2ylEuD+lyaN3L uq80Ybpc6nLspi+V5OfS8h7GX2t2mmJ1gswP04sVr9yWhcmq/6Rp0/ePGV1dlw3Hd/k8lQrn1Gl9 njdOJY7l3XtRPF2aNhoud7zOF7nyZV5HhTuZf2NlbVisaDYX90h+iZUZfU1XDrfKl6HZtvNZiWnT ZcbKS34ejbdf6TS0z0+dY/2b2beIlC9rqnGsrxHEpZk34mEvN2334SV3+3zujRYww7QhTJvfcLem EbA77fM0Dq/xNRr16LGxBuD1d/AW0L1RMsykrqx1Zyqc/uUqpVelZt7Lf7PvNW73h/2mMnKe/+bJ 6LR4f6fiKzKaoMITu3b+mcvehFkjA+Yc/RPnk9jzmGmppoqOnRzflFv3Da77CpObZmJdN3gzXvgG NGb2dccz9ZH6GeMkMG1GOcrlIflM1rHWfWSZmPN4PGytyIe5/LykvOv4i76kU/fsGn9kPmbaSsKU q//C+zeJuiA+PTJVvmPh9EyBGmXw8+49Ek9Wpz2eV6x8kStf8To79e/ztVLxUpJfrDJjX7PbNF+O 122ESbkmXoimp0emykw8j9rpEUvD1PmpdLf+LZZXrfKVrYv1vxeUmVRdv6xP+Ty32eQzCkwbwrTF OrSxN1lLO+Pj25xlnXE9+hO7r185NMF0ufRIW+u9ZTLvZYw6Waat5Dw5cuk6Q4tNW2IUTIcnZ9py 8ZGvjBvfyEbewp05nyQ7UDotVSdvvK6fdtZ9rcZwfAsav64cVVrUgCa+Z/OfJz6F7oxxEkyPjJTP VB7SYbXupX+Xb8/HPO7evuvO0/O8pk2Wz7DeKS/vOv5ipk3fU7YHMdM2zw7IhylV/5WWvZxpS5Xv eNyKkSf3nGbefURnbYRT9+J5xc4Xj8V5Lv/v4lrJsibMeduZ+cVsC41rDtPbN8yX2mDGTFvJQiSp MhPPo4n6TqVh06TPT6V77Hr2i9CwfGXr4oRpi+eN90ybHL1ttlkIDtOGMG1eRXDzRy38VST9ilUu cnAX3yA9xNQSN7QePVZ8C+XNf7bm8b/O75qCbxWCZw+nyvXfmF1j88cvF/9brcz9S84Lvx2QUyFf Fb54E5uMr0u4wIQOj58m4SiafmZ9fm5JYO9NrUhHa7ThrPkk9jxmWur5+/I4/Z3S5RKuUqk7brHv GCPXyqWXXtrfj//mWfav8zcHt0bl5TDfnCFOYmY1Vo5ieUiH1Y5/y0z4edy6jnsePaUrl5+Xlncv /oz63AyTiue5XvB/KwmTlT/aRJzG4swOm/9bLB/Y4ey8lxTWM2Tre/U9kh5tssuq/YzL81z8PjrP 5J47+J7X2gIkU2beyZexvNmPtE3to/qEIJZG5nWCNi4z2+bS37es/Yq18U1zSZ6TqiuSdVqsfMXq 4lhYE3Vnuu2+Fk1n9a8133vlat6YNoRpKzZ1O+3XVhOPtvPfTBVuUrz2vKOuu1l8/fC+S1uupCmn A9Wwb9Pasl9TnHgjwx8oR2v2VtqTYLuOhWlae/hqLs9nJMgvH2p79H3eqW+sNPy1Pkv15eq9PgKm DWHaaMDi+G9dy1c9WnveUdeFdxsifxGVd9M3HHG6HLbP4NqyX2OcuLfTW5ejWrcUseJvTZrOoyy/ 8UKmhnJXU36Rv29VZmL32aqv8eum+0vBtKHvMW3PDP2PMg0AAAAAXwamDWHaAAAAAAAqBtOGmB4J AABwFNYeUwAACkwbwrQBAAAcAYtFAEAhmDaEaXuHrVYLjC0hu3TFMm9/kQ8s1LH1dX/hY+nSfd/W Mn0gv8XH6xvkZyuPbJmPdXi3DH+1eWhFuft0voON0nbYeDfcDH3JBvJyaXvLBMpyXZKXYns8bl1v 7dVWxcJfUkY+9XyfrguWPPe4QFEnthHQWwDE24Qwbpe3H+4+elEWWQ7kXqL6N71dwOVyzEqvO+QV TBvCtL3b8Kyd1uI2ukxVpEsqn6XHb0EuDKlzphXKvr6zfflY59na36q2/LxlPtbh3Tr8ZyFbdyzM d2vK8RF1x6+kaXeb68Tciy1ZBvQmwWvK9R718t5tlRX+T9fNW5aDJWVlabmSxlVv2G1tR5CK23fa j6BuF5vYT2bQ+k1tYTI+035TjXeuxzBtCNP2VuNjbCi75XlLl9Lec+ntNWHX5+zxRvdoPjnisXV6 fyo/b5WP9e81LzV/dLkrzXdr0/yIfPaNxJZ+H+MpP3JRNlq0LL73qJdraKuOHo0uSZclabcqnS+N v//cddkG0PKe75Rra7Ps4P+v4W+NNaq8U5oeUI9h2tBvmzb3FrOV00vEGzj9RnDeq8WupKypWt7+ Lu4t0bTvjzV94y6mKRj3Vo2pdby8XhcJm3VN11gP8dH/1sfPcPzzWuq6cxhm9RXq/DyRRlKHW8V/ Mqyv9OrcFInn8dN0CSvOp82E5bO+3tgZ912TL7LPNHQMmtf0jXheCeL+bkwJFM/qTaFy+aqK/Ozy yLb5WIfXCn9JnAbHRPKCjpvg+qpsRPNOKl9G0vxRVO7mN+JWnD5K812QduO/dWLK0hDXiemopXEa 1gPzedn7xcqpSoMwjud81dz6qYMF5aEgHNn84c438kgpXTOnsXvWoY518Sfzamo0zutYi7wUCZ80 bf7+ZKq+cOG7lE1ZzpXxLdMzbFON8BtlJCyT7viV9b9uv2S51u2hbqeM8p6KL7sefkTzqzatzrQ1 Tdyw2emh43merpjrE8RM2/Bsqo5pGuO3NuxjpF4GrM5PC9PGbCcz9SKmDWHasm9JEo2H6Bz3/y7f /PQFcq6M5gIs511Pjas39WC8173rjM6x6JyKxthVGPra8m2TPl5eL5zy0Eaet/PiQ4bdHes9pwjD 2HjIxqA1p1XocDtD4cV/JKx6w1d37pwOc8MXi6tcp2F5vih4plsTpG1J3HuNl5GH9JvGWvKzyyPt xvnYerPqhb8gTnPHuDhrrbhR58rG3Pq2QhoB6/xUmpeWOztM4VS5eL67m9ebwz7nn7aN54mSOJWd Na/uyNwvlveteDLDp9Jy6mir8rAkHPeC/OHura9dSqzuGjqurkOpv4OLGDdZrue8lKgvpGm7WcZr rmuX1L+5Mr5leoZtYDiFLywjbVAmvePX1P9dPL/qsmfFca6vELuePk7n11Qe60e0rA3EzfIfGWkr 7RNETZtqq8fnsX7TU4HTxnBtflqUNma9dc/Wi5g2hGnLGre5cQoqHKMRCIfi53OCj8ef58sKMlbR WY2q7pRb15ZvjgKTpa//qkT68LaiwtbX1NNi5orTvUmKT4WQ94hNT0hNj3T/1ibCGk0vNa3DOn9+ K/x6C2lcZ02+yD7TrfFHpPQoUSTuZfrGpo2EDcrx+dn93XwgH6dMW0mc5o6xnt3rcHrntl7Z8N6m qxGvafSoMM2XlLtofm9L812sLuqGDnvTP3vbDc9onV8ap13Q8Q/fzuv7pfK+FU92nvVHJGOdsiXh 6IryRxc8X3G7ZEzbs2ZJNE1rmoJUvRuMOpl1V/jyIaxD1ayQ13XeKeNbpmc8zP6LKV1G7Dbwjfq/ exSV63Qc232F0noithCUXZ7kqJ962ZKpP9b0CWKmzfs347tO87fMfd7JT0vSpom2k+l6EdOGMG0b mTY9chDr5JqjJGqKgmmqdGfZu/c4XSH2ptY6fnwjFc5V7xv5WAdYx8d4TOs1brn56+ObpngHpdS0 xcJaatrMDtU0dWc703Zx02YKTZt+A5+K+1weese0fTI/e+Z743ycM235/Jw+xnr2WIdYl41YZ8LF 0ZI0X1Luoh31tjTfhfl//H6knUZjYi8JlsRpzLSl7pfK+1Y8Wc8ijV+sU+bKQ2k47gX5I5VHkm2S Nv3daGTldDH3ll52Di2T8JZpm6YGCgPl1aH2CGLqW7VcGd8yPbuFps3qWOdMW1H93z2KyrXdTuX6 CmX1hJVfrZcD4ayca3KmQypvlfYJcqZtrAOU+TV+c7+nRrTfrR+K0ybaTmLaEHrLtMmPwO9iTrpe QnbumPrfb8lz5PXkh+XWb9E3isa9U9eZOhaX9HPFKkV9zU7Nte6/x7qKOPCfM3yLLN90mZWtOicW /7GwRtPL+sbDig/jGzwrrpbki+wz9R9PX1LfxNhxn0qnOX7t78WOzM+9Mbu8vrPYMh/r8KbCn4rT 2DH+/dogbvS5Ml3t0Yj1ab603JlpIp8j8QyxcjyPyLdGJyydprF8GKsHlt4vFk9m+FR6zFOTLsX5 JyxP92z+GM5Rz5dbEjycEubngbDsN17dFpv2dre+txL1bKz+TdWd0zSwDcv4lukZC7OXjkYZCdrA d+t/OYU1yA+ZkUVvGmvYV0hdb66H4/k1/i298Y2d8Y1jkH5mWU/3Cbw4tr6T1t/pJrZ3kVMjY/d6 Oz8Vpk2qnozVi5g2hGmDXdFLBLNxLPwav7D34FlZul/gKfPfRnuHFt1LLLU+dPpv+67E+Avp+fk0 bD66vcORfYKl9zpBfsK0IUwbvI+1bDWdV/g19GI5UFHaiNEpthrYBn9lyX03oCY9t43Lreuro/sE S+91kvyEaUPfY9qeGfof1S8AAAAAfBmYNoRpAwAAAACoGEwbYnrkO+z5/QAAwK9gbSIOX5rWYn8z APJSFEwbwrStrhzU5pEAALANXetWsO34LvbLcSuG6pVDAZbiVpDUC6B8CZg2hGmbl3L19yfJrSI0 rjTkj7TNH2b7S9pby7rGl1IWS9GykMfEkr2O1lX2l+Rywoue9c0R2NjS4EtXt/L2h1HX0+HdMvxb p3t66XH7raq3UWxmqfW1uGcKlqIXz2pt/n01Nrg/atWyLeNGb4Ydq2NL6leXhl17D+uBRD5N5pNn h27rOvUTizi8kz6lbdceZV22f6mV/OToiF6e/tPlYot2NhWfn4rrreu0kjbrU6srblsHCdPWuuX8 9V5qdprE6i8zzyy47oZg2tBvmza3cenUGVD7GaUqKFc5PJ4Vw7y/keooJkyG26DRNbRyf6Xm1o0V AKbNa9Q/Zdq27niNDfVy05Z60+w6q6WNZup4Hd5PdzzfSZd5/6RUebkf+ozBCmlur6GpIyT3Q3r9 bR63T1n/xIjGsNeaYYpidWxJB/DRdc94UnvgqQ1uw7IXzydLOlQlcfTpF0lrnysVt3uVdXkfvUl6 LExTm5rYKHzLOJw62m+0s6n43DquPzkSmWuzlrY/RzH1FUSaDmFT5bS7qXoqUn9l4yxz3Y3TEdOG ft203b2C7W2Sm9mx3tz80e14v3DqpN4M1bsWpm2O7w91kErf/Jc3HOm8s/acpc8ZO17/vnX4t2t8 7fiwysuR+VJvZKz/fxyRFy9znuW6M4/bYSnsFXmzLB76l1dhZztWxxbldzU1Um6eGzNtqXxSWqeW PNsR3zOXpl3quN3y2YL6Wi+3/knTpuPm3XY2FZ9bxvWnyu2S69fYTljPqL+D7Y2Urm8D0xapv1KU XHfjdMS0IaZHpvbnWFpJDR24Z6Ff+uYuZdpaY4plbMrFHJY5PN4UFTFipa/h3a//TV9rmhJQNq3O vRVvI/eXb+7csZ2b2vT892mak3u+oRPQjOdbU1Jj4bgbUwJFfHrTqdzIx4Jn968rOx3xZ7SexV94 QY7M2NOFovFuHC87mDq8VvhL4tQ7xoivMM4j8eHyVd8hbx9Fnb6gM27ke9l4y/Bn85pxrWyZ18+i 0nlIA90xjRxndg6C9JjTuLn1084i5coIi17gQ5uPIF8m0lZ3YO6veA/qskgdu6R+fej6pyBtYqZN hyWIXxlHNzs/6PwZxJNV1gvqqIcqD17eNRZnidUDVtzqsp4s10Z9mKqfo/l2hSHKmbYgPiN59GG1 WVb+L8nfhW2HHddNst0rqTeXlttYOxarL2NmItv+LMwn9r3D+jmalqqdKDVXd5WntLlK1V9rr2vG 0XsLLGHaEKbNq2SNhm/JG/2xkC4vjFHTZnS6+0Ivv5PJf8/jVyrD0HxwjW7uBLYP+1q3Rnxz8Lp2 5Fm8TmVrVMqi0Wtaf0Pi8PuG+V5eh/zVABaHQ3Sy3PPJc/0RgNJn9yt5NydeNoBWHFnPMj67NNp+ WLUBiOUB63g99SU10lYSp/qYlEEM4sY4V4cpV/aW5vs5/GV5raTjGDVtqpMzdbL6b3puY8fD+nYn Vm9Yaa3jdeoAqrxpxcu964wXCqJjqPJlLG11XdWKaYjX1Pdm4t+W1K/edLvC75BM06bDYsWviiMr P/j13cs0q06tld9TdZRMO3eeVxeo58rVA7HvC8fw381yHdaR5WWmtF19x7Tl4lO3lfo5gziMtLNr 2o5YXE95NtLuldSbS8tt6vrx+tJ+cW21P+/mk1z9bMWJ1U6Um6uHt3icNFel9deS68byjFW3YNoQ pm0FVqW1qFMxVULLp83kpkfKZws+tFdv+Oa3i6ID+qpAXOVkXcOaJuJfK/zQNvUssee3OpfRY7Vp k2+r9ChRIhyy8bPiPOzklj+7NUKSSy/7WToV7tnA6Q5CKt6t43XeTpm2kjgNj2nM+LLiJjy3feUr v1Ffatp0vo91SIrymlGGSk1b8EzDvfQ99RTCjNEJ8o8/0pIybXa86A/o5/QK82VrxlfQqb0UGFAj H5bWrzqPlpyXmh7pnqU187uKIyM/BNdWaRhdQCdRR/lm2cq7YfzF6oGcadPxkaojS8qMnx/aoCwv mrGSMG25+AyfzxqltqdHxvL3kraj3LTF66Jcm1JWbu/JsOXqhVR78m4+Sd07n5bLX4p7Bu3Vdwh+ K6i/llw3HkdMj0SYtm1Mm6hU1zQ2stFeOk9+qWlLNRIX40N9V2k2TRu9htkxl9e6NWYHvEmtCFZg fC5uoYYFpk2OOOTC4Xcs/TeVsbelS569FW8iY6bNHPULnsXunMk3nW7KX9Nk8oA6fjTc5aatJG+U xNfdiJvw3m3wtlg2giXlxcr3a01bH7eXzGIXJaZtTGNpAiMdGHFcruNndSJjpm3Km2a82J0/O18W dGpvZTMUdB27pH6dOroLvhcuNW3Zly5WnRqZHqmnuy6po6zykDNtS7+nSpm2WB251LTJ/Lnm+zTz xcZrhCUXn7FZDnHz0xW+lChrO0pNW6rdu2falLJy+0jXy5l6Idme3Nbnk9y9489stxNLTZt7Xm/6 8m3dDKvUdeNpgmlDmLbVps17a2d+GyTnXMcbHvmmZpr+FnyvZLyR1FOkjO8gvLe1+huMS/g25xL5 7kN3LvU19PYEqaWz5X1jzxJ7fjmVyE2DiB7r4tF9W3NJzf23w6E7E/pZZVrp+folz67TsDS99G/y TeJgHCL3zMW7dbwZp8Z3T9b3CrE49ebrx+5lxE1w7rMxvxrLe8en84Tlxc73qqOgvuVMxUtwrUj5 Nb+HjCxJH3xPFDnOqiuCvKK+1ZmnEvm/xePFX34/lVdT9dBDTTcN0kh+3xIs2lRev06dXmsGwYJ6 NRaWorKY+A7Hf7736qj+m6urlYZeeTK+aQvSID0iKuvd1LMm60NRP3txf+vMLS6K0jmYNpz4JjaT R3WZ1mkrt+Wx8veatiMW14vaPaPefCwst6l0s+qFNhL2Je1PST7J3Tv6zKpcLM5Luu5p3Pdo6frr btQx+evmyibftCFM2+aba2+9J0lqn5oz8Gg7/y3frTttWOAsea5ZvRz31qut7Vl+l9zrU3snfZqt nvvIelXmz5r21Txrntg+fWizYIN8VE/fDdOGMG0Wmy8B/wUbZfsjK5/bQwfAKzsL9zqSb4a32hZg z/K75F6plW9rZqv6tYZ6dcyfXfDG/uxx+w3QZsHb5buuvhumDX2PaXtm6H9UMQAAAADwZWDaEKYN AAAAAKBiMG0I0wYAAAAAUDGYNoRpAwAAAACoGEwbwrQBAAAAAFQMpg19j2l7d/VIvYP9GuTePSX7 iATnGxtHWvtVrb3W0ayJE+/8L1iFc4u0/fXnjeWDd/LXUefCZ+P4W9Lm0+GY95nTGzjL/aheK7MO ++818X1Li661tpz5998yX0yrTQ57R+6XZ+QKudb+qGtXA7X2Niw9Zml6ldzLhU3vLctqp8Vg2hCm zVXgbdO8bQjGSn9dp3ZqkJTRWnPN2LXOyP3WvkzwqxH5ItP2Tn751efdKx+4fPctfFt44INlXLdB t3kT+3lz97ypSV1rTV5dev9F9crCrUW2KnvWy1W5z94YVm1+82EPXyAbm60njnm0bXH8ltwrFc/s K1gMpg1h2uYKqqwyTFde723oa4+0rbtmjSNt78bn0CB81UjbthtA/8rzfjofnC1dfi088Dl6U9W9 zJH8TZq2nntipK3kWmvy6tL7L+FTIz6p8FgGx2zzzGMyI2iq/beMUewYOcpWEicl95LHatNG/VQM pg1h2mKN0lCZvKZhtY0/TSD6u6h8dGU7b/T5+vdpY1z1W9O8NgduxAiTcR35LNZbNONa1vllzzaP 3Ll/Gyp3NyXieZ+ujV/faqSCODQM5vwc13kqTOSc1H3DfxdTP57XcNM2Gh0GcY+S51167py2/obQ c6MZpuvSZ0umRyQfR+9T8ryva3Zumo+I3/z1Rfr2x0bLmZ0PcmUuCLvIu17eVPlucb5WZSJbn+hw P3+zy3m6rEXzmREes0OVukesjJbkvdJzXTisulG/zZ/i6zo+s8hzfZ4c8tw0pS+eNsX1hpmvwjKY yveLw+vlicJwrKizwrbQf4Hp2selMzhS14o+cyKvWvc3y95FxG+07p3P86Yk9m3cmrZ7RdkzX9Kq qd/Ds0XiO9VO6L6MZUpjx/TXvXdzeudGIEvulTJtuXMA04YwbV6l374qEVlhPkTHVHbmr89Gx/79 7hksOZVMVmr62zk53WGs4EVDMjQgwgg+/93dU1eUtuFR1zLOL362Pm5ejYerYKdK/nXd3PPNceK/ yYtNqbh3nfHWMTwnd9/Yv7vpO10jp4U0yqT09yt73qXnemmrp8EY01MWXz8RL/H8fY/cp+R552cZ y8Pc6Af5vCgcsXJm54PSMud1UF5x5J2r811xvg7LRD6+u+CtdqycpstaF80HOjypzpe+h5UPwk6j nffS58bT16p/YnWH7gi6stznz7Z9JNMml65WHsrl3Xi+XxLeMIy5cKyts2yj5ZdvPTpWOk06da1Y /ijJq/L+8m+XD2LxGKsrtGlY3nbfV5W9WFvlfdOWMchTGVTHvWPaAqOcmdWwlWn71PRUTBtC32Ta dCUp3ojpt15ToxD73Rtp8w2cVYnpj3e9huz1t7xO8JFyokK3rmWdX/xshmnT0zRyzxeMRBojlLHj dQOyJF5S/66/u9AN8/QdRcHzLj03CN+U5s/jjbRdev1sekTycfw++edNh3XugOfCkSx/BfGZ+05C 591UuizL1/GpSyXhid2vpKyV5rPSOImlU6xTp+M/e24kPsz6J1J3+PHfDaag6U1u20Xioby+svLQ ujIu6tDi8MbC+ChOp5I6K2a0ZPmeZ6LMUxJLOtmpa5XWMX49Ht7fjpdwFDtXJqTRWNV2ryh7sRdA RVMSM1MkwymL+ZE+6xidjrm+Ruo6mDZMG0JvmzZdIcnKQzey05zv2O+Rytqa4jBP33lMlZys/KxG ackUAutasbdtRc+mTFv/JrJ1i4QIU5jvKH/GtKXua79BFG93RXjlCKWftgXPu/Bc6zrjW95EQ7zg +tn0iOXj6H3yz1vUeS0IR/L5CuIzNa1ozBN+3i3t0OXytb5uUXwbpi0sp/my9q5pC+Ikkk5F9yw5 NxIfZv2TMG1THddPT3yV66kOT6RNSb0RpOGqMm6btnR446atNJ3eNW1T+b5a37QtM236WkvqGKtt Nk2bGt1eUiZipq24fVxR9nQdUbLISMn3bFO4L/HyUnxMwQItJdfJXY/pkUVg2tDvmjb5Vs5v4NV8 +EvkWwHj97v1PYP3lvzif3PhjfC9vgdKXHPuJIupOEPjF3mrf0l/Z+J/j5R5NjGdyU0DufcV8OUS /R7Mmm4kR/iC+5kjGP4b5dg5qfuG/9553wLo71qsa5U8b+w5Yuda14mNsq25fi5eYvk4dl7J88ae ZRrRTjxX15SVs5L4tPK1lxdV3rXPNb5py+Rrq0zk4rtr8vFfUtaica9HFSN1xtLy/E7eK6pHRf3T GnWHzoftlE/bcJQ0kjbJ8hHJQ0vKoMz3S8LbNIm2pTAc8fwQLncfW+J9+L2ZR9qa5mp837X8WrFn TpkS6/5mXBeUidh58bog3T42hWUvanYi7fU7WN/T6bQ3j5HxKMtYpN4ovZf+dtDPL+u3SsK0IfRj C5FEK73YflCV7Rfmvt+A87P1qmhr8nctz/t1+/JVFJ4a6oxvS99fDW8t7c+j7fyl8W/1r548mJ0T 5YlPpDVL/heDaUPfY9qeGfofZRoAAAAAvgxMG8K0AQAAAABUDKYNYdoAAAAAACoG04YwbQAAAAAA FYNpQ5g2AAAAAICKwbQhTBsAAAAAQMVg2hCmDQAAAACgYjBt6KtM2/996v8jhBBCCCH0Rfo/dPrR 15g2hBBCCCGEEEKYNoQQQgghhBBCmDaEEEIIIYQQwrQhhBBCCCGEEMK0IYQQQgghhBCmDSGEEEII IYQQpg0hhBBCCCGEEKYNIYQQQgghhDBtCCGEEEIIIYQwbQghhBBCCCGEaUMIIYQQQgghhGlDCCGE EEIIIYRpQwghhBBCCCFMG0IIIYQQQgghTBtCCCGEEEIIYdoQQgghhBBCCGHaEEIIIYQQQghh2hBC CCGEEEII04YQQgghhBBCCNOGEEIIIYQQQpg2hBBCCCGEEEKYNoQQQgghhBBCmDaEEEIIIYQQwrQh hBBCCCGEEMK0IYQQQgghhBCmDSGEEEIIIYQQpg0hhBBCCCGEEKYNIYQQQgghhDBtCCGEEEIIIYQw bQghhBBCCCGEaSMSEEIIIYQQQgjThhBCCCGEEEII04YQQgghhBBCmDaEEEIIIYQQQpg2hBBCCCGE EMK0EQkIIYQQQgghhGlDCCGEEEIIIYRpQwghhBBCCCFMG0IIIYQQQgghTBtCCCGEEEIIYdqIBIQQ QgghhBDCtCGEEEIIIYQQwrQhhBBCCCGEEKYNIYQQQgghhBCmDSGEEEIIIYQQkYAQQgghhBBCmDaE EEIIIYQQQpg2hBBCCCGEEMK0IYQQQgghhBDCtCGEEEIIIYQQwrQhhBBCCCGEEKYNIYQQQgghhBCm DSGEEEIIIYQwbQghhBBCCCGEMG0IIYQQQgghhDBtCCGEEEIIIYRpQwghhBBCCCGEaUMIIYQQQggh TBtCCCGEEEIIIUwbQgghhBBCCCFMG0IIIYQQQghh2hBCCCGEEEIIYdoQQgghhBBCCNOGEEIIIYQQ QgjThhBCCCGEEEII04YQQgghhBBCmDaEEEIIIYQQQpg2hBBCCCGEEMK0IYQQQgghhBDCtCGEEEII IYQQwrQhhBBCCCGEEKYNIYQQQgghhBCmDSGEEEIIIYQwbQghhBBCCCGEMG0IIYQQQgghhDBtCCGE EEIIIYRpQwghhBBCCCGEaUMIIYQQQgghTBtCCCGEEEIIIUwbQgghhBBCCCFMG0IIIYQQQghh2hBC CCGEEEIIYdoQQgghhBBCCNOGEEIIIYQQQgjThhBCCCGEEEII04YQQgghhBBCmDaEEEIIIYQQQpg2 hBBCCCGEEMK0IYQQQgghhBDCtCGEEEIIIYQQwrQhhBBCCCGE0Bn0v0pXHWxnw1gbAAAAAElFTkSu QmCC ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/image006.png Content-Transfer-Encoding: base64 Content-Type: image/png iVBORw0KGgoAAAANSUhEUgAAAaMAAAEtCAYAAAClLw9cAAAAAXNSR0ICQMB9xQAAAAlwSFlzAAAS dAAAEnQB3mYfeAAAABl0RVh0U29mdHdhcmUATWljcm9zb2Z0IE9mZmljZX/tNXEAABp+SURBVHja 7d2Njqo8G4VhE8mEYDzndx/Zd2h+oiJtKT/qOAW97mRlz1YstJSutkCf3b9//3ZEREQlpRCIiGg9 ZnQ6nf4jIqJpMY73mxEAYAbGwYwAoDiMgxkBQHEYBzMCgOIwDmYEAMVhHMwIAIrDOJgRABSHcTAj ACgO41iZGR1+9qfdbpdVVR+zvzkeDqd6f91m/3MYSa86NYfjyxXmWFf340n3tej3h+ZUZX4ffr7b 16fDA8d6/e3+VDev5W8snWv5vp7+bx/Xu8ujVPp49fyUra/PwjhWZ0bVpRLdG+dbw9yawJgZXSpg U5/2IwbRVL9jRhcjqprA/J5PszPJME+XdH+ah9O65u+5i68r73el/1csyQe+gy3U1xyMY6XTdKkZ zW7/B2Y0OLaqeTqNw099Np59dFzPmtErPcGmmv/dFnqaS/KB78DIiP7EjMIpuXCq625G+/1gqis1 o27b3ROGEk2nvWhG7fFcju2WTmdG/T6qfpugp5dOPaYX33X7uAzC6c97mQVTju0ILZ1+Cr8P959L f75x6MssHlkG5XnPT/tZdTPrdr/9cR1z28/kI5v32z6a7rcPTI2G6b+WTl8u1fm8N00mb/e62pVV fl/L8zizj/bv83bNT3AdLdjfVJ0d5vP4+LWW1I1cGYzV1/l9vFqmv2N6jGNrZnSrBG2jE5rM/YJq G7tklBRtd0u3b7R2k9N/cxfJo79NzahL63pB9yOje6VPzKabKuzydf9d8H2Y78v3twbmEJRTe9yH c+M3NLFbOpftwrIdT395mQUdgrq+pNde8HEehvf/wuMabr8gH4O8p+b42D2gPv3X0onLMiz3uF5d pyDH9/VoHpfsIzKYewdian/HyTqb5nPZNTJeN/J5GtbXxzpJz5cpM/riabrB6CAwoHQaLTKjqPf0 woMIE9OCj5hRn9btYpsxozYvqQFGDXP6AMi5DLqLOmxM0wY9l07fG5xOfymheTU/QY827DknjVq6 //z2y/IR5z1fvstHNMnI6Jl0ug5UUscvZdw1hG361XSdeCaPj+6jK/NLJ+bB/Y3l8+HR44ThjdXX RzpJ7643zOjjpun6kURuZLTUjJ41kfQieXVkFDdA1WUa41UzSr+/pB2YRm508YgZPZvne+/1/G9d h1Mrfa93zozy20/nI5/38maUdqy6co0b/irI13jD+WgeH91HakbPlGnuoZ3Jcp6pG+82o0fymJvS Y0ZfM00XP9EWmVEyDZGbplv6lN6ghxYO3YM0Hp2yS83ofpzZHmowH9/uK+nRjk3j3b8Pp9kGDUy+ Eb/mKbzogv0n6T/CJY/J/bzeUObNKL/9RD5G876CkdFtqrKr19Gj/rl7IpMjj8fz+NA+wvJetL+w zo7nc66uTNWNRfX1MDdV97tlamT0YWYU37hMLpb7zdZzD73a9/Pb58+r+2ipb9SjaaXEPB6dZsql FRvkI/cchjdZ08Y93G6fe0Bhl/TKbsfUf99fjOGxh8fZbXvv8WbTiX+XS/+R0VGVa3QvebymWSUP SBxyN9OD7ZvgWHP5yOU9rCfp9ovrwXn7+oV0WjPa78fLMh0FTx3zs3mc2kf4oEqzYH9jdXYun9Mj o5G6kcnTWH1ddC3+YpkyIyswAB/Dpddd/d6TWqX2geUwDmYErI6l08dr3weWwziYEbAa0mnmre4D j8M4mBEAFIdxMCMAKA7jYEYAUBzGwYwAoDiMgxltinfE0hGfZ5qx98KiMkzeXZsNefLgqvTbq6fx Mj6bOOb2Hcaqejre2KvXEeNgRptGHJ83N1ALVgxIV5UIVwOYPnf7l5elerix/cVQKnNlclkx4YEV F1455nA1i6f3k1mx+zfijS2FcTCjTSOOz3uZM4xjsDxT1GjNvEy61Zg7S0gb9j+5Dn6e39/1XFTJ WpG/F29sKYxjZWYkxstUWcSxetI4PldzSpY+WrSfx+PzdHmNYiMlS+6nS7OMn4/x6Zw0flW6/E+0 Tt/IcS+Jv5Q7trHlnx4xlHDUNFi7LXOO+mV4gqWeJo77vgzST7+W2tg++zUawynC4XThI2mmx55b QqevK/U9ZMvSupDGIhuk9dMvDzZ1nFMLmYbrOYZmNBZvLC37eH+m6T7HjMR4mSyLqKFK4vhkYxkt 2M+z8XnClY3jwIDxOnq5xUzDxmdqOqfbx3TMpmb8vC6IvzR27uZGRnMjgMt9o58kzk5XXkkI+3td CdZFu9y/mBiVhQ3lvRGe2uft7+P5PB8u5dJcRwTBVNgjaY4de7jeXVhHDveRxvK6EB5/Pq1+Jfnj 5HFO1+P0HM/GG8vUq1fDnTOOtZmRGC+TZTG16nYu1tCi/Ty5KnG8cnk9NOU0cmyySGq6TP9Yg56a UTafC5b2H1t1YOzcvWpGaR6jeE7BPZXUlJYaXTqaiUZ0mX2G4T8un++raKX3R9PMG2q+g5aOQJbW hbvRjKSVTrGN5T3d31Iz6q/DON5Yvg6+NvXKOFZ6z0iMl3xZzJnRWDpT+3najLrecNB7jaYvMvtL G8S5J63SaaCxfE7Vg7l9jJ27l0dGo2EX0qmzzAruMzfuw7IbhjtYEuphf5kpCNN6NM3csYdlEqWX if81VxfG4ngNjieZ7kyPM7e/R8yo76j28cbydZAZfdg0nRgvU2UxGY8oF8toyX5eMaPsKDa+kMMb +rnGauqGf+6Ys/lcEKZ9LP7S2LmbNaPOKJM04+nl27RUtY/jX1Xnzs5taiec0grLo54w63vZJSPf 0X2m8bfCqbvAGB9JM3vsQdppPKL7FN3CujD6/T4OlhlN6Q2OM5/eWH0aq8P3TlYyzRrXQWb0cWYk xst4WYzFcBmLNbRkP8/G50mD4KUjmb4nG8enquo4DtTk+zvJwxDhNFf2gYbJODfjI43cuQsfEJk1 pLn8/VRJHUoflAmmvpI4VWO9+fCcRQ+SZPYZphWNMuoqW25L0kyPPb12+jI9/66+bRu8xzNXF8Jj zqfVRPU/f5z5/Q3PYV83Ho83lr82mdEHP9otxsv6CR+SSJ+Eeup8JO+PvPII7yfyjkfEn00z1znZ TDn+4TtYYzCOLZmRGC/rv6AHo8znL/DhPb3mMrWF6TL/6zS7p9b++iXet5RlwbAajGMDZiTGy3Z4 JvTzZAMRLrOz0V73u5h6d+Yv07xP17l2XoJxWIEBAIrDOJgRABSHcTAjACgO42BGAFAcxsGMAKA4 jGOlZhS+ULfkiazhU1fzjwEveZ/i1UdnH13JN7eYZ2517qnP+7ytJ7jZXwTwG1sINUf0EuX9vSjh OFAOxrFSM+qX/8gv4TJsWMK4I/3K2q83oH8XjTMNy3A5hsGK0uHSQsMlfH4z/6/n5+8C/+XKbvS8 BotmxiuPi3iLcjCOFZtRGgIh27AES88PPv+FxvivA4WlLw7mVpTOLxAZL2eyhpcP/3qk8cxLl4P1 D4NQCMBfwjjWOk1X59bAGjZuj4R4zq9vNgzcFQX8ujX6deal2Kngfdcoke3xPtbbnjOjfjXw6zTc 5e80Zs15/9UDL/Hmgs/1U4DVZZ2vupkKFJgJTphMIaajjuWBD5cFCHzGjMYidy5ZTRxgRl9gRt2q xtWC+fxcJMwo1khnZnOB78a2ibYfWbo+E7wvNrznzSg12zRGyz4XbbZdgqc+jo4a07IeBOQbiUk0 Fzsq+iwJ/BeZ16OBDxcECHzUjHKLfD5ragAz+kAzGkR2vMXLmQqMlRsZhQ3eksB3o9sk03TddkvS vBzHg4tO5hrCeImdMGRE3Y9YgjIbCxQ3Xn5xkLAwjaXhJdIHJvLfPxf4cEmAwDTvudDnuZWYxzoz zAjM6MvNKA6iNf8AQdfoDJ5AS8xoLvDd6DYTZjSX5m+ZUc6oh/eMhvF7ljSsuSBhj5pRH/YgH/Ez Z0bvCET41D2jzD0iZgRmxIyuo4DBvYIg8FkmvEOukRpOBc0EvhvbZmzKakGav2lG6XRd/GTdMIpn LlBctjHOBuSrknMwHSiwqjLTmBNm9GjgwyUBAp82o0x67hmBGTGj5GZ4HGRsMghb9J7RyHTMLhf0 Lf8AQxriOPc+z2TwvjTgXvv/2zHOhQaPbupnIs9ObZ+WRRq8LLfvXPC5sanBfKDAKvhsGPAuCo72 TODDRwIELni8O72nOKh/mU4MwIyswPA2SgQDaxu4ulCv+5l9vyN423rrw/fkFeuDcXy7Gf3hOyV/ /c7Sb+z7mxpoKzCgJIzjC80onAp0b2Ca3BQegN+HcXzxyAgA1gLjYEYAUBzGwYwAoDiMgxkBQHEY BzMCgOIwDmYEAMVhHMwIAIrDOJgRABSHcTAjACgO42BGAFAcxsGMAKA4jIMZAUBxGAczAoDiMA5m BADFYRzMCACKwzgKmFEcHpyI6LvEjIyMRrkH3NvXp+anEvFzLeeljVCbBPe7Rp+9XdiFIueq159J G0yyVMBNxsGMLhx+9qf9z+HW+Ak/vcZGYlc18Wc/jEi9/j2OdVU0+jPjYEbRRXv9Ww9ybbTG0wTn qPuMGanXv11ezIgZFeU+nXHrfd//f9alZ3mfGqpOTdvL3NenurpNFQU99qYK5oa7tDLbL0m/bXy7 7Q/d38G0VLqvMA9hL+8+1VWd06632Rhdjacto753H5rR0nL/Nr61Xnfb7YIp3rH6EE37Ghkxo9U0 elVSecN7FfW5Ijd9xb1cEJcL5bZ9ewEkFbyqJ7afSf96MV8vxP7CvjbG+X3d0rx93vXyun/b31Sb NqO4zO6fPVju38i31us+7fHjvRjiLW33jJhRccIpjHBqo7s4LpU37F3eenLXyn5rHKtdNI10n68f 2f7R9MOLdnRfmYu27/lt955BOArqyqz77Jly/xa+uV73D7/cjG4if50BmaZjRiu4aMO59eTeRBVX +NGL6jI10F+QXSWfaxQXp5/2IHP7Si7adpu6vd+S9HC3bEb3MtsHI6Mnyv07zOg76/Vlm33XWZk2 o3BkdE27TKeNcTCjWyU8D/WrfTTH3BH27vqL7NqDOwTz3+F33fdz2z+S/n0efGJf4Zx9NyVxOP9u X3g+/FnGHuO+fF7l7zMsLffvMKPvrNf39IP7RtXY/pO0Q8NmRsxodRf0O3tKnnKCeg3GwYxGCXty W0wfUK+3A+NgRgBQHMbBjACgOIyDGQFAcRgHMwKA4jAOZgQAxWEczOhPuL7LYNVkPFBnVhQ+I3rR 9Zfqcft+Ubg0UBjmItzPXyzl9Gq+fmPlBsbBjIpwuL09DsxROnzGO0IrhKsmzIW5CNfV+6vr7Jnf vbquHeNgRn/Oty5Ng+dYQ/iM31yzLR3pzIW5ePZ62crvOhgHM3oL6fL2g1WQd/G6XfclUPbh6tTb DfsQH79wHK+a0W+Gz+i3j9eAG6SRCa0wWJ07F5LhPr2Yn05M15JLw1ykhpU28tlrJXccmevs3dfn K6bNOJjRW0iXtw+nGg5NM1jhOFw1uFs7a8thH9LjF47jVTP6nfAZ4SikWyF7LP+50Ap9PZ4+d2kZ p3UjtzpDeI1EIS+SRVvja6UZz2tynf3F9TmWN2bEjIqRLm8/XKU4nqaIFnW89My3HfYhd/zCcbxm RmEenw2fkbuvMZZGLrRCXIZTZTv+kEXaYOfCXIxdL/lrZeo48mb0ruuTGTGj1XFIlrefq+zDVYe3 HfZh7PiF43jNjO55fDJ8RjjauTfMI2nkQyssMKOZUWNadrkwF1NmlKb9jBm96/o0TceM1tcYJ8vb x0vWD3tV6bL5Ww77kMt/1HAIx7GId4TPSO8DpdtP5T9Na7ZsR0IyDB9gGIa5OOTu8Y2cq/m8ZqYK 33B9eoCBGWFLJiVswcdzrJv4vaifJrNN9afvSf0FHu1mRtjIhSpswXed67En2Tq6Bx0+AS+9MiMA +AgYBzMCgOIwDmYEAMVhHMwIAIrDOJgRNoYV0PGJMA5mhI1jBXR8AoyDGWHDWAEdnwLjYEZYOd++ Ajq+A8bBjLByvn0FdHwHjIMZYeV8+wro+A4YBzPCyvn2FdDxHTAOZoSV8+0roOM7YBzMCACKwziY EQAUh3EwIwAoDuNgRgBQHMbBjACgOIyDGQFAcRgHMwKA4jAOZgQAxWEczAgAisM4mBEAFIdxMCMA KA7jYEYAUBzGwYwAoDiMgxkBQHEYBzMCgOIwDmYEAMVhHMwIAIrDOJgRABSHcRQwoy4kNBHRN4oZ GRkBwCphHBswo6a69Siq5nRs6lNdHzdf8dp87C+9pP2pbrafn5IcfvaX+rH/OSiMDZ0vdT+Gcazc jI51dW9k2r93u+rUHLZdgY+H5lTd8hH+jd+pJ1jxeTp3wqrwej53MHGFcWzAjD6twqZ5akd+1QeM 9kqXKTPawHlqDqfDreOl3scwjq1M0+3reyXeOu00Rdhwtv93Ub7YyDGjTZ2r6zSdGYEQxrGRBxgu 88wfYkjM6D0NHDPa3nXwSZ3MV2EcKzajY11HNzg/pdEeTtO5kfsbZcqMNnbODodTvTc66mAcKzaj dnru/vDCpeJ+RqM9eIBB7/D1MmVG2ztn7ROlHmC4wzhWakYX8/lpgsdAP+vR3X7e3KjoVcI64ums DZ0rnbAIxuGlVwAoDuNgRgBQHMbBjACgOIyDGQFAcRgHMwKA4jAOZgQAxWEczAgAisM4mBEAFIdx MCMAKA7jYEYAUBzGwYwAoDiMgxkBQHEYBzMCgOIwDmYEAMVhHMwIAIrDOJgRABSHcTAjACgO42BG AFAcxsGMAKA4jIMZvY1jU5/2u91pt6tOzeF4/exwONX79rOz9vXpcPu8pal2p/3P4asvyL7M9qe6 OT60zdxv2/Kt6u48NKdqdzsPN3Xfody5Ovzsb+dj/hx+GoyDGb2d9gLaVU382U9sRG3jWFfVaZ8Y 1Fc1bheDuBp3+PeSbeZ+e6yryHCOdRN931TDfeFvz1VrUNWtM3Y5X8k1k57DT4NxMKO30xpPc+7x haOegRnV9bkn2I6axnuZH9/AJQ1Qrhc8ts3Uby8N3vm7sV519z3Knqvjuf5310Sa3tw5/AQYx4rN qB/Kh9peY301nthoUjPq/n9ITOubSPPe/j9teMa2mfptN+oZNaNz42iKbh3nqhv97JKR1tw5/AQY x6rNqO0pNaf6XHG3PI3SGc3VXG8XVWBGx1ser3muv3aq7h0NXGg0Yw2ZKbp1nKv0t9091SXn8BNg HCufprtPX1XbbaAj47lNUQw+2/jo7zcYTt8My2Fsm/znwcMigcKG0BTdWs5Ver+pPXdtJ2H+HH4K jGPNI6O2oWh7R8GNzS0ymJKr4ifp0u+/dapucGM7M0Ic22bJb8fua5iiW9+5uswQZDoJRkZUxIzC R50vDfjGRgxjj3FfPq+6+0hxT2/q0e+vaOTuo8T+XF8br+D/mW2mPp9qyEzRredc9Y91j9d9ZkSe pgOAN8I4mBEAFIdxMCMAKA7jYEYAUBzGwYwAoDiMgxkBQHEYBzMCgOIwDmYEAMVhHMwIAIrDOJgR ABSHcTAjACgO42BGAFAcxsGMAKA4jIMZAUBxGAczAoDiMA5mBADFYRzMCACKwziYEQAUh3EwIwAo DuNgRgBQHMaxUjM61tVpt9uddvv6dDgcN1m5jk192rd52FWn5paH4+Fwqve7bN6aanfa/xy++oLs y2x/qpvjQ9uMfd6W6y75/HhoTtWu+/yqqt5mPfv0c9Vy+NlnP/8kGMcKzehSUW8NdVNtv/JdLrCq iT/7iY2obRzrqrrn+ysbt4tBXI07/HvJNqN/nzs1nclcGrRb+R7rJkq7qYb7wkrO1bk9qG6dtEsn NbmWPgXGsUIzChuGjzCjs/E054srHPUMzKiuz/lsR02f2/ObbeCShqY18XS0MrbNot9ONZof2sB9 wrk6nq+Lw709+NwRLONYmRn1w/d+uL7f7wa9pC31kK7GExtNakbd/w+JaX0Tad7b/6cNz9g2S347 ZjphjxzrPFf3afvd545gGcfazOhc6bqK2k/X9b2k7r5Ke++lqbfRaHdGczXaWz4CM7pM0Q3y/H2N 47sbuEM7Qs2Uqym67ZyrcPru02AcKzOjsGJ2lfbYjSp+zj3Yn+vI6HD+eyvTWZHx3EZ0g8+S0eA3 TtUNp2+G5TC2zdxvw05OlJ4pus2cq+v5atuCz+w8MI6VmlE4irhW2OtDANeRw/5+Q3MLDKbkqvhJ uvT7b52qG9zYzvSAx7aZ+m3Y+LX1p67jhs8U3TbOVffZ3gMM9Lf3jNJHPrubmduZxhp7jPvyedXd R7p+f5+anHj0+ysaufsoMX0MO/h/Zpuxz/tHgnfZew6m6NZ/rqLPP/iaYBxeegWA4jAOZgQAxWEc zAgAisM4mBEAFIdxMCMAKA7jYEYAUBzGwYwAoDiMgxkBQHEYBzMCgOIwDmYEAMVhHMwIAIrDOJgR ABSHcTAjACgO42BGAFAcxsGMAKA4jIMZAUBxGAczAoDiMA5mBADFYRx/bEZxWGEiou8TMzIyAoBV wjiYEQAUh3EwIwAoDuNgRgBQHMbBjACgOIyDGQFAcRgHMwKA4jAOZgQAxWEczAgAisM4mBEAFIdx MCMAKA7jYEYAUBzGwYwAoDiMgxkBQHEYBzMCgOIwDmYEAMVhHMwIAIrDOJgRABSHcTAjACgO42BG AFAcxsGMAKA4jIMZAUBxGAczAoDiMA5mBADFYRzMCACKwziYEQAUh3EwIwAoDuNgRgBQHMbxfjP6 HxERTYtxvNmMiIiImBERETEjIiIiZkRERMyIiIiIGRERETMiIiJiRkRExIyIiIiYERERMSMiIiJm REREzIiIiIgZERERMyIiImJGRETEjIiIiJgRERExIyIiImZERETMiIiIiBkREREzIiIiYkZERMSM iIiImBERETEjIiIiZkRERMyIiIiIGRERETMiIiJiRkRExIyIiIiYERERMSMiIiJmREREzIiIiIgZ ERERMyIiImJGRETEjIiIiJgRERExIyIiImZERETMiIiIiBkREREzIiIiYkZERMSMiIiImBERETEj IiIiZkRERMyIiIiIGRERETMiIiJiRkRExIyIiIiYERERMSMiIiJmREREzIiIiKiU/g/KhdUy5Rcf /wAAAABJRU5ErkJggk== ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/image007.png Content-Transfer-Encoding: base64 Content-Type: image/png iVBORw0KGgoAAAANSUhEUgAAAaYAAAJDCAYAAABAELCvAAAAAXNSR0ICQMB9xQAAAAlwSFlzAAAS dAAAEnQB3mYfeAAAABl0RVh0U29mdHdhcmUATWljcm9zb2Z0IE9mZmljZX/tNXEAADx0SURBVHja 7Z0LrqMwEgAjgSIEyh32KHu0nZNnY8DQttvG5PcaUiW15g0hgI1x4U/g8u/fvwtBEARBWAkygSAI gkBMBEEQBLEppvv9/t87AADsApEgJgAAUyASxAQAYApEgpgAAEyBSBATAIApEAliAgAwBSJBTAAA pkAkiAkAwBSIxJiYhmtzv1wuarTdTf3ObRjuXTOt01yHzPbaez/cni4o63aae9fXb0cem4z4OF/h NvT3dudxPUvfXp7KB6vpsXbMe7dzhLyargH753Nv2b713b15sV7JgUjMiakdC8V0wT0KSdPdh8eJ v3VtVkxrIdEr/KnAPV+A3L4DsczHtO/CXMXqt1dKz/4Lar2YfB6+vYJ5HPc7hVqbnm/xqXx7d9ot HOenzuezaXs1T2rL9lo/+RtOxPRTXXmxmDbX/6CY+nb67nJMO7eViGn+/7sq+fiOtG8/U6m7VuM3 xPRXd9ifyrd3p93CcX7qfD6btlfzpLZsy/1M9QFiQkz3tGvMF6ZFTE2TtGpiMfl1x/XafucFsP87 sZimbsHwQlq6EXwLUaSzvfb3vg+lKO9C5YUvW3duf+l2au5amyR/gy7WipsFrQtV2+4q+3XdVLRb eXPL7jP97lyZ+HwSLfKtLmOtDPr9yy61sXw9tttfRVkM9ld5LrW8Sc5v2JWXz2MlzTvLhn6u9G2P 6wc9Ddvi0M5Bzbnfc+5eKdt63utpj48bMZ1dTKIbTApnkc1DGnHrKVhv3u5asOq71J69k0/GmZQ0 yWN1f4fLZEWVVt7y7+EhMHmM2naKxzpXqoPIUynUmrvK8RzN8l7Sk9mu32YuPdV5o+0z+W6/ngdX TkSlHufbVvri/a9yCcc7l3I87i+Wzsa5VPImPs5AamoeD9k07y0b6fEUti3GX6a/K7ZfLLv5c197 7l4t28nxBec2l6/P9YwgkoN25cV3x1JGssAkYorHi3ZMRNga56ppMckKVLuLu0RyDe5AKyqzWJ7a dmoqH9mSk3eWdd0dqexL2w3ugru0cq7Jm9w+k+9W5OHm+VTPTa10orvtjeMo5U2831weZ/e1s2zo x6NvWx5Lbd7G69VfF3Xbf7Vsp3mfT3t83Ijp9F1503JXiLQWU62Y9t7FjNuct+f+7rvnx5jiStQV 5JzwfCGvrcxyF6ncztbFKy8kecG+KiZtu9P5WO++NTHV5E1un/Gyd4hJPzfvF9NW3mhiUvM4s6+9 ZUM/ns+Kqe66qBfTK2V7j5hendiESA7blRfOignEFDXTta682tl+srKN+8trZ9elkx/CQVPZivIC vHVd0qURXghynKJwx61sZ7s1oG9rV1eeHNNZ7nTT7XqhhJV2VDnX5I22T+2772gxqefmFTHp53Ir b5KWWiaPs8ezs2zox5PbdhuNGW5PGkrLbu11MdR35b1QtmvFpB03YjqBmMJB1qjZvkxceNyVtM3a l/9Y3i6tqLW1pA1sBt15FYUmlFLa+ipOY4/Gl+Ip4+EAuNy26w+/5AfzH+lv4q6DOX1+nanrUN9O TUtAP95LdaspHvQub7eZj7O9d5n07MmbZOJEnM+P817Kty0xxfuX2+rEPuQgeJ9NV+ZcKnnTR8cZ p0HL42yad5YN7Vy1FflZOzFBHmty7JXnfs/kh2fKttxPX5X252btIRKe/AAAYApEgpgAAEyBSBAT AIApEAliAgAwBSJBTAAApkAkiAkAwBSIBDEBAJgCkSAmAABTIBLENPLpF65t/Tpd2//Q9ffhgy8j Kx7vi/s94sv+AKyASE4qpr0vDvv0y+m2th9/Pors2n30ZWS5PPv0S9AAoAwiOamY9r447NMvp9tu MaVPBe+iZ5F9M8++uV8ACEEkxsRU//KtwsvWMi/06pYX9G2/nG45ns2XvuVf0DZ+P/OyNP0FaPK5 cl3hRWzK8S/PEHT/j74THZP6MrkXXoK2+eK8J15WCICYCBNiCh54WvHyrexj58ULveQ240fcbz1d Ov5u9qVvmReQ5V6WpqclemtrJ55OnH0RW/z6jDZ5edsiV3lM2gv7XngJWvnFeftfSAeAmBCJzRZT xcu36l+2lnZLbb2Abet45KP/cy8gy72TRk9L+JqCLn4t9qA/qj9+1UMuvf5Y8i+Te/4laJsvznvi hXQAiIk4hJiefemb+v6jjRew7RWT9gKykpjStGTek1MQU3gMbVHE8pj0l8m9/hK0rZe31b6QDgAx IZJDiGn7pW/6y9a0irrmBWx7xJR9QVvuZWlqWsQL4q7br1Nfjk8ZA4qnaqddgBWvZN9zHrZenLfz hXQAiAmRmBLT3pdvaS9bk8uDF3olLwrMv5xOO57SS9+0F5CFx1d+Adqa1nacIFCTH3Iduc/kRYsX veWSO9a9L0HbenHe8MTLCgEQE8GTHw7K2DJpo9fPM9Ub4NAgEsR0aFzrrzT2BgDHA5EgpkMiu9ok wZR7ZsEBHBJEgpgAAEyBSBATAIApEAliAgAwBSJBTAAApkAkiAkAwBSIBDEBAJgCkSAmAABTIBLE BABgCkSCmAAATIFIEBMAgCkQCWICADAFIkFMAACmQCSICQDAFIgEMQEAmAKRICYAAFMgkoOJ6XK5 EARBmAnEhJgAAE4PIkFMYIzl7bzRW3jda+TjN/Z++7ji19gDfAJEgpjACP618M11WJYN12aWU39v lVfJf+3YnBQviAm+AyJBTGCEqfJv7/2wVv63WUhOCH/dYnKSREzwDRAJYgIjjK0jRTyuC821oiYx tVPLaRbYre/uzdiSevx/lsbSFTh3A45ye/zdtdOyzn/+2Nctaoml351acb5rETHBN0AkiAmMUCWm WUh+Xd+KcZ/Jf/32mmu/iMUvn2TT3Lver9dNkku+OwTHxBgTfAtEgpjACHpX3tRiibvy/N9ri2YS zSgSOZ3Xt4rEJIrw+w9xzWNa2neljOjKOw7+ZuOoIBLEBEZYJCNaTevkh1BMa4tmbe3IFlS4XUVM c6upbdcKTPuubDFN4lpbWmC1HLnu2RYxETbEFI8HMC5wxEolOodCUst4klg+PITUROdZTjd38urb dFvj9tx3xQxA7bvLGJRY9i5kC02W0SAPvJSXtIcV7nBtVVEm23h8v3vsI5iK/4cTSd6Vb7lrnBYT Ya7FJO98p4rl7+5yj36BwGcYReO7JaM7/FvXJeXVdyn6lqL/XqeIMp5276UWj58dGdnFOqUvFjZi IgyL6S8vxKmCOHaXAnyujMa/1xrH0URLR5ZhTUx9q5etsVsz7rp8VN6tGEs7spji6yoR+9zKPXIa EclPtJjE4PnS/J+nG0dTiQdtHXdH9vis910I81hG/GSCZKrxsq2pxVacxrx0r6zTnuG8xPLw4nGV 7tDfkso17sqTMwi18l/qpju8mObrcRBjg0ftlsyBSE4qpkthXGCdLqzfnebWkWMO09/rtGN1qnHf L3d2W9OY42nPcG7S8dC0u1mbtLEsl7/Bir473gCdWUzBzeNxx8pKIJIf6MoLCvVy5zkLRZuxVVhH diNIMenTlNd1t6Yxx9Oe4XeIWwCS/pou9114fvJG/EQMrSsvvj6OLKZf+D0ZIvkhMcmpx32ri2lr nZKY9FbXKqbSNOZ42jP8BtPdv34zos0alC3qrJiUMRa5rSOLKf5x9FlBJGeeLh5V8Ok008dFHk0l Lq2zPAnAt3h8l0L8OJugq08ZY1KmMWvTnqF0ro/9W5Wl7Gg//M2UXzmTLy7v6k2P0t115Oni2s8F EBPBD2zBDFMFy4xHOCeIBDHBAWEqPpwZRIKYwAh95qnf+jR/L6Z0vTbzlHGAo4BIEBMYIffUb+3z YBKKGHvRpt2f4UkH8FsgEsQEhtCe+j0uT6bwl8WkTc8HOAqIBDGBIXJP/U6n8OfF5Lr7Ol5RAQcG kSAmMEb8+x1tCn8np+1HU6NzTxkHOAqIBDEBAJgCkSAmAABTIBLEBABgCkSCmAAATIFIEBMAgCkQ CWICADAFIkFMAACmQCSICQDAFIgEMQEAmAKRICYAAFMgEsQEAGAKRIKYAABMgUgQEwCAKRAJYgIA MAUiQUwAAKZAJIgJAMAUiAQxAQCYApEgJgAAUyASxAQAYApEcjAxXS4XgiAIM4GYEFORW9/dm7Gw tPd+uE3LhuHeNXMharr7MC/fve2uvV/a/mPH3rfhMY5peeF4p7T391bkBQAcA0Rywq68sZKPJNJf X5DSWMFfPiYmJ73mOoj9zTJ9UUyT7LbFNDzyBnkB2AGRnFFMrqK9NkFl/4qYHJ9sMQ2PY2278NhG Gb7cYnKCK4upZh0A+C6I5KRiGsYKt7l3/U0sW1s+o2gefzsh+G4zJ7PL/Png//Zda6OY2un7ohWS dMHNQunatMWzrCtaX8t+ohZZsB3xmT/uizgOf/xdciyhdLT9h9ubwgk97gKNt62lHQAQE2Iqimmu sOfKO1gmpNB2awU8VciTvNbKeZLbVIFP2xplMsvNt3SGsYXWL9tKWkCixeUrffldtcXkxamMFa3H NstW7NMJYz3+WV6Z/Q99v64j8iuWVrLtJO0DtQkAYkJMW2KSQsiL6RZ0mwWVeSwm2cqQrSrRCsl1 wfkK3SMr862uvLjls07ymI8tmijhx6zk93L7T7Y9p23cv/s3s20t7QCAmBBThZi8FILZbkE3mquU 94nJV+p7xoZki8sf02aLSTmm8Zjn5X2ri8lvO2kxKfvXxpimLrrytrVjBoD3gEjONF08MzV8XN6K MSBxp+8qVz9WErQExDjUxbcclNaBHLdx3+/bfAsiXncVVtr9lzumpKXiZCOPTRu/mv+v7n/Js3U8 zreWxr8z285t71XW9K3Hk5znqMW4tdwqa/59Pq1bP5vQtmc1P2uOK5e3vnxZ73pGJDz54fC84zdP oRzasHL60uQGt69WCluRuxxvq/nb7DmLxuhUWbwxrbeuy8tP3Z7N/KxJ+1bexj/PsAgiQUyHRt4J v3qxyVbau7ddlZZ+SLoMtQo9brWNXZKZ5cc4h/kK9h1pleexOk9bm/m5P+3KxCHEhJhQB+yueC75 HwbHMwD9WFdu+SHSLLpOP5FWJ6ahvwUzTrf20zQ283N/2tO8RUyICTHB0xWQ1r11RjHlnrzxibRq k3POLCYtbxETYkJM8BS5J1KkXTnprEm53Hw6C5XkrrR20SSVS35iRTxrVd3e1WZ+7jnPubxFTIgJ McFzFZCY1h8sjwe/5RM3lOWm0yh/G/dIb9fdPp5WrVLWt2czP2vTXspbxISY/kxMY+FrrxtPG28f BTu8swwe0bPzYuS3Pa8RTIUPpvu7ykhMY17OUTSFOrPcfFrl46U+kNagTC9P/9jej9X8VI9VpCeX t0m+G/5ROCI5oZi0mTu5p43fomfqjd/P3K3XcKTZYABgE0RyMjFp00NLTxt/t5h4WjcAvAoiOZuY lB9m5p82fgu79i5bT98uP83bQ5ceALwCIjmZmLQnXRefNl7ZYqp5mnfpGAAAakEkPyQmR/K08Qox 1T7Nu3QMAAC1IJKf6crLPG18Q0x7nubtoSsPAF4BkZx48sP208bl+JI+Xbzf8TTvZdtMfgCAF0Ak Z50u/sEfBJaeuM10cQB4FURy5h/YfmCcp/TEbbrwAOAdIBIeSQQAYApEgpgAAEyBSBATAIApEAli AgAwBSJBTAAApkAkiAkAwBSIBDEBAJgCkSAmAABTIBLEBABgCkSCmAAATIFIEBMAgCkQCWICADAF IkFMAACmQCSICQDAFIgEMQEAmAKRICYAAFMgEsQEAGAKRIKYAABMgUhOJCb52vPLpbl3/W18xfr0 /0c03X0Ybju219/bS3vvh797XXrfXsbXtU/HMqXpvXn2me0CwPMgkpO1mCY5hRXtre/uTdvv3paT wqVCTMO1+4i8vFSdmL7Fp9ICAPUgEsS0sa2ymGrWeYXh2nxNTJ9OCwDUgUhOKabL2n3nYxZT0LU3 t4ZGcTXdvWvDLr+4ou7b0vacDF232PR5cx3CY1G2H2xTLIvTsHblTceyfOdxDNPy9Xj6JA2Pz/2+ 3TKX1nH9x7ai7YZ5o6UDaQEgJsT0pJi2W0zreqtMfMvEVe5rhSwqbS+juaJ26w+P70t5jfsSFbis 7JPtPz7zy1zLyC3zf0vRuHVkt2KcRt/9lm6vXwQnl4+im9eV25VpSdPRMQ4F8CUQyQ+K6eZbDX6C xNxiGoRMYjF5mXi8SLTuLy+xsTXi/s1sfxSQ0qrzMvL7mVpM4X7kPjoptGh7vsWUtsbmtEv5FvbR PtEVCgDPgUh+TExj5T1X1H2ri2mdCRe1mC5ht54mDM/UEilvPzd+JFtMk2zcdiJpzOls23Wygra9 WEyydTVJJy+mOB0A8B0QyY9NF+/jVoWTzdKCClsuSwskHr+5rK2nuAUSCMF3/WW2n9/m2r3ol8fH Mq43t7wk8fbkeNSYJvcd0bUot6ul5dutpbg1u3meA+k2wbnX8vLbsxxfTet6PuPypedBqUzu2X8p 32TLXCt/n87fmnzTykIpPxETYjJH3KJ5B8O1XSvHD2z/W8h0fPw8yIkYhd+QaeNdLo9bL3Y5Htj1 UQvQxgSOmrTGY4bBBJnMmJ+vtGNh7N1/Lt9K3/vGzxuq8i1bFvL5iZgQky0piTvPrYu5Bn9Hlrao 3rP9bxGn4yvnQlQi/hjSrskhmdAxVUZD0lWqVmpGxspq0pqvkDN5MC+vOWd79h+0/sUPsmU3sV/n 0y2mqjJSWxYMzzJFJLSYwAhyZqL/vyamwVeKkTjXbttcS6s1041Xk9akIhWzQrU88DMp2zbtMn5l /3G+afnsW1SfFlPtcW+WBeMTehAJYgIjPFVZK90xuW4aK914z6Q190SOoNUytibk79Pyktiz/zjf nAC769plKMVlRUxbZcH6E04QCWICI6TdNNsD1P01rXTUKfzG7pD3pFWb5KLlQbzeWGlfo4k32Uk4 +v7jfAu77zI/Zv9gF/DeMpL7OYf1bnVEgpjASmUdD2xvDE7nKhj1B9WGuvH2pDUYvHctle6WzYN0 HKo0s7F+/+FY3vrDa20fHx9j2ltG4t8wbuSnFRDJScUkL1g5hdo/9UC7a1wK7jgFtzFVkf0K4SOe 5JRvZfq/OHfBj4uNd+PVpnXQftowVJbfitlxW/vP5VtwXNH+vzJdfE++qT8nuBTHnxATYvpcwQ26 H9ZHCAUXV6ZrRz4GCDkBwLdBJKd78oPymwxlWc00Up62DQB/ASI5m5ii1tKyLBmgjR/vM3d/XMMf w37ztRMAAA5EcjIxxdNJtWXySQzxjxJzD2sFAPgWiOTkYtJmDsWvmAhnNeXXBQD4Bojk5F15W+NL 4VPC05k6dOUBwLdBJCee/BBPqw2fmDy/HE8+hfjaKs+5Y/IDAHwXRHLW6eJveHIw08UB4C9AJD/w A9tnoAsPAP4KRMIjiQAATIFIEBMAgCkQCWICADAFIkFMAACmQCSICQDAFIgEMQEAmAKRICYAAFMg EsQEAGAKRIKYAABMgUgQEwCAKRAJYgIAMAUiQUwAAKZAJIgJAMAUiAQxAQCYApEgJgAAUyASxAQA YApEgpgAAEyBSE4kplvf3ZvL5X65tPd+fq36bRjuXeOWXXa9bv029PdWbOfpYxq309y7PtzO3te2 +/Vz23s57z60XQDYDyI5YYvJVeKXtg+XXeultGzjSTENj32Vvude++5EWSumveu/g600AMDnQCRn FJOrVK/NvbkOwbI9YppaWvvFVPu94XF8e0Szd/1XeDbtAPAeEMlJxTSMlevaNTUtc91VU2sqboVM LaS1lRRXzsvnojtw/c7aQvPbvczdYrJLMOhW1PYddTVq68vtLd9z6RFp07Y5fv74u2vnZb7bs31s K9rumoY1nOTX40FaAIgJMT0hpts85jRX4nLZXHn7VsggWleuQl8r4bWi9hLx646Vt5fRXGGP2+p7 RWjT/913pThG0Sjb9mjry+3dIvn67rd0m/0iOLlc7j84TpEGmYdjWruOcSgAxISYnhXTVJFOAimJ SZuIIMU0CuISto68wKREYqHF25H7kVKMt72kQ1k/2f6cPtfi6ebj0bbpW0xDMinEt+yEiAv7aKOx OwB4P4jk5GLyFfzSpRWJybUSOtEy8cRiSsQ1dneFLSNVHLHggn0/ttvmx4609bte277bzjpZQT3e SEyydTVJJy+mJQ+ZtQfwFRDJmaaLZ6aGj8tbMdZyicdtwrEc1/JZWh3xmM3lEnT7xcvilojcTrzv 0nYWmVzKxzWu95CL/J62TTkeNYrJfUfkQXicYRqWY/lCa8kfR5yeXJ7E3ZNyfC/NC1tiXX/esH1c uZ8X5Fv729vdymvZ8o7X0ctI3X6/kW/y2GX+PPvzEcSEmMAgw7X9WqWuiXb9rI9acutYWOtvDuT4 XzTeZqUyCifFlH8zl/u5gLbcV9q5/KvN69LxafvYu99P5pvsFUmO/SBjpIgEMUEB39r4dIVTU1mq lZSvgPohmC2ptS7e9aPpd6UxN56opTH+XFvuWwN7zlVZTGJm6TK7M93HM/v9ZL5pk4jinpFv/ibw GRAJYgJjVItJtIaWSuuSn85uafJGrvKM8S3CuALWlvsZlG2bTqR5Jq+1/NT28cx+P5lv43FHP+vw Yhr6tTv/mzdbe0EkiAmMUSsmXzlrlZfWZWfpaRa1Faz8rdsioMLy8Hdp2y2DopgewumuYReduo92 /34/mm/RmLE2FhVPBrIGIkFMYIwaMZVaP9qswlrZfTONYZdUWHmmlavvUu0zy4ckjWOlfe2WSS5h zN10pa68oPtOX3/cR9tWtf6+kW/J+q41lxHQ3qfBfBNEgpjAGFViirrxksoomrW4TIZwrQAD4wvJ IP7G3XvNrLz0KSPbs+OyYhI/rA7EpO5j/36/kW9TV6R+LNZuVGIQyUnFVFvwhq7/yF3TN59tdyaC HwcHM6viKeBhiyj4XvB7rejHxoYepxQ/viqX1lhApeXycVJb5W8rr7XPc/vYs99P59vyefyIL/mo LeM/FEckJxRT3NzPrufu7q6fK6B7X20BAOBAJCcT054pwZ/u1uEp3QDwDIjkbGKKWkvrr8TTgd/l sTzxOnMXQPKE7nkgtWv159pp3Qd06QHAXhDJycQUTyedfng5PeBUjkvIbjw/HhXPPio9oTt+TUTp CeGWB1kBwB6I5ORickyPIVmflzcuE9142vOztp7QvfX08dLxAACUQCRn78rzMhHPUnPIH1tqU4+3 ntC99fTx0nYAAEogkpNPfpDvTVpf3RDOxovf2Jp76rd8blzN08eZ/AAAz4BIzjpdfMfjRuQTq985 hZzp4gDwDIjkx39g65CtnXe9S4YuPAB4FkTCI4kAAEyBSBATAIApEAliAgAwBSJBTAAApkAkiAkA wBSIBDEBAJgCkSAmAABTIBLEBABgCkSCmAAATIFIEBMAgCkQCWICADAFIkFMAACmQCSICQDAFIgE MQEAmAKRICYAAFMgEsQEAGAKRIKYAABMgUgQEwCAKRDJycTkXmm+viY9DPeq9Vvf3Zumuw/De197 fhuGe9f4fbX33u3H73ven3vdu/z/8t3oNfDLq97feJy3ob+38zb7azu+Pp7XvwPYBJGcTEx924yV rsNVvL7Cd0Jqr/0kjx0V/nB9VOSV6/rK31f2k4ja4Pvx9sZ12j74v5TUu/B5MYr5suaRkyByArAF IjlxV54Uk2eUR6WYplZQWy0mv08vGt+KWkTl/n/tw2NJxPWZVozMi2FuMT2bRgD4LIjkR8XU+e4y 0VqJu9CWrre5hbH+/5K0hJbtjy2S6bOl+8yL6vFZ1+VbS0E35GN5cKzymKNtNmP3XLMsX7YjBBwf S5xPtJoA7IBIflFMc3ebbLE4SfjK2X9v6Hu1NTG1MtbusPSzefvdQyb9uo/+GrbUtOPzkpBjVtO2 WqUltq4zdtPNaZv+1o9xkm/aSvtE9yEAPAci+eGuPNmNlUyaGFssaTfXbZnU8Kj0r20wsWJZZ5aI F5GTQfP4u1MklBNTfKzTNobku7n0xGKS3XfxfhETgC0QCWJaxBR3Z8ViGuW1iEJvMS37SCZBpOvH XXl+H5qY4okUftJCvZjkGFMqJrryAOyASE4opnDqdjjW4seRxq46MS4jP7sE3WHrGFM6FT0/aaBv 18/iSQ/rcYaTH+QYlhNFH42DxcdXSs+yrfm7rsXUtk1y3NYmP/g0lFpwQau1vyXfvcibAj+2JsKK hHPpCMvRJRjnrE1TzWzLNb/0/cv81M6H3EfNeftmvuXStpVmxISYwMvoA7+rqsXidPHSlPlgXFD+ 7SqrZQxOjh32gXTlDcOfpjGTjjgfgop/aT2X0+RvSkrndfr5xLCuH7Xct45P28enfuqwO98yadtK syUQCWIyXRF/EqtdeEUxRRWKF2tN9+RYkRmpjHLpqKmQS2ny/9/cXj8EvQhqXvnZqNFPLHL7+IqY KvItl7atNFsCkSAmMEapgssJKG55qhWWaIH8NXvH+XJSjdPkW081Fe/adZz56UPm89w+viGm2nzL HftWmq2ASBATGOMpMcXjihdtqrytsbQ9Yso9gSQYyxSS2tMikN2EwXlwv7u7TuM5jegCy+3Dkpi2 0pZbbgVEgpjAGPu68pTZjsrzEC1149WmYys/ZJpSMc+TFtrr+szGiy5u9WcRyWxPt35mH0Ja3+/K K09iyE3usf7EE0SCmMAYuyY/KA/EzU3NtzSmsJUOrSLWnhySS9OeFpOcOBIsu+g/Pcjt408mP2y0 erS0lZZbAZGcVEzxRaI92Xvo+o805fld0Gt5lzx2SQzEB+dSW5apqCx14yVlMpkKXvfzhFKatsQU bDt5dJWyf6US16aL59b9s3yT13tmOWJCTN+74OVMJdG145v+ud8WvQue2g0Az4JITiYmbVqtvLNc xBR1i7z/OHhqNwA8ByI5m5i01pLSHeJnOSWfi2fTBU8an1tdNU8l99ClBwDPgEhOJqZ4Oqkca1q7 9NZuPP+5HOBNnzTeh0/63ngqee5YAABqQCQnF5Nstci3uHby5X1N2OLRnzRe/1Ty3LEAANSASE7e lbf8AFNMf5U/VtSm3GYfZ1P5VPLSdgAAtkAkJ5/8ED+JOHm9efBW2vSp3X7ZnqeST8fB5AcAeA5E ctbp4pW/U5BPan7nFHKmiwPAsyCSH/mBbQ7Z2nnXO1rowgOAV0AkPJIIAMAUiAQxAQCYApEgJgAA UyASxAQAYApEgpgAAEyBSBATAIApEAliAgAwBSJBTAAApkAkiAkAwBSIBDEBAJgCkSAmAABTIBLE BABgCkSCmAAATIFIEBMAgCkQCWICADAFIkFMAACmQCSICQDAFIjkRGIaX43erG+kjd8iexv6e7vx ltpxncrXsgMAfAJEcrIW0ySn516RvogNMQHAH4JIEFP0fVpMAPC3IJIfEtPUldfe+4d0bn13bx4C 6tq566/t13VmMfX+M/f/rl26CC9yG5e16/CifQ/BAcBOEMkPiWkShpPKOhblxqECYUkxXVOxyO3f HrJqrkOyzI9tDddm/BwAYA+I5KdaTO6zVEDJ8tzkiaWFNEtITraYt+VkdJGtqLklBgBQCyL5ATH5 Vky1mMbl4Qy+UThLV13aOvK49eJlAAB7QCQnni4ejwktrZlHK8aPA7muts3lDyH1cUvIbTMYd7os 3XbLGJNYBpXnMGqVashWqczfdfnzk1+spTW3jrZctvZzP5nQ8jFXRvfs23IZSX824usJu+UEkfAD 2+cvkK4fhbcU9ivddi/lZzzWN/9ds46rrNq5gnUtWetdqC+lNfe3KI+Ovk23mZbhVhXT3n2byjcn LjmZSazjpWb9hhGRIKankS2jo9ylm66sI6G4/C39SDroju2HZaKK9r1DpjWzTnU+Vcg5K6YX9v3X +RZPOvLd676ldIReDESCmMAIuQpFrZxEF+3W8qOmNbdOzXe18c9cRa9V1K/s+6/zbSwH4qcai1TH 1tIjX1r7E5MQCWKCA1XWY8XzqGC6a75LRk5UOXJaX5FDTTeer8RPJ6ZkrHmdrHRx+dKts2+ttqwR CWICI6TdNGn3aDqbUltnnWV56LRm1tn6ruzGS34ErlTWdV15dfu2kG/B+vMP6cfyEqXV8gxaRIKY wEplnfmhc1LRLOtkxCQGvw+d1sw6W9+t7cbz61ZNfqjct4V8k2lLZy2Wy44VEMkvTBcXhbfmCePP XzBiUD6YOaTfbW5t523HtjyhIp1OvDWlffnOOGW+HY/rk3ea6zhRXKFEvymLfsAcLDvIo6Bq0qqt U1ruqO3G0/IxKa87920h35bPNdmLn3hYniCDSE7+A1tZsX6rsloffXRLK/gv38lLGcop1fFnpcpr lNrYUlnz9Qgz3wCOCiL5hSc/fHmgMzfG8e3f15R+ZyL73kvIweZhbjGV0ggAr4NIfuRZee4Of+3O ip4OPs/U8evJbgDZPdheu3vXrS0f3y2QPgg2fvae/wHkNCuolU8on/vJx6ecL49Ccp9l9jMLpRdP q5BPqIjHGjQRqvIuPW0909Lj8UsAiAkxvUFMsptt+eGdf5ae8mRw2WIIfg8hxjbcMrldKaZg+SgY 8Xiktguecu73EbxWI9jPKkk5ZhQ/4VyKQxs/irvhboWnrcvvxN2TPD0d4DMgkh/rygtbM+Ezs7Qn g8vpqCUxpdtV/pbjPfPf8cyiYH11P7mHz9aJKd+K0rcru++035AgJoD3g0h+bPJDWOl2gTD0Hype NltM6zue6sW0TCrYIaaL7+KrFFMsIW1cyU+IyItJjjE1h/kdCABiImxPFxeVs3ySuHsrbXPRutJE d1n0A8W2uyXTrv0v4pMxn+jvYFvzMfVtZtqzb01F+8k9FX2ZBitFlIx7aT+0LG/XtZjatkke9cPk BwDEhJgMcMQp0vFzw345LwCOAiJBTFUc6QGh2rG/cyyILjyAz4JIEBMAgCkQCWICADAFIkFMAACm QCSICQDAFIgEMQEAmAKRICYAAFMgEsQEAGAKRIKYAABMgUgQEwCAKRAJYgIAMAUiQUwAAKZAJIgJ AMAUiAQxAQCYApEgJgAAUyASxAQAYApEgpgAAEyBSBATAIApEAliAgAwBSI5mZjca7+nV6CnkXu9 +G0Y7l3T3Lv+9vi7v7eX6e9nmbZ3qXqduXq8bf+zF6TPj62883l8Eeeqb30ehudvzePXzquFtMvy 4tebymxYhtrull3/2f3r+/bn4RFNdx+GW/EcvYNb392bjfMpj9XnxdbxIibE9DH6di2srnAuF9Cj MLcVonjbxeMugGtft16zHvMeqZ2VW9cW0+8rJrmO+05QGc+Vjjzvbh3r0i+lfRJQe++HW/h314// rteAso74+5n95/fdqXLQztF7rqvtNI37ns9zvE7ueK2BSE7clSfF9P19t1UXgHZx1VYiZ6VcOW+L O6i8+mG5K3YtKnn3fLy0r6358W/ljn9cHlTK5fVr969va219aK2ST1x78c2Fdk7j6979361zyxyv RRDJj4lpLNhLl8dUeU3NftmV5yu1x53X4wLsfbfA44JYugj8HbmyveRi8l0P7k42uiC0u3jEVKic x7x8tI7afLenrJzDc24/TzdbixtpkS3HZ9JezPtoW66iH5Zr5hL0Tmydo3dd0146yXEKCXt55Y4X MSGmPxfTWnnJcaX172mcwl14692V24YszHH3W7w97TjGCyOqNLLynIVotf/7T8U0inwSvD8naZ52 aiUsu/gOK6ZH2eiu+W4y341Xu/6uvC9sS7bIas7RR8Ukx5EyY1G1LUjEhJi+JqZ48DSVlOjD9hdb sDwaF9oYjM0NAudk5uTIGNNQ9VlcMW13A9poNcmWdjxWVuzKC8pjXJ6ilqK2fufLahxz+S915RX2 PZbb6yqmLXm8lG9BV155YkXpJs8fL2JCTH8uJnnX7Av1K2LStpceRzcPFIcXVTIw6wX2w7Pyqirn S+YGQeTveHff5QfFD5n2uYusz4kp7sbbWH/P/mv2Hc4S3Lff6vyJJz8UWj2T/DM3ixstU8SEmN5/ ccdNeVF40+nZvttOiGbuF/fTj10BlsuXu1055lQYZxrcRRBNXQ3Hpi7q1NZfJMhPZRA/zjttWnQ6 fmh/enBt2rV1PHE33tb6W/vf2ndQhuNxUuUcvVPecRddMDnDfx5PXy8cL2JCTOaw1MUDAIBIflhM 8oeJvzymAwC2QCS0mAAATIFIEBMAgCkQCWICADAFIkFMAACmQCSICQDAFIgEMQEAmAKRICYAAFMg EsQEAGAKRIKYAABMgUgQEwCAKRAJYgIAMAUiQUwAAKZAJIgJAMAUiAQxAQCYApEgJgAAUyASxAQA YApEgpgAAEyBSE4kpukV6dMbaYNo+x3bKL/VNt5H292U7zf3rr8t69a8HXe4NlXH3bfpPs+Ez4dS nt367t6MeTTls5aH6Xnx5y38zpHSLsumlk4tjWuebKd7c/9KvufyPLhOmu4+DLev5VOpjOSWIybE 9AU5rYVuvJh3iMkVeneBjdtp9Qsq3sfm8Vz7J447lNqtax8XU/vY1hTu7344p6BcWsuV85T24G9X 4cznWS6XlVHNDYLptHd9cM77tpxGt6yV5afiOsjtX833Up533Ucr/qfKSOZvxISYviomV/i6nZWR E5Mr8O6i7jItkz1iGpxIqgSWXijJxe7vmHeI9nRiiipY34L0502ex+UGozmGlLbSnpSXRQp6Gm/9 sNxY1ba0s2JS8r1pynmutVz/sozkllsEkZxSTGtXxygZUaFPLY98gVya+mP3g+86iboDCmIq3Ykt 23Z3unFXk3JHG9zh0WJaKj+1MnT5I7qMlspozPP2UYnv79Y1LabHer4Ml9Loy3ttecntX833NpPn j+tj6G/LdfeJm4JnykhuOWJCTF8S09xikl0ZotshVyDHvuvHhda168WttXhKYurbfCUgK9F4//FF sxxz1D9/9jGmp8WUjC/OZWAU/nQj4CtKy/lXK6agG68ijb5sb4317BJTp+d5eK08jufNY0yIiTj8 GFNQyRfEJAv6cqfXNIUJELkWk/ss02LKDMDntjd2lxykC+pblU7aHZM513NlGG/LSmW0tmSicaEK McXjpjVpXMrlMvgfxyryuq48ZVJBRkD99btiyh1rTdlBTIjpT8UUt2rGZaLQynXi8SZtH74VVBLT 8LhAl245WbEkY0mzwE4+lvRUpRMPYEeV4VThR5NflvXrxwYtpj0ua3qebJf/Z/Zfyvc4z/em51tl ZKvsICbE9EEp6d0K8VRbfZp3ODa1TIWVF2FuSvpc4JfvKJXA4C6maP/yzvlSOL5fIZg2H8z4ErJZ 8kxZplQ2Mo8t52tN2h2yG6+UxmB7FZVwvP+tfM/leVCmP3Bz9WwZKS1HTIgJAAAKIBLEBABgCkSC mAAATIFIEBMAgCkQCWICADAFIkFMAACmQCSICQDAFIgEMQEAmAKRICYAAFMgEsQEAGAKRIKYAABM gUgQEwCAKRAJYgIAMAUiQUwAAKZAJIgJAMAUiAQxAQCYApEgJgAAUyASxAQAYApEgpgAAEyBSBAT AIApEMmJxHQbhnvXXO6XSxRtv2Mb/b2dv9dch819tN1N+X5z7/rbsq62nZjh2qTHHR1D36b7Oxs+ H2ryLM6PNQ+n/NfPW/qZFVx6cse/pKPv7o2yTm75q/ks81iW0b8shzVpLR3rEcoCIjlZi2kqdGuB G0WxQ0yuQLuCPG6n7e7DcNvcx+bxXOv237dpZdM+Ko5b1z4uovaxnSnc3/1wXkG59G5VmFOerJWO z6vlM3HOfUVWI7u/THMggCYte9NNz3Tua/5+NZ9lHo95OOfpnn28//reTmvpWI9QFhDTycXkCmW3 swC6SsEVWleAu8xd4R4xDU4mVQJ7XEBzZaTJdGnJ7ZDsWcXk80fezd/6YanIg+U7Wq1m0p+rcCPh +nTmlr+Sz3Ee++tCXid/0WqqSWvuWI9UFhDJKcUUdoXJSj2+006+77sJRkn4br2oJVMQU+luctl2 +/i8u+mfKd0PtJhC+nZKf1wp+XN7Se6QH62Rdn+37p+KSTnOXIX7rDRK+Rzn8Zi3ohX3V93KNWnN HeuRygIiOXOLSXbviOZ97sL1XShduxZarcVTEtM0TqCLY7lzE9022gU3XDv1+78wxrRVYcq8y+WH 7Aqb7rCnGwF/g2I9D3Pn/1ti0vI4Hb/9m/GZKjFljvVIZQGRnHyMaVm+ISZ5kfpC2zRNYQJErsXk Psu0mAqDrr8inVfElJvcEq8rz0G8rb/qgtLSqB3/lpTDbixZ4UbLu7AFrglF21dNHo/XUqOPv34l 35Q8yK4vjtVqWUBMiGkpkHGrZlwmCrxcJx5v0vbh7zJLYvJ3wsng/B8OJh9JTDE5mecGv/eMDf6Z rPxxK2OcycC/HJNUlr8jn/Xu0r/Lwz1pjY/1SGUBkZx2ung8LrROA89P8w7vEJcpp6LwZ6ekzwV+ +Y42RuAqgmj/wdjSD0xs2CKYNh/IpdzKDL4XVVaydWL1Djn9uYCceRa2ctTynVlem89bebxs/49a SqlwLop0RAsyc6xHKAuIiR/YAgCYA5EgJgAAUyASxAQAYApEgpgAAEyBSBATAIApEAliAgAwBSJB TAAApkAkiAkAwBSIBDEBAJgCkSAmAABTIBLEBABgCkSCmAAATIFIEBMAgCkQCWICADAFIkFMAACm QCSICQDAFIgEMQEAmAKRICYAAFMgEsQEAGAKRHIiMd2G4d41l/vlEkXbF9dvrkPV9odrk277Uv99 2KZvfb42966/bZ4Hn/e3ob+30Xlpu5tSNvLbtZ72Uhp9nuwvy/q+4u1t5e9Xr/O+uzc7ykh8nEco C4jkZC2mqdCtBW68oDJiWta/9jsqj7Awu4ukRUzvOXddG1a0TXcfhptSObf3/rE8+Lvrx3/X89Qu //cVmeUbiKq0F9Lot1GTRllm3XeyN25ie1v7/t71rZ//OH3NnKZ4nSOUBQciObGYXKHsNgrgcG2r 75rGQj5XGFvCg/dVQOny9fy2OXktFdO+VrHltOfSuCyrFtOw5JlrpeVaPrnt/WXZj0WqHb8Tuzxu 93+3zpHKAiI5pZjCbralG+JRoMeCnemGWLoI3N1g6fOoiyDYJ7J6X+VcuJOfzoFeecvWx3TOHv9v j3N+aip+mcYtkTyTh6Xtafv+FjnpJGkTNyxeXkcqC4jkzC0m2WUhmvdaYZbLcxeevCiGa7d2D7h9 tumdO7xSAXX5CvNxLrtrvksm6MYb77CnGw1/g/JXleo70q6lcUskWxW91m1Y2t5fdePF12DuWk7H muf64EBlAZGcfIxJVmZbYtoaFC12ezDW9L5zWKhgw+7U9FzHrY14W7lz/xdp1CbP1Mgl16IKxoSi 1n1cSYdlPt/yjI/lr7uw06688gSGMR98eTFaFjQQyY+KSevC8Heq2oBwfsxjbS395Z3kWZB5P7aM OuU8LoPfipii1m44WK6XjaOkPZfGkkg29ymui5rt/WU3Xno+9THGID8v0USog5QFRHLa6eLKnfTG VNfBXYjaVGN596kKa/6soTvvFdLp+HL21Xo+g/Wi85Hr4vrrKc7vSnsujaU8Ke5LTuapyGMLN1/r +YylI7rsMtfjEcoCYuIHtgAA5kAkiAkAwBSIBDEBAJgCkSAmAABTIBLEBABgCkSCmAAATIFIEBMA gCkQCWICADAFIkFMAACmQCSICQDAFIgEMQEAmAKRICYAAFMgEsQEAGAKRIKYAABMgUgQEwCAKRAJ YgIAMAUiQUwAAKZAJIgJAMAUiMSgmIZrp76+OXz1NEEQxN8HYvoBMd2G/t5eWlVMAAC/ACI5UIvp Ngz3rtHuWpp712+LbJJe3bq1fGKbOfp2Tm/T3Yc3ifvWtfdL2z+1nky7vKH4dJ7syYfa9D1zXt+R Tss3Yp8+tlvf3Zs3luVvb/+TIJIDiWm6WJycwspguLbZyqG0rWf5xDZrxNBchw9UPJfNirtmvUkW eiX2zvzakw+l4/6Lc7g33854bD7fl5vMN4vj09v/FojEZFfeJVv5xGIqSWla970X1ie2WXfBNfe2 e/8+X2kx1eTLu/Nrbz7oLb2/OYeWytNfHFu8vfFaf2fr/8Pb/yaI5GCz8tLuvFVSY9N9vEN+FM5H 5TVWSmKdoLtpbub3j4ruMt9VD/7vuTCv31/vHEvbdCzdTOJO3e+ra8PlGtr3l+NSvpts2x/7fFGO y+dl6rGNFXc7tSySNEbL4vWC7ru1UgiWB/k1t2DmG4/1XKaV3958yOZ9MX3zOdTSq5SV+PxVrePL 5EXvfowr0zgNS6tPlFWXd2NexOe1cO6TPJLbdn+reeCPLV3P3xwk+46uweQmIb52tDzTjqXiGqrd vnbcVWWpcAx78gExnVZMeovJ3027Aur+HR4VYXrRu/+vcpsqyLWVpnUVymX5bd6Cu3Nf6bbduq/x 2Ar99vr3w7SFebFW9LKiaK59sM/StqeLeTqesbITF5tMt7ZekHZRwcrlcX5NF6z4f9clLd69+bA3 ffExaenVykp8/mrW8V2PWrmKxVRKg+9B6Nu1ou5EWfd5o5378vUTdmkG51wemztv4gahVfc9qJ95 krIwl9/cdbEeS901VLt97bi3y1L5HO/JB8T0A2LSW1PphZVUAqKZHy4Pt7/e8W5vc5LCWsh9Ic3t S7tL075frJCjAd61Igy7MbLHJi9C+XecbmW9NN/Kf8cX/niMmZbP3nzYkz71mArnuVxWatbJ353X lZ+15dI/RNK6iq/rx20FrUjZEip0Ycn878T+inmgiEnfd3gN5tK6iCNzXaTHsn0N1W5fO+6qsrRj e6V8QEw/IiZ/0SwDn5kKaK+Ywu6SCtmJu3NfwJe7qwox5b6/R0zaPkvblhW3vNtL0q2s96yY1pZm 5gbjmXzYkb74mLbO80ti2rhjrik/y7G77ry5wiuJelNMcxlv264+DyIxuePslH3H1+DT4kiO5b1i Kp6TndfxsDMfENPJxJSfLj4VnMG1Fi6yuR3etQxiPMn3CS8VcdzXLsecgv7u/DbXCnfdtlwW70tD +77sc08qoXgMIz4OrR9cblt+XxvL8ekurSfzKvo7d+eYay09mw970pctFyK9XUVZ2VWeouOSd+Nb 5cfnV7fIKOx+i7/TV4xlxrMbt/JAdhurY0w+7dE1WOrR2MxXcSxtxTVUu/1SPpfK0p7tlfIBMfFI otNz1N9qlGZTnur8dH3Yur72p08zvA4iQUzHrfSiSRxHQN51/gLB7K4v/RAbjg8iQUwAAKZAJIgJ AMAUiAQxAQCYApEgJgAAUyCSg4jp2d8DvAv5mxIAgE+CSA4gptqnYH+K+PlgAACfBJHQYqriU0/3 BgCIQSQGxVT9lGjlCb5bT1ruMk9X1r8bPmkCMQHAN0AkxsS06ynR0RN8a560nHu6cu4JwVJaiAkA vgEiMSam/U+JLjzzLPOkZe3pytp3ax4eCgDwbhCJxRZT9VOwwyf41j5pOfd05fQJwU30wFIeKQMA nweRGB9jKj4FW3mCb+2TluOnK2vfjZ+o/CvPdwOAvwWR8ANbAABTIBLEBABgCkSCmAAATIFIEBMA gCkQCWICADAFIkFMAACmQCSICQDAFIgEMQEAmAKRICYAAFMgEsQEAGAKRIKYAABMgUgQEwCAKRAJ YgIAMAUiQUwAAKZAJIgJAMAUiAQxAQCYApEgJgAAUyASxAQAYApEgpgAAEyBSBATAIApEAliAgAw BSJBTAAApkAknxXTfx7xP4IgCKI+EMkHxUQQBEEQiIkgCIIgEBNBEASBmAiCIAgCMREEQRCIiSAI giAQE0EQBIGYCIIgCAIxEQRBEIiJIAiCIBATQRAEgZgIgiAIAjERBEEQBGIiCIIgEBNBEARBICaC IAgCMREEQRAEYiIIgiAQE0EQBEEgJoIgCAIxEQRBEARiIgiCIBATmUAQBEEgJoIgCIJATARBEARi IgiCIAjERBAEQSAmgiAIgkBMBEEQBGIiCIIgCMREEARBICaCIAiCQEwEQRAEQSYQBEEQiIkgCIIg EBNBEASBmAiCIAgCMREEQRCIiSAIgiAQE0EQBIGYCIIgCAIxEQRBEIiJIAiCIBATQRAEQSAmgiAI AjERBEEQBGIiCIIgEBNBEARBICaCIAgCMREEQRAEYiIIgiAQE0EQBEEgJoIgCAIxEQRBEARiIgiC IAjERBAEQSAmgiAIgkBMBEEQBGIiCIIgCMREEARBICaCIAiCQEwEQRAEYiIIgiAIxEQQBEEgJoIg CIJATARBEASBmAiCIAjERBAEQRCIiSAIgkBMBEEQBIGYCIIgCMREEARBEIiJIAiCQEwEQRAEgZgI giAIxEQQBEEQiIkgCIIgEBNBEASBmAiCIAgCMREEQRCIiSAIgiAQE0EQBIGYCIIgCAIxEQRBEIiJ IAiCIBATQRAEgZgIgiAIAjERBEEQBGIiCIIgEBNBEARBICaCIAgCMREEQRAEYiIIgiAQE0EQBEEg JoIgCAIxEQRBEARiIgiCIBATQRAEQSAmgiAIgkBMBEEQBGIiCIIgCMREEARBICaCIAiCQEwEQRAE YiIIgiAIxEQQBEEgJoIgCIJATARBEARiIhMIgiAIxEQQBEEQiIkgCIJATARBEASBmAiCIAjERBAE QRCIiSAIgkBMBEEQBIGYCIIgiN+J/wMNsa0/RmSIYwAAAABJRU5ErkJggk== ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/header.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252"





All Res. J. Biol<= /i>, 2011, 2, 1-7

PAGE

 

<= span style=3D'mso-element:field-begin'>PAGE <= ![endif]--><= span style=3D'mso-no-proof:yes'>3<= o:p>

= Issue 1, Vol. 2, 2011, 1-7

2

 

All Res. J. Biol, 2011, 2, 1-7

------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/image008.png Content-Transfer-Encoding: base64 Content-Type: image/png iVBORw0KGgoAAAANSUhEUgAAAjcAAACOCAMAAAD6rNkIAAADAFBMVEVganZ2fIjz9+5XY3CmqLC4 1ZR9go2VxGLI3qyMkJrb293Q4riLj5nu9eZpcX1jbHmAu0X0+O+eoanr8+Csz4W6u8F4f4qbnqeJ jZfd3N/z8vO2t73k5OZ0e4a+2J3Kys+z0oz8/fmhyXWvsbebx2t/ukTW5sGNwVbc6crn5+mIvlBY ZHHS0tbj7dSTl6C815qGvU2+wMWPkpxbZnNtdIB7gYyQwln4+/Zlbnrd6s3AwcaGipTM4LKoqrLl 79nFxcvp8N23uL7B2qLCwsi11JHJyc6goqqDiJOCvEheaXXV1NiRlJ79/v3O4bVncHzZ2dy+v8Tb 6Mmkpq+8vcKWxGPH3Knx9urg7NHD2qTr8+NudYGztLqxsrmSw12qzoGIvk6WmqOBu0edn6itrraq rLSFipSOwVdzeYW3ub+ky3qeyG/T09d+ukLK36/L37B9ukLGxsvp6erA2Z+Gvkvi7dP29fZVYm+f yXDZ58av0IimzHz9/f749/jDxMnt7e6AhZDf3+H6+frx8PH9/fx8uUKxs7r4+PhkbXpcZ3Tr6+xZ ZXLR0dXQ0dRrc39xeITHyMzR0tWYm6T39/Zwd4Pg4OLi4uRudoGCh5Jmb3vX19rw7/C9vsTW1trq 6uvs6+3ExMlxeIPz8/TOztLGx8xdaHRvdoLj4+WipKxqc3/6/Pj1+PCZnKXPz9Pe3uBqcn6ipa3W 1tlaZXKVmKF+hI+qrLPk4+V6gIuvsbjNztLi4eOSlp+QlJ2RlZ+LkJrLy9CHjJdsc3/NzdF/hZCs rrWHi5Zrcn6anabX19uho6xfanaur7aEiZSXmqOjpa2BhpG7u8G0tbtzeobo6OmWmaKVmKL3+/Nh a3esrbWipK2nzH72+fGMv1OanaWys7rY2NuCh5HY58WeyHC4ucDJ3q6PwVmYxWXY58Pk7tf09fbR 47mlp6+lzHyjpq7s9OTV1di61peMv1SeyHHT5Lzh7NHE3KaDiZN9ukOTw2CUw2D39/ja6MbIyc33 +/TV5b5VYW7///8KlG9UAAAAAWJLR0QAiAUdSAAAAAxjbVBQSkNtcDA3MTIAAAADSABzvAAAHVpJ REFUeF7tXQt8lMW1T7KEBooJiiYQDKm2NIVUFDZpo6ioCJLWG7GmVoNtr3jVVtu7YTfZvEhCHiQh EF4RCJT3S6A8RDAIRoKoFBVFqkZb29vW1raxt9yHl/vydr57zsy3u9/7m918LEl25qdL9vvOnJk5 579nzrzOxEkiCQmEL4G48LOIHEICksCNAEEkEhC4iURqIo/AjcBAJBIQuIlEaiKPwI3AQCQSELiJ RGoij8CNwEAkEhC4iURqIo/AjcBAJBIQuIlEaiKPwI3AQCQS4MTNmIemxBfEpey48MGM+kiKUefZ cvzpNUUpPcmd75ydwMetacmbd61u7klOffYqzhx8fAVVhBLgwc28W1LdJJD8yS88H2FZcrbhZ3Jc QXY9b0yusmV39enN2cocDbY5BMFFloA9bupPdwR1xv7Ifmt55LV6ritfwy5+mjW3LQfywswRee1E Tk4J2OLmph0apeHXlrRIe6uxBXp22ZPWWdQ2M8Mgx7M1nO0TZBdHAna4mRvqUlTqix8TUX1WGIAQ HsUvMOV2JNRFKvNa5IioYiJTeBKwxk1dl7Ge4Wny+fAKotTPmrHL2WfC7YDfJEtbZMCNoNIii4EE rHEzyRQ2hBQMD1ugc83ZtT9nyM0wB4PS6g1hl+9khqTKLI+vFzmW+xIlKSGr0EnuwMvrodwdTBW+ UZzc7FtjiZshFrAhZOlGzloEyM6a2Q4sZqlRV5VmVYELl3BYlVDmweTFppV5KlHLvjClYUOe4GPc nUvlHk8JJzd9a0p80EhFssJNZqslbsgIzlrIZDtTLNklF2vZbXzFuvz3wyvfQeqEQo/H5/N48Pc7 yuNJkqQsT4WD/IFVEuPuYKrwZPFy07emwuPhxU36Umu1Edc03npQuik27A7OVA/SphfZZOi5Oqzy HSRO9HgqwCDQron+NsP4LXNWg1oxqZyTmoMsDAPGWlOSoOCa5Snjxc3LNmoj5PGVHPUNkPzMxnpB aUVDjgYmAesn/8aqV2NVOxVG8U6SglwLpV5qZ2RLE8Zvma8izIolOthXhWHAaGt6KXDlBNVR95rm /VT9q7a4IbP5hECpztizI2R7/Iunrpg591htAQe1v3lRGOU7SFrp8ZRL8IE/yBL8W+JwRgqVDoLq C3BJKATfWpnAiiVICRQ8SQbubGL43lRlwGLo8uoKoK0pxJ43UC8d6Mxx8wMOzXXarxEEhFGvnfTl YG9L8hMHwcDJqqS8HCxNVjnanHIATiL7bQackSQYBI3ywvOEJC/tZEpABQnwACTvhcRKCX0Z5fWi G+NlSkVCyYveK2rNC9CEBz4EppwSgLy3F32qCmCGuE3yUqtHE74txyJK2DuoCeUO/yYxA4Z/6/LK BQBfWlvaml7siksC9ZIqWJ8cSua4WWOrNULcZtMu6kLwW7F9t8NRoIZkir6ci/kkwQv+sDKBCfF5 wFJUBsQKaMKeyyuVgNdMf7ColAp4ABjAxCAQ/OKFRz7ASRbzWcuAMAkhBFasF98BcABjQWQgV/gP 1CkP50ZhhQIeufwWy2NcISuzWPidmUeEqCavXIBcdaggtAbKh1QWqBdtEh9uJvTwqHEht5o+4WEX Ls3SqA7FkxALquRllob1JwwQhVTnoxhpCajMlwCve+F/TIVUd8EvkLvQB34E/IuzNWAKysHSABDR iuFDT1YJICPwWwcQloEdKAQaTACNQo8P/mbD6wSYUMJxXgKQQGJc4Ts67VlZ+IAmXV65gAqACeRg vSOtvy9Jrhc+0gzuTO3NNi4dTuXGzWgzfn2xQ1EdUeEPtdBbXg4q6C2HH2llOeiLGnD4wn7LIF8v 1XkFKJUOYCrBGgB24P+sXmoDMAW/wCilHP2OSg81OF74AOxQ+wPgoSM1QGFWAJVeKAyLQHz5ZEOC umVGDMhLwGJVYEeEVgWYFCYAZsrLoAT4l00j6vIGCkCGFQgu2hp4CtWQ6wV40s5qmuLmMBduNtfx Aieei1+YRK5IFjt4a6yhA/3Q+WHQAHQMoBf8QoECP2H5t0xFjj0XVTX0OhQFiJ1eD1irwLRb4Au8 xQRQ80Ef00t7A8QO/u6BllqeUb5EhItsKpLovA48wx4NUcssivzWi/XpBVTSWgJ3MBLwAJklBqh0 eeUCENxQdag2bU0iLVOuF1Qq5ESxwkxxY7ICqVFsB+9kf0NOmJDgI38pQhBEkA3MDP1dg28C6oA+ gVkOAAooSF4SqGS9Qwloq5zqEH/28C9mpH5LILEvoNyysjKmEgACHZoVIiCoFWOWh5GxfGwYhwqF dyxTVllZhdyF4FvEDPWxQe80G9QG/lPNS+rzIiWaPbCIgdYEHRoK0ATd1LUpbl7gUlzcUU4N1J2g /PrSKRlV6Dhn8X0nA4RQ/5P2ArT3wDELGHIvgkMeKEHn1Ut7HJgTBB/aB4r1oC+Nr4EqMTCekr8A F3jk7YVxEPgkXqCoAFRWeNGP8ZYwtr1eykjGDbo38AqhVAnlA4hwkMY6ScgJfWgi5Y3sgHulF7wn oE1kbBkXTV65AGyQL9gaNKreBLleUomMbYUUTXFjN7vLtLidd0BVtfRi4Ma/pO+A4OQAXQL99cO/ 8PsGudIOhv5D16qoLQKbRB/LHUhwFIWvWRZ5SC1/YfQeOrzyJcgjHWBAuVK28qCKVVIehoFlAGTh SzpgCkzJsbcliGxIWQlybUoAxEoybV6ZQ9DnDxWL8wBYLyhXN11kipt3bewNsxxxT3GKXTrJZb/C JGqJ3mYKEGfI3GA/AKoZRfGRiNoroz/mEjA2FFdgCTw+wA888FSASvA1ZmFkkNgXHCwBAX4pLJFw sbQMntAxlC+JsqVj68CcIHDzgVHw0clApAMHBDXLurOSLFgyw04sCQotw4UC5AU9KND6oKIBr1yT Vy5AJpJbg8Vmlcj1Cs7i8NibN7lUmDePFzdc08VcZSqI9qfzFt9nOtAp6pyZG+OU4K0sK0OdVQbQ 0edS+RmUJ4KrBB1NmWbimZ+DBSVOcKqTqb25ikuH7U289bqdi1+YRG/xlt53OvQYAoMpE9iEJgUd XI7krLncY6H54szRNzJT3Kw12SAqa1Z2cNdwl77AeL9nmEDRkN/CXXyfCXEGFTsU6O5NEpiiQuxm ysp0o48+l27HAHwaH5ob+HB6t5dx0aa4SbfbxUBV+LJdg0Lvh/JBpCVv//6CuNCxF6tcrWv5i+8z JZuFVawVaTnS1UDdQk6fy+ViEFgGjRpizdeneAZUrWHsFT3LgZvVK6ZfXb9lS/rG5YcPcdinXP5l VS7pWxNRV9hixxxiCqySdobMgZLtWdCpQahg1Bwrc9xM59BzfBjrQysft2O44+yfFRJ6ptuO3pVp L1AnKRJwYcE8FcJkCjimTpbIzQvm9iqgn7wYPnGY/ZRUv99Ob4T8gLthQLjJht8w7Zmoj2yWVl8J p/SLT8uWEaPjXuhaQ31ytmoalWSxv/hXtrgpCm8Y/KIVQ9cQfXuftNw6lrIqKhLiLwTmTQovEWyk BLA2FdGDjVX84r22iwJhbpuq2WwOHNcRI/3ss3DOXZP5NSoonZaAhb0pbbcxOGH3E2PYIlUoBZHp fsi4YQvOmdXB/w9Oi0LwC0MCVudgzA9rUmUWhR9RZIzJqrj7KrMqbzAZvrc+EkYjBanjErDCzeuW 9qYgksmTBbuMeLZa+Ndbuoy6yw7RSTkOhbAYWuHGciS+/xthlRMgXqs/fOf3f9GS1VmdkfJP7W8u cUSyGMiZrHDzkoW96TSPIGEtjun6Y1RdNgKsebNNWRP3oekDWeKDo+5WuJlhipu4W7jXM3Vi0p35 LrKKfsOy10+f1N7i8hNXa96aW+4ZHJIf2K2wwo3ZknjriL6orj5ZA8f7uCQ4/7nF26YdH17PRSyI LrYErHBzhaG96Tm2uG+VelrNln8rRt+KFbmdlIAVboyGwBlH+nyYf99BFXC+5WRzBK8oScACN2Na dPYmdTb3uReL+i9V8o324mSU5DrYi7HAzUwtbFqGOIEaSVItdG8Pf/ZwsOtkILTPHDc1BRrcpCxz qEGqKH8dpQ5xFWyiKQFz3GjD3/RsdapeqpF423yn2Ao+UZSAKW4maMyNy3QJKezaqnBzQuAmbAH2 gwymuBmh6aWGOVdZ1RHiZIEb5yQbPU5muNGGFehxcEVomBKScfazxdGThiiJVwImuHlfewpmEi9D DrpOJW6ieiaBo3KChEsChrip0e28cf+MixsXUb16SXwsVyZB1L8kYICb+of0u6v4z9fZN09zIOYN +xyCot9JQIebo0OM9uS9bVHxeZ899PRPV8w9PHkB36mYXLXHffCeficUUSFbCWhwkznsNaPFzIOm ca3mzbmrJ7Ahzx3/NMcewJu0rlO3bSUFQb+TgAo3mbUmh8LzTK57mjeTRpd15ed19ND9WO7Rdovl i3Q7Rf1hHovodzKMxQopcDOhyzSUQI7xgdof7AeoFLy48BuL0tPX7Zu94hwc63ZbX2nWcEFvz/Ii 3TsYiwrrJ20O4aZau59KoeAdRrVNx3mYzrOK+ZeGxS/Aqe7Hn7Rom+Gp8x07+4k0RDV4JRDEzdtW 5/jbDBbCJ8A0TMdYrSu8GDbtpBSblj7JeOvpUuPbp3gbIeiiLoEAbsZahrtJ0W922AiBZQ8ZRGmr S/OT/G0m7TDeQQhYOneJblqIurwHS4EybrZZRw3J3qttbx34Ka+EtkA0vPfee/93NyN6xEVSjOOb PGS60Z3UOrO1Z7Copd+3g+Fmp/aqZ62CX9c2BCzHG4qdM9/58MMPv/RLmeh1F8kw2j9+3AqcK/q9 qEQFFRJguJlqbgjYm1qN0J5vJY8rFyTvhSgaj10eIDpFyFy9lNdZhr52iUNRAwmYFDefWcfyA9zk qz2Zuk7iVk3UfAVw87UgbubHE/c/6aRg6twwaIYZFGUgCXkQ1pXihiP0njo6DZwAflYlDDVupOPZ 5AWtsFbl2xg1EWBiAOELcbPWIAqj9jB/vGrmr5Zo9uNocCOtIT0/10jBxtwQkiN2cA0c4CBujK7w 0OKmVRlGYGc+OaZuohY3xS6iCYRUr9l3qjc+fvNpn4Ejz1ipKeDmOdPYRErdKkMFX0VcM6xxU5dD TqoptjEkWsXwOhMrQh8E7QTcbNOfrzPwRJQ3lL1ItAHutfZG6iId6g2gHHH7lw4CecZKEwA3Q+wG 4fT96pCDU/U40e7j0uHm18SlvnPD5g55LCJfTBoPGNgBblTbxE0xlBLyc+FE3q80DdThJtNFqpU0 VRn26GxdP2DEFvMVBdzU2msUKNyhLVmreoj2YgQdboa3EFWoxyaO28hdUby9LuYV30cBAG44Zm8A N67QFWH78rWDJUmHm1Vx5H1l1ZqS7dHpit7tdX2UmsgOuOG7UUyBmwVxuvs8dLh5Kp+o1rSq7ILa Aqyylwt9DBQJAG60JzONDYPiJMyEPHLazr/5aitRHww+ZDsMJ27eyzoHinAHcT0BNx/Y9yBAkRK6 uXd+EXnRDjc/IURtPf7evpSOyIMGDmIN9c+mAW6mH+S5Zlc5uXKSnNNsONb1UzPJa+q9XmPtcRPZ SaprLk+AtEcW79cvl3cB3X/jvX9lz+6+/L3+KfuBXCvAzVMcrgchUxStHEJaNBuzdLjpJOfUO7HG mGy+UUwg6zb5cAn2jlkjR44cP/KJr1DqL328G/+5tXLW+P8c/5fL8O9P8YJUkZyVAOCmwSaePjMU Sm/lSZd2IH6jah+FJC1oIdpVA81xO/2SgzuyYw3X+r79+98n3Tl+IoLkspG/QPn8cVbWf9z7x4rG 330dvvzYc6+zMhPcJHofzEu222+Iv2OjQlor28nSlSrpPYC4Cez3gzdzSbb2VIPuvjvtUlVkl6z+ cuK1tCYPNH4ZAeP5Nnxe9/C19EqdKxt/i5+z7headloCiJsq2GJul06pCv4WIbcHH+z2Jn5vFuDm CdmzgBfzUkiq9sjVStUtQvr1zQhnb0oar6c1ubnxRvgc5/lUknYXTmRbyH7bOA7M6YcfhyrmtPhi lh/dt2V/9WWceog8oZmcCC5b7v6Q3Vj6+5AQIYKfPjyXzcWLoyPTwY8b6aXL13xMsXLt98HQfLlR vuPyuka4OPC2H1VExlnkspAAxU2DKiKNkemZqWEBYZWCG/52f43C5nvUIaWpuJV0GoypLSeK8iI8 QlUxctQ113z9Tz8c/+9Q8O6JTyB4bpAvfrsR7c3fPH8nEOC4BNi+9Ge2W/dTRdrz4StTiWuOXJnd /z1+5KzCB0Kw2VdAWozObG60uO8uO8Jt6Xd/3PjYH/4w8UcfYy8l/elHYGDuf5h5PJL0+UaAzDjP bY5LTTCUz0/NscRNi34BYEwzccu3Rt1926fX/TWEGgkvNzS+vk59+5TSxXGZ3Hdnq6AHZ318551f +OGsLDoMv9nzN0m6t/EBOVti461gfT7EQZVIzkpAxo2ku6VFASTXRwZlwm4vt+GdmIvh0h+znXvD TY7CHIwUNtLfGm/Gyt068V/RvfnCyAfRQ2ZTOZL0X9/dLe3+fsD6OCu4GOcWwI30rqnFyTZW6n2w TXCKfqfVwjhCjpkGUFpluPheoNqqE5ZGrm9kd3rfiaZF+hwARbqjUe6YPsWh1nUe8HFEcloCQdxI M022/vaYhacphkOeu46or4LOhOVLl9aJVta5bojuUnD/6D7EKv23iWyF4crxYGkue/hK+POOxj+x Ev/yMDz7sSdgfZwWXUzzC+FGmm146fIh8xBaw3HHV86pZbLTXLr+cC7MIObYXH25IE21FWf71L4c Y9gj90IPzvod2Lg/enAA3tt4B1XpzfTfilnB44AxrWiHG6/AjVSTprv8MmehZXlvI9T8zbnDfpp2 bE0bHsOKO2O/SXjd2WGb87P9fpd7/5ohkS0uBGr1ncbEPXv2/PXzj92ANmac5zr4vOyGG+69Rrr/ jsYrcb7vu5+7HCj27BHOsaPIUeIG4gucXqpYc3B3HrG7Xq7+oU7FeqU/J40TBk0bnsmcsWTnlr62 5YHGxvGYnqBezpceprald1bj1wpnjUy8Bv4e5fHAsicsfFL3WSSnJKDGjSQ1LfmgO76to6Coc8oj xsFItCWPefnF1Jy85v3nHp15POp3u/zvuOuvv37cP6JPDOnbMjhu/Zdf/OJ69uzBcUgBaZRTEhN8 UAJa3OCzqtL0dPWypZ2sSuvr/8wXhNaOk3g/MCRghJuBUXNRy0spAYGbSyn9gVu2wM3A1d2lrLnA zaWU/sAtW+Bm4OruUtZc4OZSSn/glg24WVUcA6mac0Jy4GoyujUH3GyZFwPp5+r11+gKeRCWJvqp QajUKDRJ4CYKQh6ERQjcDEKlRqFJAjdREPIgLELgZhAqNQpNAtw0lcoJAgGsxHXwKvrZID8NrXOX ymei5pcGzmKG/sKqVmEO9kqVed097F6yKsqAfdaVUr51irKlLcOfUh3ylLmvfI5tKGwoxUgFVfhJ S2IVayil4bKb5AX8JnkrR92WUL033KO/BikKoh3URQBu0vLy8l5ty8trHivVp/4GWluTgRFFXmor aMYUjFS8tS2eKfDZosCG4G+2K0/Lrd1RkJLX/izOlOzNYZlhz2jVkDjiP3QPPFzbhrd91ORgzP4j bTSY35HmvLxdr0LZcLzzbAHcQ7VMIe132vDWcriMsWUFbvDauwvPTwxvg3NbY9oLUprbu/AOiK1t O5B32lAK6g3xbezeiKt2BbafblnhJtndVw9qLUa/cYCbw7m5ndmkM7dzslQT14bCb1kNn9WkoxZT MFD6GeKfTSv4FtknV3SoXzmdtpcUjO4+R5LhWTHJo5khYt/rJP6DKaQALgZZQvAs7wZ6SuY0oQft 7oOyXdm5ubnV0nHXrtNn3K2KgNprCGCg2t+x4jf0todicgV8niefwDlB0jG6O4OkAK6qCZkEj7vz qNn5iBB2IdHL5KxcxyvIyQPdZHMo7FP0hTwIS2T+TdXq7bSHqElBxCyKwyBJ0zSnoEpP7IjrptQX XAG01LYq74lZQoPkvIlBapdRZdKUkQJTbu+3AOQWk2HI3f9T+DwQDFNbl1xE6Y4R2F84reVASMhT IWRXXbwbHtf6AUHLyNPw7hkC5mo95XSEdEGO7M7XwJiMSKa4eaX5RBvtsY6QwDGMgs3wdUV+KKxl qADxV8QSYLipK9pOoxzVpOANrDUybt5RcX2ezJnaQ/cbm+MGtfkUBsVeFrrAYXMKdDINuOfUGDfz k3NoOcMQN9JwRbQlxM0q16PwdDKBszUq3IyApxsPdoIV8r/ugmiDwyhu1uUPe588r8ZNCuKmXiwz RAwRw4wMN/OLttOfK9ibhoaqDTJujoHzGbqj5Yxr5+1kmjVu4PcPv3SwJ8vIC4HMp0gu1aQZbkqT 2S3TV5Ed09WxTxA328i3EE3+CxrcoGWbjfammDx5qDldtjezyU/2+WnAgy8G7c0I0m1+lMdZYcYQ Nw1uClpXr16d48oACUwjLXnNzcGA+vN37ZCOZuPP3NzeuNrTzkx1vQq/7WV+mhnHNDVwmd5QeqZK aW/+mWySpRzADV7omjFHGdwNcfM2PWq+0x2vxo1rR9qK7uxm8G+KyfptEIyH9VMjDu6UcnZhRxXq p3ZCCIRHM2NIpVFpqhY3LYcOHcrNPkdxU1BbezJ47eVXSZokxb+GYbdM+6nsgyl+0oWD7mV+8ItP rmD24z4Ik/JNAIQaN4GzvQHcwLV7cNfrUMXxK8TNEfI2cLh6OyBZ2U+1tqa4yAi8AaKY7K3KWc36 qfqUVBhZ+TEWRgg30spfLzW8tzEq8h2shWj7KfRv6uV+KujaYuNnEvjNDqGjIHP/prt0NvZSqGN0 dYJpWTxGWGe42Sj7xVp7g8TLLygvtkLcfETDZx/NzoV7a6hfvJ75xVNLi1kRxWQrDNmWdyFuqvHd S3REpcANTO7MPsF6WJGckoDOv0HNBvwbRSFN50hGamoRHUmb4wa6sVzXVzW4wR0MNfmg+OU07PHP zXCDPnfV5teoR7WlGGwJ4mY5RcFyHIhnUtw8iSEp15NuvFcCrylH3MzLf2US4qaLFKWmxpMcmPsL 4aYJJ3bW+jUXrTklv1jlY4SbwDj8XYVQzmfvGpqbOzSuB+ZBLrgCd8PUtiqnRej8zGL/UOidlgXj 1m4cSn2iFMDNKj94KdJnNBbpARK4jEHup5q6aETA1Hw6fzcH7RPODtX0tMPXT7C3WktwaPURTsxQ 3Dzj2gyeDOJGOuV+A25ZLC2IwzoWufYibuR+cFU89K/SPJfAjaMQl3GT0yKPp3AuZVE+Dl03kc6F mEAtkJ5mAfvm4jDlgv+Thb9euBAmfGtdnyAJ6AnTEtQmXK0JJNtIPM2cKaW3k7lPrTqDYKnKJS9P ePKcC6d5D5B38D2MoEoLTiBgGkaQEcMnHJYjse8lqQs+c7cBhiaR0/OO9+SB25Ne5Bo74fiuOJit WU9egSwjEE3FOO4+6n6taL70POvkqnGYBXM7yH9yw7wO/+Grx4wmNzkqtphnZmVvWEQc6kU0ndtO 13jOu+6CyTUWXx3syBpGgrO5FDfYiy13r64Bv5i9Aeox9BrGNbhudL6AuIifXg38CXsPcdcDfvE6 8Ir9pF1ewjgDL7Nx6m5eBuRpoeOxGT3w50GM8kXtjbRg+6sbmb2ByZ/2+RD7ia4trEspqAfc0ARo WrIf/5iiHKjFvNb7LgB5vnjrMjr0qctEJfzPDDQgi6ZVb9pUXV19D76Yv43NwTTNyAStTaMvYBB8 ntJsoiSgsGl0omTr9BppY3E1klQ/A99Lx154aw5bEt2ZljGF9U9Hp+Hraiio4bg8vSPdNHroLcFA gmNzRzDK+ls6u86zAoa/k/EuXfaoZyUtnr4RqolZNkzbWiUtLmaLmour06XnKP9N8FRa9PrJR+9j DERySgJiH4VTkowtPgI3saVvp1orcOOUJGOLj8BNbOnbqdYK3DglydjiI3ATW/p2qrUCN05JMrb4 CNzElr6daq3AjVOSjC0+AjexpW+nWitw45QkY4uPwE1s6dup1grcOCXJ2OLz/+KqngEk/LpDAAAA AElFTkSuQmCC ------=_NextPart_01CC82DD.F65216E0 Content-Location: file:///C:/0ECBB227/Sarkar-LayoutEditing_files/filelist.xml Content-Transfer-Encoding: quoted-printable Content-Type: text/xml; charset="utf-8" ------=_NextPart_01CC82DD.F65216E0--

This website is optimized for the last versions of Internet Explorer (V. 7 or higher) and Firefox. We therefore advise to download (or upgrade your internet browser to) IE 7 or Firefox. All rights reserved to The All Results Journals (c).


To help promote The All Results Journals:Biol (ISSN:2172-4784) you can now download our poster and display it in your library, common room, office or laboratory.